Sperm Motility of Mice under Simulated Microgravity and Hypergravity
Abstract
:1. Introduction
2. Results
2.1. Sperm Motility
2.2. Cell Respiration
2.3. Protein Relative Content
2.4. Relative mRNA Content
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Estimation of Sperm Motility
4.3. Estimation of Cell Respiration by Polarography
4.4. Evaluation of Protein Content by Western Blotting
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Serova, L.V.; Denisova, L.A.; Apanasenko, Z.I.; Kuznetsova, M.A.; Meĭzerov, E.S. Reproductive function of the male rat after a flight on the Kosmos-1129 biosatellite. Kosm. Biol. Aviakosm. Med. 1982, 16, 62–65. [Google Scholar] [PubMed]
- Kojima, Y.; Sasaki, S.; Kubota, Y.; Ikeuchi, T.; Hayashi, Y.; Kohri, K. Effects of simulated microgravity on mammalian fertilization and preimplantation embryonic development in vitro. Fertil. Steril. 2000, 74, 1142–1147. [Google Scholar] [CrossRef]
- Schenker, E.; Forkheim, K. Mammalian mice embryo early development in weightlessness environment on STS 80 space flight. In Proceedings of the American Society of Gravitational and Space Biology (ASGSR), Houston, TX, USA, 18 October 1998. [Google Scholar]
- Zhang, S.; Wu, Y.; Weng, Y.; Xu, Z.; Chen, W.; Zheng, D.; Lin, W.; Liu, J.; Zhou, Y. In vitro growth of mouse preantral follicles under simulated microgravity. J. Vis. Exp. 2017, 130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tash, J.S.; Bracho, G.E. Microgravity alters protein phosphorylation changes during initiation of sea urchin sperm motility. FASEB J. 1999, 13, 43–54. [Google Scholar] [CrossRef] [PubMed]
- Wakayama, S.; Kamada, Y.; Yamanaka, K.; Kohda, T.; Suzuki, H.; Shimaxu, T.; Tada, M.N.; Osada, I.; Nagamatsu, A.; Kamimura, S.; et al. Healthy offspring from freeze-dried mouse spermatozoa held on the International Space Station for 9 months. Proc. Natl. Acad. Sci. USA 2017, 114, 5988–5993. [Google Scholar] [CrossRef] [Green Version]
- Serova, L.V. Effect of weightlessness on the reproductive system of mammals. Kosm. Biol. Aviakosm. Med. 1989, 23, 11–16. [Google Scholar]
- Serova, L.V. Adaptive potentials of mammals under conditions of weightlessness. Aviakosm. Ekolog. Med. 1996, 30, 5–11. [Google Scholar]
- Tash, J.S.; Johnson, D.C.; Enders, G.C. Long-term (6-wk) hindlimb suspension inhibits spermatogenesis in adult male rats. J. Appl. Physiol. 2002, 92, 1191–1198. [Google Scholar] [CrossRef] [PubMed]
- Usik, M.A.; Ogneva, I.V. Cytoskeleton Structure in Mouse Sperm and Testes after 30 Days of Hindlimb Unloading and 12 Hours of Recovery. Cell. Physiol. Biochem. 2018, 51, 375–392. [Google Scholar] [CrossRef]
- Ikeuchi, T.; Sasaki, S.; Umemoto, Y.; Kubota, Y.; Kubota, H.; Kaneko, T.; Kohri, K. Human sperm motility in a microgravity environment. Reprod. Med. Biol. 2005, 4, 161–168. [Google Scholar] [CrossRef]
- Krieger, D.A.; Tate, C.A.; McMillin-Wood, J.; Booth, F.W. Populations of rat skeletal muscle mitochondria after exercise and immobilization. J. Appl. Physiol. 1980, 48, 23–28. [Google Scholar] [CrossRef] [PubMed]
- Bigard, A.-X.; Boehm, E.; Veksler, V.; Mateo, P.; Anflous, K.; Ventura-Clapier, R. Muscle unloading induces slow to fast transitions in myofibrillar but not mitochondrial properties. Relevance to skeletal muscle abnormalities in heart failure. J. Mol. Cell. Cardiol. 1998, 30, 2391–2401. [Google Scholar] [CrossRef]
- Ogneva, I.V.; Mirzoev, T.M.; Biryukov, N.S.; Veselova, O.M.; Larina, I.M. Structure and functional characteristics of rat’s left ventricle cardiomyocytes under antiorthostatic suspension of various duration and subsequent reloading. J. Biomed. Biotechnol. 2012, 2012. [Google Scholar] [CrossRef] [Green Version]
- Ogneva, I.V.; Biryukov, N.S.; Veselova, O.M.; Larina, I.M. Cell respiration of rat cardiomyocytes and soleus muscle fibers under ultra-short-term antiorthostatic suspension. Int. J. Biomed. 2014, 4, 162–168. [Google Scholar] [CrossRef]
- Ogneva, I.V. Cell mechanosensitivity: Mechanical properties and interaction with gravitational field. BioMed Res. Int. 2013, 2013. [Google Scholar] [CrossRef] [Green Version]
- Brand, M.D. The sites and topology of mitochondrial superoxide production. Exp. Gerontol. 2010, 45, 466–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di Meo, S.; Reed, T.T.; Venditti, P.; Victor, V.M. Role of ROS and RNS Sources in Physiological and Pathological Conditions. Oxidative Med. Cell. Longev. 2016, 2016. [Google Scholar] [CrossRef] [PubMed]
- Shekarriz, M.; DeWire, D.M.; Thomas, A.J., Jr.; Agarwal, A. A method of human semen centrifugation to minimize the iatrogenic sperm injuries caused by reactive oxygen species. Eur. Urol. 1995, 28, 31–35. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.; Agca, C.; Agca, Y. Effects of various physical stress factors on mitochondrial function and reactive oxygen species in rat spermatozoa. Reprod. Fertil. Dev. 2013, 25, 1051–1064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guimarães, A.C.; Leivas, F.G.; Santos, F.W.; Schwengber, E.B.; Giotto, A.B.; Machado, C.I.; Gonçalves, C.G.; Folchini, N.P.; Brum, D.S. Reduction of centrifugation force in discontinuous percoll gradients increases in vitro fertilization rates without reducing bovine sperm recovery. Anim. Reprod. Sci. 2014, 146, 103–110. [Google Scholar] [CrossRef]
- Shi, X.; Wang, T.; Qiu, Z.L.; Li, K.; Li, L.; Chan, C.P.; Chan, S.M.; Li, T.C.; Quan, S. Effects of mechanical stresses on sperm function and fertilization rate in mice. Syst. Biol. Reprod. Med. 2016, 62, 152–159. [Google Scholar] [CrossRef] [Green Version]
- Takeshima, T.; Yumura, Y.; Kuroda, S.; Kawahara, T.; Uemura, H.; Iwasaki, A. Effect of density gradient centrifugation on reactive oxygen species in human semen. Syst. Biol. Reprod. Med. 2017, 63, 192–198. [Google Scholar] [CrossRef] [PubMed]
- Moraes, C.R.; Meyers, S. The sperm mitochondrion: Organelle of many functions. Anim. Reprod. Sci. 2018, 194, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Saks, V.; Kuznetsov, A.; Andrienko, T.; Usson, Y.; Appaix, F.; Guerrero, K.; Kaambre, T.; Sikk, P.; Lemba, M.; Vendelin, M. Heterogeneity of ADP diffusion and regulation of respiration in cardiac cells. Biophys. J. 2003, 84, 3436–3456. [Google Scholar] [CrossRef] [Green Version]
- Szymanski, D. Tubulin folding cofactors: Half of dozen for a dimer. Curr. Biol. 2002, 12, 767–769. [Google Scholar] [CrossRef] [Green Version]
- Cleveland, D.W. Autoregulated instability of tubulin mRNAs: A novel eukaryotic regulatory mechanism. Trends Biochem. Sci. 1998, 13, 339–343. [Google Scholar] [CrossRef]
- Yaffe, M.B.; Farr, G.W.; Miklos, D.; Horwich, A.L.; Sternlicht, M.L.; Sternlicht, H. TCP1 complex is a molecular chaperone in tubulin biogenesis. Nature 1992, 358, 245–248. [Google Scholar] [CrossRef]
- Cassimeris, L.; Morabito, J. TOGp, the human homolog of XMAP215/Dis1, is required for centrosome integrity, spindle pole organization, and bipolar spindle assembly. Mol. Biol. Cell 2004, 15, 1580–1590. [Google Scholar] [CrossRef] [Green Version]
- Vassy, J.; Portet, S.; Beil, M.; Millot, G.; Fauvel-Lafève, F.; Karniguian, A.; Gasset, G.; Irinopoulou, T.; Calvo, F.; Rigaut, J.P.; et al. The effect of weightlessness on cytoskeleton architecture and proliferation of human breast cancer cell line MCF-7. FASEB J. 2001, 15, 1104–1106. [Google Scholar] [CrossRef] [Green Version]
- Uva, B.M.; Masini, M.A.; Sturla, M.; Prato, P.; Passalacqua, M.; Giuliani, M.; Tagliafierro, G.; Strollo, F. Clinorotation-induced weightlessness influences the cytoskeleton of glial cells in culture. Brain Res. 2002, 934, 132–139. [Google Scholar] [CrossRef]
- Hughes-Fulford, M. Function of the cytoskeleton in gravisensing during spaceflight. Adv. Space Res. 2003, 32, 1585–1593. [Google Scholar] [CrossRef]
- Rosner, H.; Wassermann, T.; Moller, W.; Hanke, W. Effects of altered gravity on the actin and microtubule cytoskeleton of human SH-SY5Y neuroblastoma cells. Protoplasma 2006, 229, 225–234. [Google Scholar] [CrossRef] [PubMed]
- Janmaleki, M.; Pachenari, M.; Seyedpour, S.M.; Shahghadami, R.; Sanati-Nezhad, A. Impact of simulated microgravity on cytoskeleton and viscoelastic properties of endothelial cell. Sci. Rep. 2016, 6, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Papaseit, C.; Pochon, N.; Tabony, J. Microtubule self-organization is gravity-dependent. Proc. Natl. Acad. Sci. USA 2000, 97, 8364–8368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tabony, J.; Glade, N.; Papaseit, C.; Demongeot, J. Microtubule self-organisation and its gravity dependence. Adv. Space Biol. Med. 2002, 8, 19–58. [Google Scholar] [CrossRef] [PubMed]
- Xue, L.; Li, Y.; Chen, J. Duration of simulated microgravity affects the differentiation of mesenchymal stem cells. Mol. Med. Rep. 2017, 15, 3011–3018. [Google Scholar] [CrossRef] [Green Version]
- Van Loon, J.J.W.A. Some history and use of the Random Positioning Machine, RPM, in gravity related research. Adv. Space Res. 2007, 39, 1161–1165. [Google Scholar] [CrossRef]
- Kuznetsov, A.V.; Veksler, V.; Gellerich, F.N.; Saks, V.; Margreiter, R.; Kunz, W.S. Analysis of mitochondrial function in situ in permeabilized muscle fibers, tissues and cells. Nat. Protoc. 2008, 3, 965–976. [Google Scholar] [CrossRef]
- Towbin, H.; Staehlin, T.; Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some application. Proc. Natl. Acad. Sci. USA 1979, 76, 4350–4354. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 2, 402–408. [Google Scholar] [CrossRef]
Protein | Manufacturer with Catalog Number, Dilution |
---|---|
Cyc1 (cytochrome c-1, 13.5 kDa) | Abcam, UK, #ab13575, 5 μg/mL |
Cox4i1 (cytochrome c oxidase, 16 kDa) | Abcam, UK, #ab14744, 1 μg/mL |
ATP5a1 (ATPsyntase F1, 56 kDa) | Abcam, UK, #ab14748, 1 μg/mL |
Gapdh (glyceraldehyde-3-phosphate dehydrogenase, 37 kDa) | Abm, Canada, #G041, 1:1000 |
Tuba1c (alpha-tubulin, 50 kDa) | Abcam, UK, #ab52866, 1:1000–1:50,000 |
Tubb4b (beta-tubulin, 50 kDa) | Abcam, UK, #ab179513, 1:1000 |
Cct4 (chaperonin containing Tcp1, subunit 4 (delta), 56 kDa) | Abcam, UK, #ab49151, 1.25 μg/mL |
Ckap5 (cytoskeleton associated protein 5, 200 kDa) | Thermo Fisher Scientific, USA, #PA3-16835, 1:1000 |
Gene | Primer Sequence, Forward/Reverse (5′ 3′) | Product Size, bp |
---|---|---|
Cyc1 | GTGGAACCCTGGAACCCATA/CAAACAGTGCTGCCAGGTTTT | 106 |
Cox4i1 | CTTCCCTGATTCCCGCGATG/ACACTCCCATGTGCTCGAAG | 208 |
ATP5a1 | GGCAACCACAAGGTCGATTC/CGGACGACTGGCACAAAATG | 241 |
Gapdh | TCCCAGCTTAGGTTCATCAGG/ATGAAGGGGTCGTTGATGGC | 165 |
Tuba1c | GGCTCGCCTAGATCACAAGT/CTCATCGTCTCCTTCAGCACT | 172 |
Tubb4b | GAGCGTCGGTTGTAGCACTC/GATCAATGCCATGCTCGTCG | 174 |
Cct4 | TGTCTCGACCTGTGCAACTG/GTAGCTGTGGCTGGGTCAAT | 151 |
Ckap5 | GCTTGGGCAGAACAAACTGG/AGCATCTTGGGCCTTCTTCC | 225 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ogneva, I.V.; Usik, M.A.; Biryukov, N.S.; Zhdankina, Y.S. Sperm Motility of Mice under Simulated Microgravity and Hypergravity. Int. J. Mol. Sci. 2020, 21, 5054. https://doi.org/10.3390/ijms21145054
Ogneva IV, Usik MA, Biryukov NS, Zhdankina YS. Sperm Motility of Mice under Simulated Microgravity and Hypergravity. International Journal of Molecular Sciences. 2020; 21(14):5054. https://doi.org/10.3390/ijms21145054
Chicago/Turabian StyleOgneva, Irina V., Maria A. Usik, Nikolay S. Biryukov, and Yuliya S. Zhdankina. 2020. "Sperm Motility of Mice under Simulated Microgravity and Hypergravity" International Journal of Molecular Sciences 21, no. 14: 5054. https://doi.org/10.3390/ijms21145054