Seminal Plasma Induces Overexpression of Genes Associated with Embryo Development and Implantation in Day-6 Porcine Blastocysts
Abstract
1. Introduction
2. Results
2.1. Transcriptional Profile of Embryos
2.2. Gene Ontology and Pathway Enrichment Analysis of Differentially Expressed Genes (DEGs)
2.3. Validation of the Microarray Data
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Animals
4.3. Detection of Estrus
4.4. Estrus Synchronization and Superovulation
4.5. Artificial Insemination
4.6. Seminal Plasma Preparation
4.7. Embryo Collection and Evaluation
4.8. Total RNA Extraction
4.9. Microarray Hybridization
4.10. Analysis of the Microarray Data
4.11. RT-qPC Assay
4.12. Experimental Design
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Robertson, S.A. Immune regulation of conception and embryo implantation-all about quality control? J. Reprod. Immunol. 2010, 85, 51–57. [Google Scholar] [CrossRef] [PubMed]
- Robertson, S.A. Seminal plasma and male factor signalling in the female reproductive tract. Cell Tissue Res. 2005, 322, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Martinez, H.; Kvist, U.; Ernerudh, J.; Sanz, L.; Calvete, J.J. Seminal plasma proteins: What role do they play? Am. J. Reprod. Immunol. 2011, 66, 11–22. [Google Scholar] [CrossRef] [PubMed]
- Waberski, D.; Claassen, R.; Hahn, T.; Jungblut, P.W.; Parvizi, N.; Kallweit, E.; Weitze, K.F. LH profile and advancement of ovulation after transcervical infusion of seminal plasma at different stages of oestrus in gilts. J. Reprod. Fertil. 1997, 109, 29–34. [Google Scholar] [CrossRef]
- Weitze, K.F.; Rath, D.; Willmen, T.; Waberski, D.; Lotz, J. Advancement of Ovulation in the Sow Related to Seminal Plasma Application before Insemination. Reprod. Domest. Anim. 1990, 25, 61–67. [Google Scholar] [CrossRef]
- O’Leary, S.; Jasper, M.J.; Robertson, S.A.; Armstrong, D.T. Seminal plasma regulates ovarian progesterone production, leukocyte recruitment and follicular cell responses in the pig. Reproduction 2006, 132, 147–158. [Google Scholar] [CrossRef]
- Waberski, D.; Schäfer, J.; Bölling, A.; Scheld, M.; Henning, H.; Hambruch, N.; Schuberth, H.J.; Pfarrer, C.; Wrenzycki, C.; Hunter, R.H.F. Seminal plasma modulates the immune-cytokine network in the porcine uterine tissue and pre-ovulatory follicles. PLoS ONE 2018, 13, e0202654. [Google Scholar] [CrossRef]
- Alvarez-Rodriguez, M.; Atikuzzaman, M.; Venhoranta, H.; Wright, D.; Rodriguez-Martinez, H. Expression of immune regulatory genes in the porcine internal genital tract is differentially triggered by spermatozoa and seminal plasma. Int. J. Mol. Sci. 2019, 20, 513. [Google Scholar] [CrossRef]
- Pang, S.F.; Chow, P.H.; Wong, T.M. The role of the seminal vesicles, coagulating glands and prostate glands on the fertility and fecundity of mice. J. Reprod. Fertil. 1979, 56, 129–132. [Google Scholar] [CrossRef]
- Schjenken, J.E.; Robertson, S.A. Seminal fluid and immune adaptation for pregnancy—Comparative biology in mammalian species. Reprod. Domest. Anim. 2014, 49, 27–36. [Google Scholar] [CrossRef]
- Takeda, K.; Tasai, M.; Iwamoto, M.; Akita, T.; Tagami, T.; Nirasawa, K.; Hanada, H.; Onishi, A. Transmission of mitochondrial DNA in pigs and progeny derived from nuclear transfer of Meishan pig fibroblast cells. Mol. Reprod. Dev. 2006, 73, 306–312. [Google Scholar] [CrossRef] [PubMed]
- Samiec, M.; Skrzyszowska, M. The use of different methods of oocyte activation for generation of porcine fibroblast cell nuclear-transferred embryos. Ann. Anim. Sci. 2010, 10, 399–411. [Google Scholar]
- Huang, J.; Zhang, H.; Yao, J.; Qin, G.; Wang, F.; Wang, X.; Luo, A.; Zheng, Q.; Cao, C.; Zhao, J. BIX-01294 increases pig cloning efficiency by improving epigenetic reprogramming of somatic cell nuclei. Reproduction 2016, 151, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Liu, Z.; He, H.; Wang, J.; Li, H.; Li, J.; Li, F.; Jiang, Z.; Huan, Y. Dnmt1s in donor cells is a barrier to SCNT-mediated DNA methylation reprogramming in pigs. Oncotarget 2017, 8, 34980–34991. [Google Scholar] [CrossRef][Green Version]
- Opiela, J.; Samiec, M.; Romanek, J. In Vitro development and cytological quality of inter-species (porcine-bovine) cloned embryos are affected by trichostatin A-dependent epigenomic modulation of adult mesenchymal stem cells. Theriogenology 2017, 97, 27–33. [Google Scholar] [CrossRef]
- Watson, J.G.; Carroll, J.; Chaykin, S. Reproduction in mice: The fate of spermatozoa not involved in fertilization. Gamete Res. 1983, 7, 75–84. [Google Scholar] [CrossRef]
- Carp, H.; Serr, D.M.; Mashiach, S.; Nebel, L. Influence of insemination on the implantation of transferred rat blastocysts. Gynecol. Obstet. Investig. 1984, 18, 194–198. [Google Scholar] [CrossRef]
- O’Leary, S.; Jasper, M.J.; Warnes, G.M.; Armstrong, D.T.; Robertson, S.A. Seminal plasma regulates endometrial cytokine expression, leukocyte recruitment and embryo development in the pig. Reproduction 2004, 128, 237–247. [Google Scholar] [CrossRef]
- Martinez, C.A.; Cambra, J.M.; Parrilla, I.; Roca, J.; Ferreira-Dias, G.; Pallares, F.J.; Lucas, X.; Vazquez, J.M.; Martinez, E.A.; Gil, M.A.; et al. Seminal Plasma Modifies the Transcriptional Pattern of the Endometrium and Advances Embryo Development in Pigs. Front. Vet. Sci. 2019, 6, 1–16. [Google Scholar] [CrossRef]
- Pursel, V.G.; Johnson, L.A. Freezing of boar spermatozoa: Fertilizing capacity with concentrated semen and a new thawing procedure. J. Anim. Sci. 1975, 40, 99–102. [Google Scholar] [CrossRef]
- Maegawa, M.; Kamada, M.; Irahara, M.; Yamamoto, S.; Yoshikawa, S.; Kasai, Y.; Ohmoto, Y.; Gima, H.; Thaler, C.J.; Aono, T. A repertoire of cytokines in human seminal plasma. J. Reprod. Immunol. 2002, 54, 33–42. [Google Scholar] [CrossRef]
- Wu, B.J.; Sun, Y.; Ong, K.-L.; Li, Y.; Tang, S.; Barter, P.J.; Rye, K.-A. Apolipoprotein A-I Protects Against Pregnancy-Induced Insulin Resistance in Rats. Arterioscler. Thromb. Vasc. Biol. 2019, 39, 1160–1171. [Google Scholar] [CrossRef] [PubMed]
- Rosing, U.; Samsioe, G.; Olund, A.; Johansson, B.; Kallner, A. Serum levels of apolipoprotein A-I, A-II and HDL-cholesterol in second half of normal pregnancy and in pregnancy complicated by pre-eclampsia. Horm. Metab. Res. 1989, 21, 376–382. [Google Scholar] [CrossRef] [PubMed]
- Park, K.-H.; Kim, J.-Y.; Choi, I.; Kim, J.-R.; Won, K.C.; Cho, K.-H. Fructated apolipoprotein A-I exacerbates cellular senescence in human umbilical vein endothelial cells accompanied by impaired insulin secretion activity and embryo toxicity. Biochem. Cell Biol. 2016, 94, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Gou, J.; Jia, J.; Zhao, X.; Yi, T.; Li, Z. Identification of stathmin 1 during peri-implantation period in mouse endometrium by a proteomics-based analysis. Biochem. Biophys. Res. Commun. 2015, 461, 211–216. [Google Scholar] [CrossRef] [PubMed]
- Jia, J.; Gou, J.; Zhao, X.; Yi, T.; Li, Z. Apolipoprotein A1 and heterogeneous nuclear ribonucleoprotein E1 implicated in the regulation of embryo implantation by inhibiting lipid peroxidation. Reprod. Biomed. Online 2016, 33, 635–645. [Google Scholar] [CrossRef]
- Mains, L.M.; Christenson, L.; Yang, B.; Sparks, A.E.T.; Mathur, S.; Van Voorhis, B.J. Identification of apolipoprotein A1 in the human embryonic secretome. Fertil. Steril. 2011, 96, 422–427. [Google Scholar] [CrossRef]
- Adhikari, D.; Zheng, W.; Shen, Y.; Gorre, N.; Ning, Y.; Halet, G.; Kaldis, P.; Liu, K. Cdk1, but not Cdk2, is the sole Cdk that is essential and sufficient to drive resumption of meiosis in mouse oocytes. Hum. Mol. Genet. 2012, 21, 2476–2484. [Google Scholar] [CrossRef]
- Santamaría, D.; Barrière, C.; Cerqueira, A.; Hunt, S.; Tardy, C.; Newton, K.; Cáceres, J.F.; Dubus, P.; Malumbres, M.; Barbacid, M. Cdk1 is sufficient to drive the mammalian cell cycle. Nature 2007, 448, 811–815. [Google Scholar] [CrossRef]
- Gavet, O.; Pines, J. Progressive Activation of CyclinB1-Cdk1 Coordinates Entry to Mitosis. Dev. Cell 2010, 18, 533–543. [Google Scholar] [CrossRef]
- Hatano, N.; Mori, Y.; Oh-hora, M.; Kosugi, A.; Fujikawa, T.; Nakai, N.; Niwa, H.; Miyazaki, J.I.; Hamaoka, T.; Ogata, M. Essential role for ERK2 mitogen-activated protein kinase in placental development. Genes Cells 2003, 8, 847–856. [Google Scholar] [CrossRef] [PubMed]
- Saba-El-Leil, M.K.; Vella, F.D.J.; Vernay, B.; Voisin, L.; Chen, L.; Labrecque, N.; Ang, S.L.; Meloche, S. An essential function of the mitogen-activated protein kinase Erk2 in mouse trophoblast development. EMBO Rep. 2003, 4, 964–968. [Google Scholar] [CrossRef] [PubMed]
- Jeong, W.; Kim, J.; Bazer, F.W.; Song, G. Epidermal growth factor stimulates proliferation and migration of porcine trophectoderm cells through protooncogenic protein kinase 1 and extracellular-signal-regulated kinases 1/2 mitogen-activated protein kinase signal transduction cascades during early. Mol. Cell. Endocrinol. 2013, 381, 302–3311. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Liu, X.; Ren, X.; Tian, Y.; Chen, Z.; Xu, X.; Du, Y.; Jiang, C.; Fang, Y.; Liu, Z.; et al. Smad2 and Smad3 have differential sensitivity in relaying TGFβ signaling and inversely regulate early lineage specification. Sci. Rep. 2016, 6, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Shevach, E.M. CD4+CD25+ suppressor T cells: More questions than answers. Nat. Rev. Immunol. 2002, 2, 389–400. [Google Scholar] [CrossRef]
- Aluvihare, V.R.; Kallikourdis, M.; Betz, A.G. Regulatory T cells mediate maternal tolerance to the fetus. Nat. Immunol. 2004, 5, 266–271. [Google Scholar] [CrossRef]
- McBride, A.; Ghilagaber, S.; Nikolaev, A.; Hardie, D.G. The Glycogen-Binding Domain on the AMPK β Subunit Allows the Kinase to Act as a Glycogen Sensor. Cell Metab. 2009, 9, 23–34. [Google Scholar] [CrossRef]
- Lee, J.H.; Koh, H.; Kim, M.; Kim, Y.; Lee, S.Y.; Karess, R.E.; Lee, S.H.; Shong, M.; Kim, J.M.; Kim, J.; et al. Energy-dependent regulation of cell structure by AMP-activated protein kinase. Nature 2007, 447, 1017–1020. [Google Scholar] [CrossRef]
- Jansen, M.; Ten Klooster, J.P.; Offerhaus, G.J.; Clevers, H. LKB1 and AMPK family signaling: The intimate link between cell polarity and energy metabolism. Physiol. Rev. 2009, 89, 777–798. [Google Scholar] [CrossRef]
- Shiota, C.; Woo, J.T.; Lindner, J.; Shelton, K.D.; Magnuson, M.A. Multiallelic Disruption of the rictor Gene in Mice Reveals that mTOR Complex 2 Is Essential for Fetal Growth and Viability. Dev. Cell 2006, 11, 583–589. [Google Scholar] [CrossRef]
- Aimi, F.; Georgiopoulou, S.; Kalus, I.; Lehner, F.; Hegglin, A.; Limani, P.; De Lima, V.G.; Rüegg, M.A.; Hall, M.N.; Lindenblatt, N.; et al. Endothelial Rictor is crucial for midgestational development and sustained and extensive FGF2-induced neovascularization in the adult. Sci. Rep. 2015, 5, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, K.; Watson, L.A.; Davidson, B.; Jiang, Y.; Berube, N.G. ATRX is required for maintenance of the neuroprogenitor cell pool in the embryonic mouse brain. Biol. Open 2014, 3, 1158–1163. [Google Scholar] [CrossRef] [PubMed]
- Garrick, D.; Sharpe, J.A.; Arkell, R.; Dobbie, L.; Smith, A.J.H.; Wood, W.G.; Higgs, D.R.; Gibbons, R.J. Loss of Atrx affects trophoblast development and the pattern of X-inactivation in extraembryonic tissues. PLoS Genet. 2006, 2, e58. [Google Scholar] [CrossRef] [PubMed]
- Gehring, W.J. Homeo boxes in the study of development. Science 1987, 236, 1245–1252. [Google Scholar] [CrossRef]
- McGinnis, W.; Krumlauf, R. Homeobox genes and axial patterning. Cell 1992, 68, 283–302. [Google Scholar] [CrossRef]
- Bulfone, A.; Puelles, L.; Porteus, M.H.; Frohman, M.A.; Martin, G.R.; Rubenstein, J.L. Spatially restricted expression of Dlx-1, Dlx-2 (Tes-1), Gbx-2, and Wnt-3 in the embryonic day 12.5 mouse forebrain defines potential transverse and longitudinal segmental boundaries. J. Neurosci. 1993, 13, 3155–3172. [Google Scholar] [CrossRef]
- Martinez, C.A.; Cambra, J.M.; Parrilla, I.; Lucas, X.; Rodriguez-Martinez, H.; Martinez, E.A.; Izpisua, J.C.; Cuello, C.; Gil, M.A. Three-to-5-day weaning-to-estrus intervals do not affect neither efficiency of collection nor in vitro developmental ability of in vivo-derived pig zygotes. Theriogenology 2020, 141, 48–53. [Google Scholar] [CrossRef]
- Martinez, E.A.; Martinez, C.A.; Nohalez, A.; Sanchez-Osorio, J.; Vazquez, J.M.; Roca, J.; Parrilla, I.; Gil, M.A.; Cuello, C. Nonsurgical deep uterine transfer of vitrified, in vivo-derived, porcine embryos is as effective as the default surgical approach. Sci. Rep. 2015, 5, 1–9. [Google Scholar] [CrossRef]
- Wright, J.M. Photographic illustrations of embryo developmental stage and quality codes. In Manual of the International Embryo Transfer Society; Stringfellow, D.A., Seidel, S.M., Eds.; International Embryo Transfer Society (IETS): Savoy, IL, USA, 1998. [Google Scholar]
- Bolstad, B.M.; Irizarry, R.A.; Åstrand, M.; Speed, T.P. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 2003, 19, 185–193. [Google Scholar] [CrossRef]
- Curtis, R.K.; Orešič, M.; Vidal-Puig, A. Pathways to the analysis of microarray data. Trends Biotechnol. 2005, 23, 429–435. [Google Scholar] [CrossRef]
- Kanehisa, M. The KEGG database. Novartis Found. Symp. 2002, 247, 91–103. [Google Scholar] [PubMed]
- Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W.H.; Pagès, F.; Trajanoski, Z.; Galon, J. ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, 1091–1093. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]





| Pathway ID | Pathway Name | Enrichment p-Value | ||
|---|---|---|---|---|
| All | Up | Down | ||
| ssc04218 | Cellular senescence | 0.002 | 0.010 | 0.156 |
| ssc04115 | p53 signaling | 0.002 | 0.045 | 0.035 |
| ssc04371 | Apelin signaling | 0.006 | 0.030 | 0.124 |
| ssc04979 | Cholesterol metabolism | 0.008 | 0.036 | 0.194 |
| ssc04110 | Cell cycle | 0.021 | 0.030 | 0.428 |
| ssc04520 | Adherents junctions | 0.022 | 0.005 | - |
| ssc04140 | Autophagy-animal | 0.025 | 0.036 | 0.446 |
| ssc04068 | FoxO signaling | 0.027 | 0.036 | 0.452 |
| ssc04914 | Progesterone-mediated oocyte maturation | 0.041 | 0.061 | 0.333 |
| ssc04978 | Mineral absorption | 0.045 | - | 0.013 |
| ssc04923 | Regulation of lipolysis in adipocytes | 0.080 | - | 0.025 |
| ssc04926 | Relaxin signaling | 0.103 | 0.020 | - |
| ssc04550 | Signaling pathways regulating pluripotency of stem cell | 0.112 | 0.021 | - |
| ssc04910 | Insulin signaling | 0.114 | 0.037 | - |
| ssc04150 | mTOR signaling | 0.141 | 0.043 | - |
| Pathway ID | Pathway Name | Enrichment Score | Genes Altered (%) | Gene List |
|---|---|---|---|---|
| SSC04520 | Adherents junctions | 5.3 | 6.7 | PTRJ, MAPK1, SMAD2 |
| SSC04218 | Cellular senescence | 4.6 | 3.6 | MAPK1, SMAD2, CDK1 |
| SSC04926 | Relaxin signaling | 3.9 | 6.9 | MAPK1, Smad2, COL4A1 |
| SSC04550 | Signaling pathways regulating pluripotency of stem cell | 3.9 | 3.9 | Smad2, MAPK1, Hesx1 |
| SSC04110 | Cell cycle | 3.5 | 3.4 | Smad2, Stag1, CDK1 |
| SSC04371 | Apelin signaling | 3.5 | 3.4 | PRKAA1, SMAD2, MAPK1 |
| SSC04979 | Cholesterol metabolism | 3.3 | 5.1 | ApoA-I |
| SSC04068 | FoxO signaling | 3.3 | 3.1 | PRKAA1, SMAD2, MAPK1 |
| SSC04140 | Autophagy–animal | 3.3 | 3.1 | PRKAA1, ATG4C, MAPK1 |
| SSC04910 | Insulin signaling | 3.3 | 3.1 | PRKAA1, GYS1, MAPK1 |
| SSC04150 | mTOR signaling | 3.1 | 2.9 | MAPK1, PRKAA1, RICTOR |
| SSC04115 | P53 signaling | 3.1 | 4.5 | CDK1, IGF-BP3 |
| Pathway ID | Pathway Name | Enrichment Score | Genes Altered (%) | Gene List |
|---|---|---|---|---|
| SSC04978 | Mineral absorption | 3.6 | 6.7 | MT-2B |
| SSC04923 | Regulation of lipolysis in adipocytes | 3.3 | 5.7 | PTGS1, ADORA1 |
| SSC04115 | P53 signaling | 3.3 | 3.1 | CDK2, SERPINE1 |
| Gene | Accession Number | Primers (5′–3′) | Size (pb) | Efficiency (%) | R2 |
|---|---|---|---|---|---|
| ApoA-1 | NM_214398.1 | F: CGATCAAAGACAGTGGCAGA | 166 | 75.5 | 0.96 |
| R: TCCAGGTTGTCCCAGAACTC | |||||
| PTPRJ | XM_013994325.1 | F: CCAGCAAGACAACGCAGATA | 179 | 96.6 | 0.99 |
| R: GTGGAAGGAGGCTACAGGTG | |||||
| CDK1 | NM_001159304.2 | F: AGGCTAGAAAGTGAAGAGGAAGG | 193 | 115.0 | 0.99 |
| R: TGAACTGACCAGGAGGGATAG | |||||
| STAR | NM_213755.2 | F: CCCCGAGACTTTGTGAGTGT | 186 | 151.9 | 0.99 |
| R: CAGCCAGGTGAGTTTGGTCT | |||||
| EDEM1 | XM_003483209.3 | F: AGGACCAAGTGGAAAAGTCTG | 160 | 101.6 | 1.00 |
| R: CAAATCAAGCCAACCATCTG | |||||
| PPIA | XM_021078519.1 | F: CTGAAGCATACGGGTCCTGG | 100 | 98.1 | 1.00 |
| R: CCAACCACTCAGTCTTGGCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martinez, C.A.; Cambra, J.M.; Gil, M.A.; Parrilla, I.; Alvarez-Rodriguez, M.; Rodriguez-Martinez, H.; Cuello, C.; Martinez, E.A. Seminal Plasma Induces Overexpression of Genes Associated with Embryo Development and Implantation in Day-6 Porcine Blastocysts. Int. J. Mol. Sci. 2020, 21, 3662. https://doi.org/10.3390/ijms21103662
Martinez CA, Cambra JM, Gil MA, Parrilla I, Alvarez-Rodriguez M, Rodriguez-Martinez H, Cuello C, Martinez EA. Seminal Plasma Induces Overexpression of Genes Associated with Embryo Development and Implantation in Day-6 Porcine Blastocysts. International Journal of Molecular Sciences. 2020; 21(10):3662. https://doi.org/10.3390/ijms21103662
Chicago/Turabian StyleMartinez, Cristina A., Josep M. Cambra, Maria A. Gil, Inmaculada Parrilla, Manuel Alvarez-Rodriguez, Heriberto Rodriguez-Martinez, Cristina Cuello, and Emilio A. Martinez. 2020. "Seminal Plasma Induces Overexpression of Genes Associated with Embryo Development and Implantation in Day-6 Porcine Blastocysts" International Journal of Molecular Sciences 21, no. 10: 3662. https://doi.org/10.3390/ijms21103662
APA StyleMartinez, C. A., Cambra, J. M., Gil, M. A., Parrilla, I., Alvarez-Rodriguez, M., Rodriguez-Martinez, H., Cuello, C., & Martinez, E. A. (2020). Seminal Plasma Induces Overexpression of Genes Associated with Embryo Development and Implantation in Day-6 Porcine Blastocysts. International Journal of Molecular Sciences, 21(10), 3662. https://doi.org/10.3390/ijms21103662

