Early-Life Maternal Deprivation Predicts Stronger Sickness Behaviour and Reduced Immune Responses to Acute Endotoxaemia in a Pig Model
Abstract
1. Introduction
2. Results
2.1. Sickness Behaviour
2.2. Cytokine and Hormone Analysis
2.3. Brain mRNA Expression
2.3.1. Hypothalamus
2.3.2. Amygdala
3. Discussion
4. Materials and Methods
4.1. Animals and Experimental Design
4.2. Behavioural Observations
4.3. Blood and Tissue Sampling
4.4. Cytokine and Hormone Assays
4.5. RNA Extraction and Quantification of Transcripts
4.6. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
C | Control pigs |
CD14 | Cluster of differentiation 14 |
cDNA | Complementary DNA |
CNS | Central nervous system |
CRHR1 | Corticotropin-releasing hormone receptor 1 |
CRHR2 | Corticotropin-releasing hormone receptor 2 |
CV | Coefficients of variance |
DA | Deprivation alone |
DG | Deprivation in a group of littermates |
DNA | Deoxyribonucleic acid |
EDTA | Ethylenediaminetetraacetic acid |
GR | Glucocorticoid receptor (gene-name NR3C1) |
HPA | Hypothalamic-pituitary-adrenal axis |
IL-1β | Interleukin-1 beta |
IL-6 | Interleukin-6 |
IL-10 | Interleukin-10 |
LPS | Lipopolysaccharide |
LS mean | Least squares mean |
MR | Mineralocorticoid receptor |
mRNA | Messenger RNA |
NF-кB | Nuclear factor kappa B |
NR3C1 | Nuclear receptor subfamily 3 group C member 1 (alias GR) |
NR3C2 | Nuclear receptor subfamily 3 group C member 2 (alias MR) |
PCR | Polymerase chain reaction |
qPCR | Quantitative polymerase chain reaction |
RNA | Ribonucleic acid |
SE | Standard error |
TLR4 | Toll-like receptor 4 |
TNF-α | Tumour necrosis factor-alpha |
References
- Daskalakis, N.P.; Bagot, R.C.; Parker, K.J.; Vinkers, C.H.; de Kloet, E.R. The three-hit concept of vulnerability and resilience: Toward understanding adaptation to early-life adversity outcome. Psychoneuroendocrinology 2013, 38, 1858–1873. [Google Scholar] [CrossRef]
- Shonkoff, J.P. Capitalizing on advances in science to reduce the health consequences of early childhood adversity. JAMA Pediatr. 2016, 170, 1003–1007. [Google Scholar] [CrossRef] [PubMed]
- Maccari, S.; Krugers, H.J.; Morley-Fletcher, S.; Szyf, M.; Brunton, P.J. The consequences of early-life adversity: Neurobiological, behavioural and epigenetic adaptations. J. Neuroendocrinol. 2014, 26, 707–723. [Google Scholar] [CrossRef]
- Lu, A.; Petrullo, L.; Carrera, S.; Feder, J.; Schneider-Crease, I.; Snyder-Mackler, N. Developmental responses to early-life adversity: Evolutionary and mechanistic perspectives. Evol. Anthropol. 2019, 28, 249–266. [Google Scholar] [CrossRef]
- Nusslock, R.; Miller, G.E. Early-life adversity and physical and emotional health across the lifespan: A neuroimmune network hypothesis. Biol. Psychiatry 2016, 80, 23–32. [Google Scholar] [CrossRef]
- Conrad, M.S.; Johnson, R.W. The domestic piglet: An important model for investigating the neurodevelopmental consequences of early life insults. Annu. Rev. Anim. Biosci. 2015, 3, 245–264. [Google Scholar] [CrossRef]
- Gimsa, U.; Tuchscherer, M.; Kanitz, E. Psychosocial stress and immunity-what can we learn from pig studies? Front. Behav. Neurosci. 2018, 12, 64. [Google Scholar] [CrossRef] [PubMed]
- Holm, I.E.; West, M.J. Hippocampus of the domestic pig: A stereological study of subdivisional volumes and neuron numbers. Hippocampus 1994, 4, 115–125. [Google Scholar] [CrossRef]
- Lind, N.M.; Moustgaard, A.; Jelsing, J.; Vajta, G.; Cumming, P.; Hansen, A.K. The use of pigs in neuroscience: Modeling brain disorders. Neurosci. Biobehav. Rev. 2007, 31, 728–751. [Google Scholar] [CrossRef]
- Dawson, H. A comparative assessment of the pig and human genomes: Structural and functional analysis of genes involved in immunity and inflammation. In The Minipig in Biomedical Research; McAnulty, P., Dayan, A., Ganderup, N.-C., Hastings, K., Eds.; CRC Press: London, UK, 2011; pp. 323–342. ISBN 978-1-4398-1118-4. [Google Scholar]
- Freeman, T.C.; Ivens, A.; Baillie, J.K.; Beraldi, D.; Barnett, M.W.; Dorward, D.; Downing, A.; Fairbairn, L.; Kapetanovic, R.; Raza, S.; et al. A gene expression atlas of the domestic pig. BMC Biol. 2012, 10, 90. [Google Scholar] [CrossRef]
- Mair, K.H.; Sedlak, C.; Käser, T.; Pasternak, A.; Levast, B.; Gerner, W.; Saalmüller, A.; Summerfield, A.; Gerdts, V.; Wilson, H.L.; et al. The porcine innate immune system: An update. Dev. Comp. Immunol. 2014, 45, 321–343. [Google Scholar] [CrossRef] [PubMed]
- Kanitz, E.; Otten, W.; Nürnberg, G.; Brüssow, K.P. Effects of age and maternal reactivity on the stress response of the pituitary-adrenocortical axis and the sympathetic nervous system in neonatal pigs. Anim. Sci. 1999, 68, 519–526. [Google Scholar] [CrossRef]
- Proudfoot, K.; Habing, G. Social stress as a cause of diseases in farm animals: Current knowledge and future directions. Vet. J. 2015, 206, 15–21. [Google Scholar] [CrossRef]
- Coutinho, A.E.; Chapman, K.E. The anti-inflammatory and immunosuppressive effects of glucocorticoids, recent developments and mechanistic insights. Mol. Cell. Endocrinol. 2011, 335, 2–13. [Google Scholar] [CrossRef]
- McEwen, B.S. Glucocorticoid-biogenic amine interactions in relation to mood and behavior. Biochem. Pharmacol. 1987, 36, 1755–1763. [Google Scholar] [CrossRef]
- Johnson, J.D.; O’Connor, K.A.; Deak, T.; Stark, M.; Watkins, L.R.; Maier, S.F. Prior stressor exposure sensitizes LPS-induced cytokine production. Brain Behav. Immun. 2002, 16, 461–476. [Google Scholar] [CrossRef]
- Besedovsky, H.O.; del Rey, A. Central and peripheral cytokines mediate immune-brain connectivity. Neurochem. Res. 2011, 36, 1–6. [Google Scholar] [CrossRef]
- Quan, N.; Avitsur, R.; Stark, J.L.; He, L.; Shah, M.; Caligiuri, M.; Padgett, D.A.; Marucha, P.T.; Sheridan, J.F. Social stress increases the susceptibility to endotoxic shock. J. Neuroimmunol. 2001, 115, 36–45. [Google Scholar] [CrossRef]
- Slavich, G.M.; Way, B.M.; Eisenberger, N.I.; Taylor, S.E. Neural sensitivity to social rejection is associated with inflammatory responses to social stress. Proc. Natl. Acad. Sci. USA 2010, 107, 14817–14822. [Google Scholar] [CrossRef]
- Tuchscherer, M.; Puppe, B.; Tuchscherer, A.; Kanitz, E. Psychosocial stress sensitizes neuroendocrine and inflammatory responses to Escherichia coli challenge in domestic piglets. Brain Behav. Immun. 2018, 68, 274–287. [Google Scholar] [CrossRef]
- Dantzer, R. Cytokine, sickness behavior, and depression. Immunol. Allergy Clin. N. Am. 2009, 29, 247–264. [Google Scholar] [CrossRef] [PubMed]
- Himmerich, H.; Fischer, J.; Bauer, K.; Kirkby, K.C.; Sack, U.; Krügel, U. Stress-induced cytokine changes in rats. Eur. Cytokine Netw. 2013, 24, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Yamakawa, K.; Matsunaga, M.; Isowa, T.; Kimura, K.; Kasugai, K.; Yoneda, M.; Kaneko, H.; Ohira, H. Transient responses of inflammatory cytokines in acute stress. Biol. Psychol. 2009, 82, 25–32. [Google Scholar] [CrossRef]
- Boissy, A.; Le Neindre, P. Behavioral, cardiac and cortisol responses to brief peer separation and reunion in cattle. Physiol. Behav. 1997, 61, 693–699. [Google Scholar] [CrossRef]
- Cacioppo, J.T.; Hawkley, L.C.; Norman, G.J.; Berntson, G.G. Social isolation. Ann. N. Y. Acad. Sci. 2011, 1231, 17–22. [Google Scholar] [CrossRef]
- Hawkley, L.C.; Cole, S.W.; Capitanio, J.P.; Norman, G.J.; Cacioppo, J.T. Effects of social isolation on glucocorticoid regulation in social mammals. Horm. Behav. 2012, 62, 314–323. [Google Scholar] [CrossRef]
- Farrell, M.R.; Holland, F.H.; Shansky, R.M.; Brenhouse, H.C. Sex-specific effects of early life stress on social interaction and prefrontal cortex dendritic morphology in young rats. Behav. Brain Res. 2016, 310, 119–125. [Google Scholar] [CrossRef]
- Spivey, J.M.; Shumake, J.; Colorado, R.A.; Conejo-Jimenez, N.; Gonzalez-Pardo, H.; Gonzalez-Lima, F. Adolescent female rats are more resistant than males to the effects of early stress on prefrontal cortex and impulsive behavior. Dev. Psychobiol. 2009, 51, 277–288. [Google Scholar] [CrossRef]
- Wei, Y.; Wang, G.; Wang, H.; He, J.; Zhang, N.; Wu, Z.; Xiao, L.; Yang, C. Sex-dependent impact of different degrees of maternal separation experience on OFT behavioral performances after adult chronic unpredictable mild stress exposure in rats. Physiol. Behav. 2018, 194, 153–161. [Google Scholar] [CrossRef]
- Raetz, C.R.H.; Whitfield, C. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 2002, 71, 635–700. [Google Scholar] [CrossRef]
- Rivest, S. Molecular insights on the cerebral innate immune system. Brain Behav. Immun. 2003, 17, 13–19. [Google Scholar] [CrossRef]
- Rohleder, N.; Schommer, N.C.; Hellhammer, D.H.; Engel, R.; Kirschbaum, C. Sex differences in glucocorticoid sensitivity of proinflammatory cytokine production after psychosocial stress. Psychosom. Med. 2001, 63, 966–972. [Google Scholar] [CrossRef] [PubMed]
- Kanitz, E.; Tuchscherer, M.; Puppe, B.; Tuchscherer, A.; Stabenow, B. Consequences of repeated early isolation in domestic piglets (Sus scrofa) on their behavioural, neuroendocrine, and immunological responses. Brain Behav. Immun. 2004, 18, 35–45. [Google Scholar] [CrossRef]
- Tuchscherer, M.; Kanitz, E.; Puppe, B.; Tuchscherer, A.; Stabenow, B. Effects of postnatal social isolation on hormonal and immune responses of pigs to an acute endotoxin challenge. Physiol. Behav. 2004, 82, 503–511. [Google Scholar] [CrossRef] [PubMed]
- Kanitz, E.; Puppe, B.; Tuchscherer, M.; Heberer, M.; Viergutz, T.; Tuchscherer, A. A single exposure to social isolation in domestic piglets activates behavioural arousal, neuroendocrine stress hormones, and stress-related gene expression in the brain. Physiol. Behav. 2009, 98, 176–185. [Google Scholar] [CrossRef] [PubMed]
- Tuchscherer, M.; Kanitz, E.; Puppe, B.; Tuchscherer, A.; Viergutz, T. Changes in endocrine and immune responses of neonatal pigs exposed to a psychosocial stressor. Res. Vet. Sci. 2009, 87, 380–388. [Google Scholar] [CrossRef]
- Kanitz, E.; Hameister, T.; Tuchscherer, M.; Tuchscherer, A.; Puppe, B. Social support attenuates the adverse consequences of social deprivation stress in domestic piglets. Horm. Behav. 2014, 65, 203–210. [Google Scholar] [CrossRef]
- Tuchscherer, M.; Kanitz, E.; Puppe, B.; Hameister, T.; Tuchscherer, A. Social support modulates splenocyte glucocorticoid sensitivity in piglets exposed to social deprivation stress. Physiol. Behav. 2014, 131, 25–32. [Google Scholar] [CrossRef]
- Johnson, R.W.; von Borell, E. Lipopolysaccharide-induced sickness behavior in pigs is inhibited by pretreatment with indomethacin. J. Anim. Sci. 1994, 72, 309–314. [Google Scholar] [CrossRef]
- Tuchscherer, M.; Kanitz, E.; Puppe, B.; Tuchscherer, A. Early social isolation alters behavioral and physiological responses to an endotoxin challenge in piglets. Horm. Behav. 2006, 50, 753–761. [Google Scholar] [CrossRef]
- Webel, D.M.; Finck, B.N.; Baker, D.H.; Johnson, R.W. Time course of increased plasma cytokines, cortisol, and urea nitrogen in pigs following intraperitoneal injection of lipopolysaccharide. J. Anim. Sci. 1997, 75, 1514–1520. [Google Scholar] [CrossRef] [PubMed]
- Wright, K.J.; Balaji, R.; Hill, C.M.; Dritz, S.S.; Knoppel, E.L.; Minton, J.E. Integrated adrenal, somatotropic, and immune responses of growing pigs to treatment with lipopolysaccharide. J. Anim. Sci. 2000, 78, 1892–1899. [Google Scholar] [CrossRef] [PubMed]
- Kelley, K.W.; Bluthé, R.-M.; Dantzer, R.; Zhou, J.-H.; Shen, W.-H.; Johnson, R.W.; Broussard, S.R. Cytokine-induced sickness behavior. Brain Behav. Immun. 2003, 17, 112–118. [Google Scholar] [CrossRef]
- Chow, J.C.; Young, D.W.; Golenbock, D.T.; Christ, W.J.; Gusovsky, F. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J. Biol. Chem. 1999, 274, 10689–10692. [Google Scholar] [CrossRef] [PubMed]
- Dantzer, R. Cytokine-induced sickness behaviour: A neuroimmune response to activation of innate immunity. Eur. J. Pharmacol. 2004, 500, 399–411. [Google Scholar] [CrossRef] [PubMed]
- Llamas Moya, S.; Boyle, L.; Lynch, P.B.; Arkins, S. Pro-inflammatory cytokine and acute phase protein responses to low-dose lipopolysaccharide (LPS) challenge in pigs. Anim. Sci. 2006, 82, 527–534. [Google Scholar] [CrossRef]
- Williams, P.N.; Collier, C.T.; Carroll, J.A.; Welsh, T.H.; Laurenz, J.C. Temporal pattern and effect of sex on lipopolysaccharide-induced stress hormone and cytokine response in pigs. Domest. Anim. Endocrinol. 2009, 37, 139–147. [Google Scholar] [CrossRef]
- von Känel, R.; Bellingrath, S.; Kudielka, B.M. Association between burnout and circulating levels of pro- and anti-inflammatory cytokines in schoolteachers. J. Psychosom. Res. 2008, 65, 51–59. [Google Scholar] [CrossRef]
- You, Z.; Luo, C.; Zhang, W.; Chen, Y.; He, J.; Zhao, Q.; Zuo, R.; Wu, Y. Pro- and anti-inflammatory cytokines expression in rat’s brain and spleen exposed to chronic mild stress: Involvement in depression. Behav. Brain Res. 2011, 225, 135–141. [Google Scholar] [CrossRef]
- Aulock, S.V.; Deininger, S.; Draing, C.; Gueinzius, K.; Dehus, O.; Hermann, C. Gender difference in cytokine secretion on immune stimulation with LPS and LTA. J. Interferon Cytokine Res. 2006, 26, 887–892. [Google Scholar] [CrossRef]
- Asai, K.; Hiki, N.; Mimura, Y.; Ogawa, T.; Unou, K.; Kaminishi, M. Gender differences in cytokine secretion by human peripheral blood mononuclear cells: Role of estrogen in modulating LPS-induced cytokine secretion in an ex vivo septic model. Shock 2001, 16, 340–343. [Google Scholar] [CrossRef] [PubMed]
- Moxley, G.; Posthuma, D.; Carlson, P.; Estrada, E.; Han, J.; Benson, L.L.; Neale, M.C. Sexual dimorphism in innate immunity. Arthritis Rheum. 2002, 46, 250–258. [Google Scholar] [CrossRef]
- Collier, C.T.; Williams, P.N.; Carroll, J.A.; Welsh, T.H.; Laurenz, J.C. Effect of maternal restraint stress during gestation on temporal lipopolysaccharide-induced neuroendocrine and immune responses of progeny. Domest. Anim. Endocrinol. 2011, 40, 40–50. [Google Scholar] [CrossRef] [PubMed]
- Kudielka, B.M.; Kirschbaum, C. Sex differences in HPA axis responses to stress: A review. Biol. Psychol. 2005, 69, 113–132. [Google Scholar] [CrossRef]
- Spencer, R.L.; Deak, T. A users guide to HPA axis research. Physiol. Behav. 2017, 178, 43–65. [Google Scholar] [CrossRef] [PubMed]
- Tottenham, N.; Sheridan, M.A. A review of adversity, the amygdala and the hippocampus: A consideration of developmental timing. Front. Hum. Neurosci. 2010, 3, 68. [Google Scholar] [CrossRef]
- Blanchard, R.J.; McKittrick, C.R.; Blanchard, D.C. Animal models of social stress: Effects on behavior and brain neurochemical systems. Physiol. Behav. 2001, 73, 261–271. [Google Scholar] [CrossRef]
- Cacioppo, J.T.; Cacioppo, S.; Capitanio, J.P.; Cole, S.W. The neuroendocrinology of social isolation. Annu. Rev. Psychol. 2015, 66, 733–767. [Google Scholar] [CrossRef]
- Turnbull, A.V.; Rivier, C. Regulation of the HPA axis by cytokines. Brain Behav. Immun. 1995, 9, 253–275. [Google Scholar] [CrossRef]
- Kolber, B.J.; Wieczorek, L.; Muglia, L.J. Hypothalamic-pituitary-adrenal axis dysregulation and behavioral analysis of mouse mutants with altered glucocorticoid or mineralocorticoid receptor function. Stress 2008, 11, 321–338. [Google Scholar] [CrossRef]
- Perreau, V.; Sarrieau, A.; Morméde, P. Characterization of mineralocorticoid and glucocorticoid receptors in pigs: Comparison of Meishan and large white breeds. Life Sci. 1999, 64, 1501–1515. [Google Scholar] [CrossRef]
- Kanitz, E.; Hameister, T.; Tuchscherer, A.; Tuchscherer, M.; Puppe, B. Social Support Modulates Stress-Related Gene Expression in Various Brain Regions of Piglets. Front. Behav. Neurosci. 2016, 10, 227. [Google Scholar] [CrossRef] [PubMed]
- Frøen, J.F.; Munkeby, B.H.; Stray-Pedersen, B.; Saugstad, O.D. Interleukin-10 reverses acute detrimental effects of endotoxin-induced inflammation on perinatal cerebral hypoxia–ischemia. Brain Res. 2002, 942, 87–94. [Google Scholar] [CrossRef]
- Kremlev, S.G.; Palmer, C. Interleukin-10 inhibits endotoxin-induced pro-inflammatory cytokines in microglial cell cultures. J. Neuroimmunol. 2005, 162, 71–80. [Google Scholar] [CrossRef]
- Spera, P.A.; Ellison, J.A.; Feuerstein, G.Z.; Barone, F.C. IL-10 reduces rat brain injury following focal stroke. Neurosci. Lett. 1998, 251, 189–192. [Google Scholar] [CrossRef]
- Klein, S.L.; Flanagan, K.L. Sex differences in immune responses. Nat. Rev. Immunol. 2016, 16, 626–638. [Google Scholar] [CrossRef]
- Aoyama, M.; Kotani, J.; Usami, M. Gender difference in granulocyte dynamics and apoptosis and the role of IL-18 during endotoxin-induced systemic inflammation. Shock 2009, 32, 401–409. [Google Scholar] [CrossRef]
- Barna, M.; Komatsu, T.; Bi, Z.; Reiss, C.S. Sex differences in susceptibility to viral infection of the central nervous system. J. Neuroimmunol. 1996, 67, 31–39. [Google Scholar] [CrossRef]
- Zuk, M.; McKean, K.A. Sex differences in parasite infections: Patterns and processes. Int. J. Parasitol. 1996, 26, 1009–1024. [Google Scholar] [CrossRef]
- Bangasser, D.A. Sex differences in stress-related receptors: “micro” differences with “macro” implications for mood and anxiety disorders. Biol. Sex Differ. 2013, 4, 2. [Google Scholar] [CrossRef]
- Voskuhl, R. Sex differences in autoimmune diseases. Biol. Sex Differ. 2011, 2, 1. [Google Scholar] [CrossRef] [PubMed]
- Bath, K.G. Synthesizing views to understand sex differences in response to early life adversity. Trends Neurosci. 2020, 43, 300–310. [Google Scholar] [CrossRef] [PubMed]
- McEwen, B.S.; Nasca, C.; Gray, J.D. Stress effects on neuronal structure: Hippocampus, amygdala, and prefrontal cortex. Neuropsychopharmacology 2016, 41, 3–23. [Google Scholar] [CrossRef] [PubMed]
- McLaughlin, K.J.; Baran, S.E.; Conrad, C.D. Chronic stress- and sex-specific neuromorphological and functional changes in limbic structures. Mol. Neurobiol. 2009, 40, 166–182. [Google Scholar] [CrossRef] [PubMed]
- Murgatroyd, C.; Patchev, A.V.; Wu, Y.; Micale, V.; Bockmühl, Y.; Fischer, D.; Holsboer, F.; Wotjak, C.T.; Almeida, O.F.X.; Spengler, D. Dynamic DNA methylation programs persistent adverse effects of early-life stress. Nat. Neurosci. 2009, 12, 1559–1566. [Google Scholar] [CrossRef]
- Stokes, C.R.; Bailey, M.; Haverson, K.; Harris, C.; Jones, P.; Inman, C.; Pié, S.; Oswald, I.P.; Williams, B.A.; Akkermans, A.D.L.; et al. Postnatal development of intestinal immune system in piglets: Implications for the process of weaning. Anim. Res. 2004, 53, 325–334. [Google Scholar] [CrossRef]
- Kanitz, E.; Tuchscherer, M.; Otten, W.; Tuchscherer, A.; Zebunke, M.; Puppe, B. Coping style of pigs is associated with different behavioral, neurobiological and immune responses to stressful challenges. Front. Behav. Neurosci. 2019, 13, 173. [Google Scholar] [CrossRef]
Treatment Group | p-Value (F-Test) | |||||||
---|---|---|---|---|---|---|---|---|
Parameter | DA | DG | C | Treatment | Time | Sex | Treatment × Time × Sex | Treatment × Time |
Somnolence (counts) | <0.05 | <0.001 | 0.563 | 0.871 | 0.804 | |||
1 h | 5.45 ± 0.40 | 5.20 ± 0.40 | 4.70 ± 0.40 | |||||
2 h | 8.55 ± 0.40 | 8.85 ± 0.40 b | 7.25 ± 0.40 a | |||||
3 h | 10.85 ± 0.40 | 10.60 ± 0.40 | 10.45 ± 0.40 | |||||
4 h | 9.75 ± 0.40 | 9.95 ± 0.40 | 9.45 ± 0.40 | |||||
5 h | 11.25 ± 0.40 | 11.15 ± 0.40 | 10.75 ± 0.40 | |||||
6 h | 11.30 ± 0.40 | 10.80 ± 0.40 | 10.85 ± 0.40 | |||||
Panting (counts) | <0.05 | <0.001 | 0.242 | 0.635 | 0.060 | |||
1 h | 1.05 ± 0.66 | 1.05 ± 0.66 | 0.25 ± 0.66 | |||||
2 h | 5.95 ± 0.66 b | 5.15 ± 0.66 b | 2.70 ± 0.66 a | |||||
3 h | 7.70 ± 0.66 b | 7.55 ± 0.66 b | 4.95 ± 0.66 a | |||||
4 h | 3.00 ± 0.66 | 4.60 ± 0.66 | 2.85 ± 0.66 | |||||
5 h | 1.05 ± 0.66 | 2.05 ± 0.66 | 1.15 ± 0.66 | |||||
6 h | 0.25 ± 0.66 | 1.75 ± 0.66 | 0.05 ± 0.66 | |||||
Circulatory problems (counts) | 0.393 | <0.001 | 0.729 | 0.988 | 0.922 | |||
1 h | 2.30 ± 0.61 | 2.05 ± 0.61 | 1.25 ± 0.61 | |||||
2 h | 7.95 ± 0.61 | 8.55 ± 0.61 | 7.10 ± 0.61 | |||||
3 h | 6.85 ± 0.61 | 7.50 ± 0.61 | 7.30 ± 0.61 | |||||
4 h | 2.80 ± 0.61 | 4.00 ± 0.61 | 3.60 ± 0.61 | |||||
5 h | 0.00 ± 0.61 | 0.65 ± 0.61 | 0.35 ± 0.61 | |||||
6 h | 0.00 ± 0.61 | 0.35 ± 0.61 | 0.00 ± 0.61 | |||||
Shivering (counts) | 0.174 | <0.001 | 0.846 | 0.933 | 0.099 | |||
1 h | 2.65 ± 0.51 | 1.75 ± 0.51 | 1.10 ± 0.51 | |||||
2 h | 5.10 ± 0.51 | 4.10 ± 0.51 | 3.65 ± 0.51 | |||||
3 h | 4.20 ± 0.51 | 2.75 ± 0.51 | 3.70 ± 0.51 | |||||
4 h | 1.15 ± 0.51 | 1.30 ± 0.51 | 2.80 ± 0.51 | |||||
5 h | 0.75 ± 0.51 | 0.30 ± 0.51 | 1.05 ± 0.51 | |||||
6 h | 0.05 ± 0.51 | 0.00 ± 0.51 | 0.25 ± 0.51 | |||||
Salivating (counts) | 0.961 | <0.001 | 0.250 | 0.959 | 0.991 | |||
1 h | 0.40 ± 0.13 | 0.35 ± 0.13 | 0.25 ± 0.13 | |||||
2 h | 0.65 ± 0.13 | 0.55 ± 0.13 | 0.65 ± 0.13 | |||||
3 h | 0.10 ± 0.13 | 0.25 ± 0.13 | 0.20 ± 0.13 | |||||
4 h | 0.00 ± 0.13 | 0.10 ± 0.13 | 0.00 ± 0.13 | |||||
5 h | 0.00 ± 0.13 | 0.00 ± 0.13 | 0.00 ± 0.13 | |||||
6 h | 0.00 ± 0.13 | 0.00 ± 0.13 | 0.00 ± 0.13 | |||||
Empty chewing (counts) | 0.616 | <0.001 | 0.936 | 0.293 | 0.924 | |||
1 h | 0.30 ± 0.13 | 0.60 ± 0.13 | 0.40 ± 0.13 | |||||
2 h | 0.50 ± 0.13 | 0.60 ± 0.13 | 0.50 ± 0.13 | |||||
3 h | 0.20 ± 0.13 | 0.35 ± 0.13 | 0.45 ± 0.13 | |||||
4 h | 0.10 ± 0.13 | 0.00 ± 0.13 | 0.00 ± 0.13 | |||||
5 h | 0.00 ± 0.13 | 0.05 ± 0.13 | 0.00 ± 0.13 | |||||
6 h | 0.00 ± 0.13 | 0.00 ± 0.13 | 0.00 ± 0.13 | |||||
Vomiting (counts) | 0.453 | <0.001 | 0.920 | <0.05 | 0.947 | |||
1 h | 0.50 ± 0.22 | 0.70 ± 0.22 | 0.55 ± 0.22 | |||||
2 h | 1.20 ± 0.22 | 1.45 ± 0.22 | 1.25 ± 0.22 | |||||
3 h | 0.60 ± 0.22 | 1.05 ± 0.22 | 1.00 ± 0.22 | |||||
4 h | 0.35 ± 0.22 | 0.20 ± 0.22 | 0.05 ± 0.22 | |||||
5 h | 0.05 ± 0.22 | 0.25 ± 0.22 | 0.00 ± 0.22 | |||||
6 h | 0.00 ± 0.22 | 0.00 ± 0.22 | 0.00 ± 0.22 | |||||
Diarrhoea (counts) | 0.591 | <0.05 | 0.408 | 0.723 | 0.848 | |||
1 h | 0.20 ± 0.09 | 0.00 ± 0.09 | 0.00 ± 0.09 | |||||
2 h | 0.25 ± 0.09 | 0.15 ± 0.09 | 0.10 ± 0.09 | |||||
3 h | 0.20 ± 0.09 | 0.35 ± 0.09 | 0.20 ± 0.09 | |||||
4 h | 0.10 ± 0.09 | 0.10 ± 0.09 | 0.00 ± 0.09 | |||||
5 h | 0.00 ± 0.09 | 0.00 ± 0.09 | 0.05 ± 0.09 | |||||
6 h | 0.00 ± 0.09 | 0.00 ± 0.09 | 0.00 ± 0.09 | |||||
Activity (counts) | 0.128 | <0.001 | 0.230 | 0.690 | 0.765 | |||
1 h | 2.15 ± 0.33 a | 3.15 ± 0.33 | 3.50 ± 0.33 b | |||||
2 h | 0.05 ± 0.33 | 0.20 ± 0.33 | 0.40 ± 0.33 | |||||
3 h | 0.10 ± 0.33 | 0.05 ± 0.33 | 0.20 ± 0.33 | |||||
4 h | 0.10 ± 0.33 | 0.20 ± 0.33 | 0.25 ± 0.33 | |||||
5 h | 0.65 ± 0.33 | 0.60 ± 0.33 | 1.05 ± 0.33 | |||||
6 h | 0.60 ± 0.33 | 0.45 ± 0.33 | 1.00 ± 0.33 | |||||
Inactivity (counts) | 0.088 | <0.001 | 0.295 | 0.930 | 0.487 | |||
1 h | 11.20 ± 0.23 | 10.45 ± 0.23 | 10.45 ± 0.23 | |||||
2 h | 11.95 ± 0.23 | 11.95 ± 0.23 | 11.80 ± 0.23 | |||||
3 h | 11.90 ± 0.23 | 11.95 ± 0.23 | 11.80 ± 0.23 | |||||
4 h | 11.95 ± 0.23 | 11.95 ± 0.23 | 11.90 ± 0.23 | |||||
5 h | 11.75 ± 0.23 | 11.75 ± 0.23 | 11.70 ± 0.23 | |||||
6 h | 11.95 ± 0.23 | 11.15 ± 0.23 | 11.70 ± 0.23 | |||||
Rectal temp. (°C) | 0.517 | <0.001 | 0.073 | 0.760 | 0.359 | |||
0 h | 39.06 ± 0.23 | 39.12 ± 0.23 | 39.11 ± 0.23 | |||||
1 h | 39.46 ± 0.23 | 39.40 ± 0.23 | 39.53 ± 0.23 | |||||
3 h | 38.69 ± 0.23 | 38.77 ± 0.23 | 38.62 ± 0.23 | |||||
6 h | 39.26 ± 0.23 | 39.25 ± 0.23 | 39.85 ± 0.23 | |||||
24 h | 40.14 ± 0.23 | 39.55 ± 0.23 | 40.18 ± 0.23 |
Treatment Group | p-Value (F-Test) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Parameter | DA | DG | C | Treatment | Time | Sex | Treatment × Time × Sex | Treatment × Time | Treatment × Sex |
Cortisol (ng/mL) | 0.614 | <0.001 | 0.311 | 0.882 | 0.543 | 0.870 | |||
0 h | 32.50 ± 10.41 | 31.79 ± 10.81 | 35.27 ± 10.81 | ||||||
1 h | 92.80 ± 10.42 | 75.96 ± 10.81 | 88.16 ± 10.81 | ||||||
3 h | 218.61 ± 10.42 | 191.87 ± 10.81 | 186.62 ± 10.81 | ||||||
6 h | 98.21 ± 10.42 | 107.90 ± 10.81 | 102.11 ± 10.81 | ||||||
24 h | 26.24 ± 10.42 | 20.70 ± 10.81 | 22.10 ± 10.81 | ||||||
TNF-α (ng/mL) | 0.127 | <0.001 | 0.354 | <0.01 | < 0.05 | 0.094 | |||
0 h | 0.11 ± 1.85 | 0.05 ± 1.92 | 0.05 ± 1.92 | ||||||
1 h | 15.09 ± 1.85 b | 21.20 ± 1.92 | 27.53 ± 1.92 a | ||||||
3 h | 5.30 ± 1.85 | 4.96 ± 1.92 | 5.48 ± 1.92 | ||||||
6 h | 1.25 ± 1.85 | 1.18 ± 1.92 | 1.36 ± 1.92 | ||||||
24 h | 0.12 ± 1.85 | 0.06 ± 1.92 | 0.07 ± 1.92 | ||||||
IL-6 (ng/mL) | 0.837 | <0.001 | 0.575 | 0.920 | 0.998 | 0.600 | |||
0 h | 0.01 ± 0.34 | 0.02 ± 0.36 | 0.02 ± 0.36 | ||||||
1 h | 0.09 ± 0.34 | 0.14 ± 0.36 | 0.22 ± 0.36 | ||||||
3 h | 2.21 ± 0.34 | 2.35 ± 0.36 | 2.75 ± 0.36 | ||||||
6 h | 0.33 ± 0.34 | 0.43 ± 0.36 | 0.43 ± 0.36 | ||||||
24 h | 0.04 ± 0.34 | 0.04 ± 0.36 | 0.05 ± 0.36 | ||||||
IL-10 (pg/mL) | 0.681 | <0.001 | 0.354 | 0.180 | 0.919 | 0.771 | |||
0 h | 22.99 ± 8.50 | 20.80 ± 8.74 | 26.93 ± 8.76 | ||||||
1 h | 93.04 ± 8.50 | 97.12 ± 8.74 | 111.87 ± 8.76 | ||||||
3 h | 23.30 ± 8.50 | 18.67 ± 8.74 | 20.09 ± 8.76 | ||||||
6 h | 54.37 ± 8.50 | 47.10 ± 8.74 | 58.81 ± 8.76 | ||||||
24 h | 50.85 ± 8.50 | 55.16 ± 8.74 | 56.76 ± 8.76 | ||||||
TNF-α/IL-10 ratio | 0.231 | <0.001 | 0.067 | 0.278 | 0.191 | 0.721 | |||
0 h | 7.87 ± 16.42 | 13.69 ± 17.04 | 10.03 ± 17.04 | ||||||
1 h | 155.96 ± 16.42 | 217.86 ± 17.04 | 237.24 ± 17.04 | ||||||
3 h | 10.60 ± 16.42 | 8.34 ± 17.04 | 9.33 ± 17.04 | ||||||
6 h | 97.47 ± 16.42 | 123.87 ± 17.04 | 106.60 ± 17.04 | ||||||
24 h | 26.90 ± 16.42 | 26.18 ± 17.04 | 27.96 ± 17.04 |
Treatment Group | p-Value (F-Test) | |||||
---|---|---|---|---|---|---|
Parameter | DA | DG | C | Treatment | Sex | Treatment × Sex |
MR | 1.04 ± 0.20 | 0.84 ± 0.20 | 1.12 ± 0.19 | 0.595 | 0.058 | 0.423 |
GR | 1.01 ± 0.23 | 0.93 ± 0.23 | 1.16 ± 0.22 | 0.772 | 0.517 | 0.926 |
CRHR1 | 1.13 ± 0.18 | 1.03 ± 0.18 | 1.24 ± 0.17 | 0.711 | 0.828 | 0.188 |
CRHR2 | 0.95 ± 0.19 | 1.05 ± 0.19 | 1.23 ± 0.18 | 0.567 | 0.874 | 0.841 |
TNF-α | 1.02 ± 0.19 b | 0.83 ± 0.19 b | 1.77 ± 0.18 a | <0.01 | 0.072 | 0.623 |
IL-6 | 1.36 ± 0.20 | 0.95 ± 0.20 | 1.35 ± 0.19 | 0.260 | 0.841 | 0.430 |
IL-10 | 0.70 ± 0.37 | 0.23 ± 0.37 | 0.77 ± 0.37 | 0.436 | 0.450 | 0.252 |
MR/GR ratio | 1.75 ± 1.21 | 1.06 ± 1.21 | 2.80 ± 1.17 | 0.589 | 0.104 | 0.456 |
Treatment Group | p-Value (F-Test) | |||||
---|---|---|---|---|---|---|
Parameter | DA | DG | C | Treatment | Sex | Treatment × Sex |
MR | 1.09 ± 0.11 | 0.70 ± 0.12 b | 1.42 ± 0.11 a | <0.001 | <0.05 | 0.211 |
GR | 1.10 ± 0.17 | 1.09 ± 0.18 | 1.70 ± 0.17 | <0.05 | 0.567 | 0.965 |
CRHR1 | 1.32 ± 0.13 | 1.14 ± 0.14 | 1.44 ± 0.13 | 0.332 | 0.104 | 0.600 |
CRHR2 | 1.05 ± 0.11 | 0.82 ± 0.11 | 0.97 ± 0.11 | 0.272 | 0.291 | 0.387 |
TNF-α | 1.11 ± 0.17 | 0.94 ± 0.18 | 1.42 ± 0.17 | 0.162 | 0.856 | 0.670 |
IL-6 | 1.11 ± 0.28 | 0.72 ± 0.29 | 1.39 ± 0.28 | 0.167 | 0.424 | 0.577 |
IL-10 | 1.35 ± 0.22 b | 0.87 ± 0.22 b | 2.01 ± 0.22 a | <0.01 | <0.05 | <0.05 |
MR/GR ratio | 1.03 ± 0.15 | 0.88 ± 0.16 | 0.95 ± 0.15 | 0.782 | <0.05 | 0.507 |
Gene | GeneBank Accession Numbers | Sense, Antisense Primer (5′–3′) | Amplicon (bp) |
---|---|---|---|
MR | ENSSSCG00000037766 | AGTGTTCTTCAAAAGAGCAGTGG, CCTCGTGGATCCCTTTCAAC | 188 |
GR | NM_001008481.1 | GTTCCAGAGAACCCCAAGAGTTCA, TCAAAGGTGCTTTGGTCTGTGGTA | 173 |
CRHR1 | NM_001144110.1 | CTCATCTCAGCCTTCATCCTG, CGAACATCCAGAAGAAGTTGG | 151 |
CRHR2 | NM_001144118.1 | CAGGGTTTCTTCGTGTCTGTC, GTCTGCTTGATGCTGTGGAAG | 173 |
TNF-α | NM_214022.1 | TCCTCACTCACACCATCAGC, TAGTCGGGCAGGTTGATCTC | 199 |
IL-6 | NM_214399.1 | TGCTTCTGGTGATGGCTACTG, TTCTGCCAGTACCTCCTTGC | 209 |
IL-10 | NM_214041 | AGCCAGCATTAAGTCTGAGAAC, CCTCTCTTGGAGCTTGCTAA | 394 |
ACTB * | ENSSSCT00000042531 | TCTGGCACCACACCTTCT, TGATCTGGGTCATCTTCTCAC | 114 |
TBP * | NM_003194.5 | AACAGTTCAGTAGTTATGAGCCAGA, AGATGTTCTCAAACGCTTCG | 153 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brückmann, R.; Tuchscherer, M.; Tuchscherer, A.; Gimsa, U.; Kanitz, E. Early-Life Maternal Deprivation Predicts Stronger Sickness Behaviour and Reduced Immune Responses to Acute Endotoxaemia in a Pig Model. Int. J. Mol. Sci. 2020, 21, 5212. https://doi.org/10.3390/ijms21155212
Brückmann R, Tuchscherer M, Tuchscherer A, Gimsa U, Kanitz E. Early-Life Maternal Deprivation Predicts Stronger Sickness Behaviour and Reduced Immune Responses to Acute Endotoxaemia in a Pig Model. International Journal of Molecular Sciences. 2020; 21(15):5212. https://doi.org/10.3390/ijms21155212
Chicago/Turabian StyleBrückmann, Roberto, Margret Tuchscherer, Armin Tuchscherer, Ulrike Gimsa, and Ellen Kanitz. 2020. "Early-Life Maternal Deprivation Predicts Stronger Sickness Behaviour and Reduced Immune Responses to Acute Endotoxaemia in a Pig Model" International Journal of Molecular Sciences 21, no. 15: 5212. https://doi.org/10.3390/ijms21155212
APA StyleBrückmann, R., Tuchscherer, M., Tuchscherer, A., Gimsa, U., & Kanitz, E. (2020). Early-Life Maternal Deprivation Predicts Stronger Sickness Behaviour and Reduced Immune Responses to Acute Endotoxaemia in a Pig Model. International Journal of Molecular Sciences, 21(15), 5212. https://doi.org/10.3390/ijms21155212