The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms
Abstract
:1. Introduction
2. Results
2.1. Construction of Isogenic Yeast Strains
2.2. Transactivation Activity of p53α
3. Discussion
4. Methods
4.1. Preparation of Plasmids to Express p53α Isoforms
4.2. Preparation of Yeast Isogenic Strains by Delitto Perfetto Homologous Recombination
4.3. Circular Dichroism (CD) Spectroscopy
4.4. Transformation of Yeast Strains
4.5. Luciferase Assay
4.6. Western Blot
4.7. Statistical Analysis
4.8. G4Hunter Analyses
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Lane, D.P. Cancer. p53, guardian of the genome. Nature 1992, 358, 15–16. [Google Scholar] [CrossRef] [PubMed]
- Oren, M. Decision making by p53: Life, death and cancer. Cell Death Differ. 2003, 10, 431–442. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K.; Dashzeveg, N.; Lu, Z.G.; Taira, N.; Miki, Y.; Yoshida, K. Programmed cell death 6, a novel p53-responsive gene, targets to the nucleus in the apoptotic response to DNA damage. Cancer Sci. 2012, 103, 1788–1794. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Simpson, E.R.; Brown, K.A. p53: Protection against Tumor Growth beyond Effects on Cell Cycle and Apoptosis. Cancer Res. 2015, 75, 5001–5007. [Google Scholar] [CrossRef] [Green Version]
- Levine, A.J. p53, the Cellular Gatekeeper for Growth and Division. Cell 1997, 88, 323–331. [Google Scholar] [CrossRef] [Green Version]
- Khoury, M.P.; Bourdon, J.-C. p53 Isoforms: An Intracellular Microprocessor? Genes Cancer 2011, 2, 453–465. [Google Scholar] [CrossRef] [Green Version]
- Joruiz, S.M.; Bourdon, J.-C. p53 Isoforms: Key Regulators of the Cell Fate Decision. Cold Spring Harb. Perspect. Med. 2016, 6, a026039. [Google Scholar] [CrossRef] [Green Version]
- Meek, D.W.; Anderson, C.W. Posttranslational Modification of p53: Cooperative Integrators of Function. Cold Spring Harb. Perspect. Biol. 2009, 1, a000950. [Google Scholar] [CrossRef] [Green Version]
- Cho, Y.; Gorina, S.; Jeffrey, P.D.; Pavletich, N.P. Crystal structure of a p53 tumor suppressor-DNA complex: Understanding tumorigenic mutations. Science 1994, 265, 346–355. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, A.; Stewart, D.; Matlashewski, G. Regulation of Human p53 Activity and Cell Localization by Alternative Splicing. Mol. Cell Biol. 2004, 24, 7987–7997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marcel, V.; Tran, P.L.T.; Sagne, C.; Martel-Planche, G.; Vaslin, L.; Teulade-Fichou, M.-P.; Hall, J.; Mergny, J.-L.; Hainaut, P.; Van Dyck, E. G-quadruplex structures in TP53 intron 3: Role in alternative splicing and in production of p53 mRNA isoforms. Carcinogenesis 2011, 32, 271–278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pavletich, N.P.; Chambers, K.A.; Pabo, C.O. The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots. Genes Dev. 1993, 7, 2556–2564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nutthasirikul, N.; Limpaiboon, T.; Leelayuwat, C.; Patrakitkomjorn, S.; Jearanaikoon, P. Ratio disruption of the Δ133p53 and TAp53 isoform equilibrium correlates with poor clinical outcome in intrahepatic cholangiocarcinoma. Int. J. Oncol. 2013, 42, 1181–1188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chambers, S.K.; Martinez, J.D. The significance of p53 isoform expression in serous ovarian cancer. Future Oncol. 2012, 8, 683–686. [Google Scholar] [CrossRef] [Green Version]
- El-Deiry, W.S.; Kern, S.E.; Pietenpol, J.A.; Kinzler, K.W.; Vogelstein, B. Definition of a consensus binding site for p53. Nat. Genet. 1992, 1, 45. [Google Scholar] [CrossRef]
- Weinberg, R.L.; Veprintsev, D.B.; Bycroft, M.; Fersht, A.R. Comparative Binding of p53 to its Promoter and DNA Recognition Elements. J. Mol. Biol. 2005, 348, 589–596. [Google Scholar] [CrossRef]
- Vyas, P.; Beno, I.; Xi, Z.; Stein, Y.; Golovenko, D.; Kessler, N.; Rotter, V.; Shakked, Z.; Haran, T.E. Diverse p53/DNA binding modes expand the repertoire of p53 response elements. Proc. Natl. Acad. Sci. USA 2017, 114, 10624–10629. [Google Scholar] [CrossRef] [Green Version]
- Brázda, V.; Coufal, J. Recognition of local DNA structures by p53 protein. Int. J. Mol. Sci. 2017, 18, 375. [Google Scholar] [CrossRef] [Green Version]
- Brázda, V.; Fojta, M. The Rich World of p53 DNA Binding Targets: The Role of DNA Structure. Int. J. Mol. Sci. 2019, 20, 5605. [Google Scholar] [CrossRef] [Green Version]
- Qian, H.; Wang, T.; Naumovski, L.; Lopez, C.D.; Brachmann, R.K. Groups of p53 target genes involved in specific p53 downstream effects cluster into different classes of DNA binding sites. Oncogene 2002, 21, 7901–7911. [Google Scholar] [CrossRef] [Green Version]
- Menendez, D.; Inga, A.; Resnick, M.A. The expanding universe of p53 targets. Nat. Rev. Cancer 2009, 9, 724–737. [Google Scholar] [CrossRef] [PubMed]
- Göhler, T.; Reimann, M.; Cherny, D.; Walter, K.; Warnecke, G.; Kim, E.; Deppert, W. Specific Interaction of p53 with Target Binding Sites Is Determined by DNA Conformation and Is Regulated by the C-terminal Domain. J. Biol. Chem. 2002, 277, 41192–41203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jagelska, E.B.; Brazda, V.; Pecinka, P.; Palecek, E.; Fojta, M. DNA topology influences p53 sequence-specific DNA binding through structural transitions within the target sites. Biochem. J. 2008, 412, 57–63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coufal, J.; Jagelská, E.B.; Liao, J.C.C.; Brazda, V. Preferential binding of p53 tumor suppressor to p21 promoter sites that contain inverted repeats capable of forming cruciform structure. Biochem. Biophys. Res. Commun. 2013, 441, 83–88. [Google Scholar] [CrossRef] [PubMed]
- Brazda, V.; Čechová, J.; Battistin, M.; Coufal, J.; Jagelská, E.B.; Raimondi, I.; Inga, A. The structure formed by inverted repeats in p53 response elements determines the transactivation activity of p53 protein. Biochem. Biophys. Res. Commun. 2017, 483, 516–521. [Google Scholar] [CrossRef] [PubMed]
- Petr, M.; Helma, R.; Polaskova, A.; Krejci, A.; Dvorakova, Z.; Kejnovska, I.; Navratilova, L.; Adamik, M.; Vorlickova, M.; Brazdova, M. Wild-type p53 binds to MYC promoter G-quadruplex. Biosci. Rep. 2016, 36, e00397. [Google Scholar] [CrossRef] [Green Version]
- Brazdova, M.; Tichy, V.; Helma, R.; Bazantova, P.; Polaskova, A.; Krejci, A.; Petr, M.; Navratilova, L.; Ticha, O.; Nejedly, K.; et al. p53 Specifically Binds Triplex DNA In Vitro and in Cells. PLoS ONE 2016, 11, e0167439. [Google Scholar] [CrossRef]
- Degtyareva, N.; Subramanian, D.; Griffith, J.D. Analysis of the binding of p53 to DNAs containing mismatched and bulged bases. J. Biol. Chem. 2001, 276, 8778–8784. [Google Scholar] [CrossRef] [Green Version]
- Stros, M.; Muselikova-Polanska, E.; Pospisilova, S.; Strauss, F. High-affinity binding of tumor-suppressor protein p53 and HMGB1 to hemicatenated DNA loops. Biochemistry 2004, 43, 7215–7225. [Google Scholar] [CrossRef]
- Spradling, A.; Ganetsky, B.; Hieter, P.; Johnston, M.; Olson, M.; Orr-Weaver, T.; Rossant, J.; Sanchez, A.; Waterston, R. New roles for model genetic organisms in understanding and treating human disease: Report from the 2006 Genetics Society of America meeting. Genetics 2006, 172, 2025–2032. [Google Scholar]
- Lion, M.; Raimondi, I.; Donati, S.; Jousson, O.; Ciribilli, Y.; Inga, A. Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay. PLoS ONE 2015, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guaragnella, N.; Palermo, V.; Galli, A.; Moro, L.; Mazzoni, C.; Giannattasio, S. The expanding role of yeast in cancer research and diagnosis: Insights into the function of the oncosuppressors p53 and BRCA1/2. FEMS Yeast Res. 2014, 14, 2–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bedrat, A.; Lacroix, L.; Mergny, J.-L. Re-evaluation of G-quadruplex propensity with G4Hunter. Nucleic Acids Res. 2016, 44, 1746–1759. [Google Scholar] [CrossRef] [PubMed]
- Brázda, V.; Kolomazník, J.; Lýsek, J.; Bartas, M.; Fojta, M.; Šťastný, J.; Mergny, J.-L. G4Hunter web application: A web server for G-quadruplex prediction. Bioinformatics 2019, 35, 3493–3495. [Google Scholar] [CrossRef] [Green Version]
- Siddiqui-Jain, A.; Grand, C.L.; Bearss, D.J.; Hurley, L.H. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. USA 2002, 99, 11593–11598. [Google Scholar] [CrossRef] [Green Version]
- Yang, D.; Hurley, L.H. Structure of the biologically relevant G-quadruplex in the c-MYC promoter. Nucleosides Nucleotides Nucleic Acids 2006, 25, 951–968. [Google Scholar] [CrossRef]
- Ambrus, A.; Chen, D.; Dai, J.; Bialis, T.; Jones, R.A.; Yang, D. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 2006, 34, 2723–2735. [Google Scholar] [CrossRef] [Green Version]
- Del Villar-Guerra, R.; Trent, J.O.; Chaires, J.B. G-Quadruplex Secondary Structure Obtained from Circular Dichroism Spectroscopy. Angew. Chem. Int. Ed. Engl. 2018, 57, 7171–7175. [Google Scholar] [CrossRef]
- Nguyen, T.-A.T.; Grimm, S.A.; Bushel, P.R.; Li, J.; Li, Y.; Bennett, B.D.; Lavender, C.A.; Ward, J.M.; Fargo, D.C.; Anderson, C.W.; et al. Revealing a human p53 universe. Nucleic Acids Res. 2018, 46, 8153–8167. [Google Scholar] [CrossRef] [Green Version]
- Jordan, J.J.; Menendez, D.; Inga, A.; Nourredine, M.; Bell, D.; Resnick, M.A. Noncanonical DNA Motifs as Transactivation Targets by Wild Type and Mutant p53. PLoS Genet. 2008, 4, e1000104. [Google Scholar] [CrossRef]
- Brázda, V.; Laister, R.C.; Jagelská, E.B.; Arrowsmith, C. Cruciform structures are a common DNA feature important for regulating biological processes. BMC Mol. Biol. 2011, 12, 33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huppert, J.L.; Balasubramanian, S. G-quadruplexes in promoters throughout the human genome. Nucleic Acids Res. 2007, 35, 406–413. [Google Scholar] [CrossRef] [PubMed]
- Tokan, V.; Puterova, J.; Lexa, M.; Kejnovsky, E. Quadruplex DNA in long terminal repeats in maize LTR retrotransposons inhibits the expression of a reporter gene in yeast. BMC Genom. 2018, 19, 184. [Google Scholar] [CrossRef] [PubMed]
- Candeias, M.M.; Hagiwara, M.; Matsuda, M. Cancer-specific mutations in p53 induce the translation of Δ160p53 promoting tumorigenesis. EMBO Rep. 2016, 17, 1542–1551. [Google Scholar] [CrossRef] [PubMed]
- User guide: Gateway Technology with Clonase II-A universal technology to clone DNA sequences for functional analysis and expression in multiple systems. Available online: http://tools.thermofisher.com/content/sfs/manuals/gateway_clonaseii_man.pdf (accessed on 10 January 2019).
- Storici, F.; Resnick, M.A. The delitto perfetto approach to in vivo site-directed mutagenesis and chromosome rearrangements with synthetic oligonucleotides in yeast. Methods Enzym. 2006, 409, 329–345. [Google Scholar]
- Sharma, V.; Monti, P.; Fronza, G.; Inga, A. Human transcription factors in yeast: The fruitful examples of P53 and NF-κB. FEMS Yeast Res. 2016, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andreotti, V.; Ciribilli, Y.; Monti, P.; Bisio, A.; Lion, M.; Jordan, J.; Fronza, G.; Menichini, P.; Resnick, M.A.; Inga, A. p53 Transactivation and the Impact of Mutations, Cofactors and Small Molecules Using a Simplified Yeast-Based Screening System. PLoS ONE 2011, 6, e20643. [Google Scholar] [CrossRef]
- Vojtesek, B.; Dolezalova, H.; Lauerova, L.; Svitakova, M.; Havlis, P.; Kovarik, J.; Midgley, C.A.; Lane, D.P. Conformational changes in p53 analysed using new antibodies to the core DNA binding domain of the protein. Oncogene 1995, 10, 389–393. [Google Scholar]
- Brazda, V.; Muller, P.; Brozkova, K.; Vojtesek, B. Restoring wild-type conformation and DNA-binding activity of mutant p53 is insufficient for restoration of transcriptional activity. Biochem. Biophys. Res. Commun. 2006, 351, 499–506. [Google Scholar] [CrossRef]
- Pospísilová, S.; Brázda, V.; Amrichová, J.; Kamermeierová, R.; Palecek, E.; Vojtesek, B. Precise characterisation of monoclonal antibodies to the C-terminal region of p53 protein using the PEPSCAN ELISA technique and a new non-radioactive gel shift assay. J. Immunol. Methods 2000, 237, 51–64. [Google Scholar] [CrossRef]
- Sayers, E.W.; Agarwala, R.; Bolton, E.E.; Brister, J.R.; Canese, K.; Clark, K.; Connor, R.; Fiorini, N.; Funk, K.; Hefferon, T.; et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2019, 47, D23–D28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Region | Sequence 5’−3’ |
---|---|
PUMA | CTGCAAGTCCTGACTTGTCC |
PUMA–G4 | CTGCAAGTCCTGACTTGTCCGGGGCGGGGGACGGGGGAGGGG |
G4–PUMA | GGGGCGGGGGACGGGGGAGGGGCTGCAAGTCCTGACTTGTCC |
G4 | GGGGCGGGGGACGGGGGAGGGG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Porubiaková, O.; Bohálová, N.; Inga, A.; Vadovičová, N.; Coufal, J.; Fojta, M.; Brázda, V. The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms. Int. J. Mol. Sci. 2020, 21, 127. https://doi.org/10.3390/ijms21010127
Porubiaková O, Bohálová N, Inga A, Vadovičová N, Coufal J, Fojta M, Brázda V. The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms. International Journal of Molecular Sciences. 2020; 21(1):127. https://doi.org/10.3390/ijms21010127
Chicago/Turabian StylePorubiaková, Otília, Natália Bohálová, Alberto Inga, Natália Vadovičová, Jan Coufal, Miroslav Fojta, and Václav Brázda. 2020. "The Influence of Quadruplex Structure in Proximity to P53 Target Sequences on the Transactivation Potential of P53 Alpha Isoforms" International Journal of Molecular Sciences 21, no. 1: 127. https://doi.org/10.3390/ijms21010127