Overexpression of SmANS Enhances Anthocyanin Accumulation and Alters Phenolic Acids Content in Salvia miltiorrhiza and Salvia miltiorrhiza Bge f. alba Plantlets
Abstract
1. Introduction
2. Results
2.1. Isolation and Bioinformatics Analysis of SmANS
2.2. Spatio-Temporal Expression of SmANS in S. miltiorrhiza and S. miltiorrhiza Bge f. alba
2.3. Subcellular Location of SmANS Protein
2.4. Generation of SmANS-Overexpressing Transgenic S. miltiorrhiza and S. miltiorrhiza Bge f. alba Plantlets
2.5. SmANS Overexpression Improves the Accumulation of Flavonoids in Transgenic S. miltiorrhiza and S. miltiorrhiza Bge f. alba Plantlets
2.6. Overexpression of SmANS Up-Regulates Parts of Pathway Genes Involved in Flavonoids Biosynthesis
2.7. SmANS Overexpression Indirectly Affects the Salvianolic Acids Branched Pathway
2.8. SmANS-Overexpression Down-Regulates the Expression Levels of Part Transcriptional Regulation Factors
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Total RNA and DNA Extraction
4.3. Isolation and Bioinformatics Analysis of SmANS
4.4. QRT-PCR Analysis
4.5. Subcellular Localization Analysis
4.6. Acquisition of Positive Transgenic Lines
4.7. Extraction and Determination Anthocyanin, Catechin, and Epicatechin
4.8. Extraction and Determination of Phenolic Acids and Total Flavonoid
4.9. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Appendix A

| Primer | Sequence (5′ to 3′) | Note |
|---|---|---|
| ANS-F1 | CGTGATGCACCTGGTCaaycayggnrt | Homologous cloning of SmANS |
| ANS-R2 | GGACAGGATCTCGATGGTGtcnccdatrtg | |
| ANS-R3 | CAGGCCGGGCaccatrttrtg | |
| SmANS-F1 | CTGAAGCGGGAAGGGACT | Full length cDNA cloning of SmANS |
| SmANS-R1 | GAGGACCTAACAGAACTCGCC | |
| SmANS-GFPf | TTTTTTGTCGACATGGTTGCTACACCGG (SalI site underlined) | Construction of subcellular localization vector |
| SmANS-GFPr | GGGACTAGTGCACTCGATTTATCATAATCAGGC (SpeI site underlined) | |
| SmANS-OE-F | TTTTGGATCCATGGTTGCTACACCGG (BamHI site underlined) | Construction of overexpression vector |
| SmANS-OE-R | CGCGGGGTACCTCAACTCGATTTATCA (KpnI site underlined) | |
| 2300NPTII-F | ATACCGTAAAGCACGAGGAAG | Transgenic lines identification |
| 2300NPTII-R | CTGAAGCGGGAAGGGACT | |
| CaMV35S-F | GAGGACCTAACAGAACTCGCC | |
| SmANS-O-R | CCAAATAGACAAGTCCCTCT | |
| SmCHI-F | TTCCATTCCAGAGCAAGGCG | qRT-PCR analysis |
| SmCHI-R | CCTTGCAGTAGGCGACACTCCTT | |
| SmUF3GT-F | AGCCAAAACCGCCCTAATTCAGTA | |
| SmUF3GT-R | ATGGGAATCCGCATGTTTCTAGG | |
| SmFSNII-F | TCGACCCGATCATCACCAAAGAC | |
| SmFSNII-R | GGGAATCCGCATGTTTCTAGG | |
| SmDFR-F | TAAACTTCATCAGCATCATACCACC | |
| SmDFR-R | TCCTTGCTTTATGATGGAGTAGTG | |
| SmANS-F | CTTGTCTATTTGGCCCAAGCACC | |
| SmANS-R | CTGAGGGCATTTCGGGTAGAAG | |
| SmF3H-F | AAAGCGTGCGTTGATATGG | |
| SmF3H-R | GATCCATGTATTACCACCATCC | |
| SmF3’H-F | TGCCACGAACGCAATAGCTC | |
| SmF3’H-R | TTGAATACTCCAGCCAACGACA | |
| SmActin-F | GGTGCCCTGAGGTCCTGTT | |
| SmActin-R | AGGAACCACCGATCCAGACA |
| ANS Protein | Species Names | GenBank ID |
|---|---|---|
| SmANS | Salvia miltiorrhiza | MK704422 |
| PsANS | Paeonia suffruticosa | AEN71543.1 |
| PrANS | Paeonia rockii | AIL29326.1 |
| PlANS | Paeonia lactiflora | AFI71900.1 |
| CsANS | Citrus sinensis | NP_001275784.1 |
| TcANS | Theobroma cacao | ADD51356.1 |
| VvhANS | Vitis vinifera | ABV82967.1 |
| FeANS | Fagopyrum esculentum | ADT63066.1 |
| FdANS | Fagopyrum dibotrys | AHH30830.1 |
| GeANS | Gypsophila elegans | AAP13054.1 |
| MiANS | Matthiola incana | AAB82287.1 |
| AtANS | Arabidopsis thaliana | NP_194019.1 |
| GmANS3 | Glycine max | AAR26527.1 |
| GmANS2 | Glycine max | AAR26526.1 |
| GmANS | Triticum aestivum | BAE98273.1 |
| GbANS | Ginkgo biloba | ACC66093.1 |
| LsANS | Lactuca sativa | AVV62510.1 |
| IbANS | Ipomoea batatas | BAA75305.1 |
| IcANS | Ipomoea coccinea | BAL43066.1 |
| IhANS | Ipomoea horsfalliae | ACS71531.1 |
| IpANS | Ipomoea purpurea | ABW69684.1 |
| InANS | Ipomoea nil | BAB71806.1 |
| IheANS | Ipomoea hederacea | AAP82029.1 |
| StANS | Solanum tuberosum | NP_001274859.1 |
| NtANS1 | Nicotiana tabacum | AFM52334.1 |
| NtANS2 | Nicotiana tabacum | AFM52335.1 |
| ElANS | Erythranthe lewisii | AHJ80980.1 |
| SsANS | Solenostemon scutellarioides | ABP57081.1 |
| SsANS1 | Solenostemon scutellarioides | ABP57079.1 |
| DcANS1 | Daucus carota | AF184273_1 |
| DcANS2 | Daucus carota | AF184274_1 |
| PpANS | Prunus persica | XP_007210520.1 |
| PaANS | Prunus avium | ADZ54785.1 |
| PcANS | Pyrus communis | AGL50919.1 |
| MdANS | Malus domestica | XP_008356542.1 |
| TaANS | Triticum aestivum | BAE98273.1 |
| LsANS | Lactuca sativa | AVV62510.1 |
| DpANS | Dahlia pinnata | BAJ21536.1 |
| RrANS | Rosa rugosa | AKT74337.1 |
| OsANS | Oryza sativa | CAA69252.1 |
| PgANS | Punica granatum | AHZ97874.1 |
| AcANS | Allium cepa | ABM66367.1 |
| MtANS | Medicago truncatula | ABU40983.1 |
| MaANS | Morus alba | AOV62765.1 |
| LcANS | Lycoris chinensis | AGD99672.1 |
| LrANS | Lycoris radiata | AIA59795.1 |
| OoANS | Oryza officinalis | ANY30309.1 |
| ZmaANS | Zostera marina | KMZ76142.1 |
| PxhANS | Petunia x hybrida | P51092.1 |
| ZmANS | Zea mays | NP_001106074.1 |
References
- Ma, Y.; Yuan, L.; Wu, B.; Li, X.E.; Chen, S.; Lu, S. Genome-wide identification and characterization of novel genes involved in terpenoid biosynthesis in Salvia miltiorrhiza. J. Exp. Bot. 2012, 63, 2809–2823. [Google Scholar] [CrossRef]
- Hao, G.P.; Jiang, X.Y.; Feng, L.; Tao, R.; Li, Y.L.; Huang, L.Q. Cloning, molecular characterization and functional analysis of a putative R2R3-MYB transcription factor of the phenolic acid biosynthetic pathway in S. miltiorrhiza Bge f. alba. Plant Cell Tissue Organ Cult. 2016, 124, 151–168. [Google Scholar] [CrossRef]
- Zhang, S.; Ma, P.; Yang, D.; Li, W.; Liang, Z.; Liu, Y.; Liu, F. Cloning and characterization of a putative R2R3 MYB transcriptional repressor of the rosmarinic acid biosynthetic pathway from Salvia miltiorrhiza. PLoS ONE 2013, 8, e73259. [Google Scholar] [CrossRef]
- Ravipati, A.S.; Zhang, L.; Koyyalamudi, S.R.; Jeong, S.C.; Reddy, N.; Bartlett, J.; Smith, P.T.; Shanmugam, K.; Munch, G.; Wu, M.J.; et al. Antioxidant and anti-inflammatory activities of selected Chinese medicinal plants and their relation with antioxidant content. BMC Complement. Altern. Med. 2012, 12, 173. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y.; Sasaki, N.; Ohmiya, A. Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J. 2008, 54, 733–749. [Google Scholar] [CrossRef]
- Veitch, N.C.; Grayer, R.E.J. Flavonoids and their glycosides, including anthocyanins. Nat. Prod. Rep. 2008, 25, 555–611. [Google Scholar] [CrossRef] [PubMed]
- Winkel-Shirley, B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, 485–493. [Google Scholar] [CrossRef] [PubMed]
- Nakabayashi, R.; Saito, K. Integrated metabolomics for abiotic stress responses in plants. Curr. Opin. Plant Biol. 2015, 24, 10–16. [Google Scholar] [CrossRef]
- Medina-Puche, L.; Cumplido-Laso, G.; Amil-Ruiz, F.; Hoffmann, T.; Ring, L.; Rodriguez-Franco, A.; Luis Caballero, J.; Schwab, W.; Munoz-Blanco, J.; Blanco-Portales, R. MYB10 plays a major role in the regulation of flavonoid/phenylpropanoid metabolism during ripening of Fragaria ananassa fruits. J. Exp. Bot. 2014, 65, 401–417. [Google Scholar] [CrossRef] [PubMed]
- Qi, T.; Song, S.; Ren, Q.; Wu, D.; Huang, H.; Chen, Y.; Fan, M.; Peng, W.; Ren, C.; Xie, D. The Jasmonate-ZIM-Domain Proteins Interact with the WD-Repeat/bHLH/MYB Complexes to Regulate Jasmonate-Mediated Anthocyanin Accumulation and Trichome Initiation in Arabidopsis thaliana. Plant Cell 2011, 23, 1795–1814. [Google Scholar] [CrossRef] [PubMed]
- Yousuf, B.; Gul, K.; Wani, A.A.; Singh, P. Health benefits of anthocyanins and their encapsulation for potential use in food systems: A review. Crit. Rev. Food Sci. 2016, 56, 2223–2230. [Google Scholar] [CrossRef]
- Zhang, Y.; Yan, Y.P.; Wu, Y.C.; Hua, W.P.; Chen, C.; Ge, Q.; Wang, Z.Z. Pathway engineering for phenolic acid accumulations in Salvia miltiorrhiza by combinational genetic manipulation. Metab. Eng. 2014, 21, 71–80. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Li, H.; Liang, X.; Yan, Y.; Xia, P.; Jia, Y.; Liang, Z. Enhanced production of phenolic acids in Salvia miltiorrhiza hairy root cultures by combing the RNAi-mediated silencing of chalcone synthase gene with salicylic acid treatment. Biochem. Eng. J. 2015, 103, 185–192. [Google Scholar] [CrossRef]
- Wang, N.; Xu, H.; Jiang, S.; Zhang, Z.; Lu, N.; Qiu, H.; Qu, C.; Wang, Y.; Wu, S.; Chen, X. MYB12 and MYB22 play essential roles in proanthocyanidin and flavonol synthesis in red-fleshed apple (Malus sieversii f. niedzwetzkyana). Plant J. 2017, 90, 276–292. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Chen, B.; Zhang, G.; Chen, L.; Dong, Q.; Wen, J.; Mysore, K.S.; Zhao, J. Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bHLH transcription factor MtTT8. New Phytol. 2016, 210, 905–921. [Google Scholar] [CrossRef]
- Wang, N.; Qu, C.; Jiang, S.; Chen, Z.; Xu, H.; Fang, H.; Su, M.; Zhang, J.; Wang, Y.; Liu, W.; et al. The proanthocyanidin-specific transcription factor MdMYBPA1 initiates anthocyanin synthesis under low-temperature conditions in red-fleshed apples. Plant J. 2018, 96, 39–55. [Google Scholar] [CrossRef]
- Xu, W.; Grain, D.; Bobet, S.; Le Gourrierec, J.; Thevenin, J.; Kelemen, Z.; Lepiniec, L.; Dubos, C. Complexity and robustness of the flavonoid transcriptional regulatory network revealed by comprehensive analyses of MYB-bHLH-WDR complexes and their targets in Arabidopsis seed. New Phytol. 2014, 202, 132–144. [Google Scholar] [CrossRef]
- Xu, W.; Dubos, C.; Lepiniec, L. Transcriptional control of flavonoid biosynthesis by MYB-bHLH-WDR complexes. Trends Plant Sci. 2015, 20, 176–185. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Wu, Y.; Kuang, J.; Wang, H.; Du, T.; Huang, Y.; Zhang, Y.; Cao, X.; Wang, Z. SmMYB111 is a key factor to phenolic acid biosynthesis and interacts with both SmTTG1 and SmbHLH51 in Salvia miltiorrhiza. J. Agric. Food Chem. 2018, 66, 8069–8078. [Google Scholar] [CrossRef] [PubMed]
- Ding, K.; Pei, T.; Bai, Z.; Jia, Y.; Ma, P.; Liang, Z. SmMYB36, a Novel R2R3-MYB transcription factor, enhances tanshinone accumulation and decreases phenolic acid content in Salvia miltiorrhiza hairy roots. Sci. Rep. 2017, 7, 5104. [Google Scholar] [CrossRef]
- Li, C.; Lu, S. Genome-wide characterization and comparative analysis of R2R3-MYB transcription factors shows the complexity of MYB-associated regulatory networks in Salvia miltiorrhiza. BMC Genom. 2014, 15. [Google Scholar] [CrossRef]
- Ben-Simhon, Z.; Judeinstein, S.; Trainin, T.; Harel-Beja, R.; Bar-Ya’akov, I.; Borochov-Neori, H.; Holland, D. A "White" anthocyanin-less pomegranate (Punica granatum L.) caused by an insertion in the coding region of the leucoanthocyanidin dioxygenase (LDOX; ANS) gene. PLoS One 2015, 10, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Fang, J.; Qi, X.; Lin, M.; Zhong, Y.; Sun, L. A key structural gene, AaLDOX, is involved in anthocyanin biosynthesis in all red-fleshed kiwifruit (Actinidia arguta) based on transcriptome analysis. Gene 2018, 648, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Rafique, M.Z.; Carvalho, E.; Stracke, R.; Palmieri, L.; Herrera, L.; Feller, A.; Malnoy, M.; Martens, S. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L.). Front. Plant Sci. 2016, 7, 1892. [Google Scholar] [CrossRef]
- Yu, Z.; Liao, Y.; da Silva, J.A.T.; Yang, Z.; Duan, J. Differential accumulation of anthocyanins in dendrobium officinale stems with red and green peels. Int. J. Mol. Sci. 2018, 19, 2857. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Shi, Z.; Maximova, S.; Payne, M.J.; Guiltinan, M.J. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase. BMC Plant Biol. 2013, 13, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Jun, J.H.; Xiao, X.; Rao, X.; Dixon, R.A. Proanthocyanidin subunit composition determined by functionally diverged dioxygenases. Nat. Plants 2018, 4, 1034–1043. [Google Scholar] [CrossRef] [PubMed]
- Szankowski, I.; Flachowsky, H.; Li, H.; Halbwirth, H.; Treutter, D.; Regos, I.; Hanke, M.-V.; Stich, K.; Fischer, T.C. Shift in polyphenol profile and sublethal phenotype caused by silencing of anthocyanidin synthase in apple (Malus sp.). Planta 2009, 229, 681–692. [Google Scholar] [CrossRef]
- Giampieri, F.; Gasparrini, M.; Forbes-Hernandez, T.Y.; Mazzoni, L.; Capocasa, F.; Sabbadini, S.; Alvarez-Suarez, J.M.; Afrin, S.; Rosati, C.; Pandolfini, T.; et al. Overexpression of the anthocyanidin synthase gene in strawberry enhances antioxidant capacity and cytotoxic effects on human hepatic cancer cells. J. Agric. Food Chem. 2018, 66, 581–592. [Google Scholar] [CrossRef]
- Shao, Y.X.; Wei, J.B.; Wu, F.L.; Zhang, H.H.; Yang, D.F.; Liang, Z.S.; Jin, W.B. DsTRD: Danshen transcriptional resource database. PLoS ONE 2016, 11, 1–8. [Google Scholar] [CrossRef]
- Pei, T.; Ma, P.; Ding, K.; Liu, S.; Jia, Y.; Ru, M.; Dong, J.; Liang, Z. SmJAZ8 acts as a core repressor regulating JA-induced biosynthesis of salvianolic acids and tanshinones in Salvia miltiorrhiza hairy roots. J. Exp. Bot. 2018, 69, 1663–1678. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Li, C.; Li, H.; Lu, S. Identification and characterization of flavonoid biosynthetic enzyme genes in Salvia miltiorrhiza (Lamiaceae). Molecules 2018, 23, 1467. [Google Scholar] [CrossRef]
- Nakatsuka, T.; Nishihara, M.; Mishiba, K.; Yamamura, S. Two different mutations are involved in the formation of white-flowered gentian plants. Plant Sci. 2005, 169, 949–958. [Google Scholar] [CrossRef]
- Jiang, S.-H.; Sun, Q.-G.; Chen, M.; Wang, N.; Xu, H.-F.; Fang, H.-C.; Wang, Y.-C.; Zhang, Z.-Y.; Chen, X.-S. Methylome and transcriptome analyses of apple fruit somatic mutations reveal the difference of red phenotype. BMC Genom. 2019, 20, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Yang, N.; Zhao, K.; Li, X.; Zhao, R.; Aslam, M.Z.; Yu, L.; Chen, L. Comprehensive analysis of wintersweet flower reveals key structural genes involved in flavonoid biosynthetic pathway. Gene 2018, 676, 279–289. [Google Scholar] [CrossRef]
- Reddy, A.M.; Reddy, V.S.; Scheffler, B.E.; Wienand, U.; Reddy, A.R. Novel transgenic rice overexpressing anthocyanidin synthase accumulates a mixture of flavonoids leading to an increased antioxidant potential. Metab. Eng. 2007, 9, 95–111. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Xu, M.; Xiao, Y.; Cui, D.; Qin, Y.; Wu, J.; Wang, W.; Wang, G. Fine mapping identifies smfas encoding an anthocyanidin synthase as a putative candidate gene for flower purple color in Solanum melongena L. Int. J. Mol. Sci. 2018, 19, 789. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.-S.; Huang, Y.; Wang, F.; Song, X.; Wang, G.-L.; Xiong, A.-S. Transcript profiling of structural genes involved in cyanidin-based anthocyanin biosynthesis between purple and non-purple carrot (Daucus carota L.) cultivars reveals distinct patterns. BMC Plant Biol. 2014, 14, 262. [Google Scholar] [CrossRef]
- Luo, J.R.; Shi, Q.Q.; Niu, L.X.; Zhang, Y.L. Transcriptomic analysis of leaf in tree peony reveals differentially expressed pigments genes. Molecules 2017, 22, 324. [Google Scholar] [CrossRef]
- Suzuki, K.; Suzuki, T.; Nakatsuka, T.; Dohra, H.; Yamagishi, M.; Matsuyama, K.; Matsuura, H. RNA-seq-based evaluation of bicolor tepal pigmentation in Asiatic hybrid lilies (Lilium spp.). BMC Genom. 2016, 17, 611. [Google Scholar] [CrossRef]
- Sun, Y.; Li, H.; Huang, J.-R. Arabidopsis TT19 functions as a carrier to transport anthocyanin from the cytosol to tonoplasts. Mol. Plant 2012, 5, 387–400. [Google Scholar] [CrossRef]
- Wang, H.L.; Wang, W.; Zhang, P.; Pan, Q.H.; Zhan, J.C.; Huang, W.D. Gene transcript accumulation, tissue and subcellular localization of anthocyanidin synthase (ANS) in developing grape berries. Plant Sci. 2010, 179, 103–113. [Google Scholar] [CrossRef]
- Hrazdina, G.; Wagner, G.J. Metabolic pathways as enzyme complexes: evidence for the synthesis of phenylpropanoids and flavonoids on membrane associated enzyme complexes. Arch. Biochem. Biophys. 1985, 237, 88–100. [Google Scholar] [CrossRef]
- Fujino, N.; Tenma, N.; Waki, T.; Ito, K.; Komatsuzaki, Y.; Sugiyama, K.; Yamazaki, T.; Yoshida, S.; Hatayama, M.; Yamashita, S.; et al. Physical interactions among flavonoid enzymes in snapdragon and torenia reveal the diversity in the flavonoid metabolon organization of different plant species. Plant J. 2018, 94, 372–392. [Google Scholar] [CrossRef]
- Chen, C.; Wei, K.; Wang, L.; Ruan, L.; Li, H.; Zhou, X.; Lin, Z.; Shan, R.; Cheng, H. Expression of key structural genes of the phenylpropanoid pathway associated with catechin epimerization in tea cultivars. Front. Plant Sci. 2017, 8, 702. [Google Scholar] [CrossRef]
- Li, J.; Zhao, A.; Yu, M.; Li, Y.; Liu, X.; Chen, X. Function analysis of anthocyanidin synthase from Morus alba L. by expression in bacteria and tobacco. Electron. J. Biotechn. 2018, 36, 9–14. [Google Scholar] [CrossRef]
- Zhang, J.; Han, Z.Y.; Tian, J.; Zhang, X.; Song, T.-T.; Yao, Y.C. The expression level of anthocyanidin synthase determines the anthocyanin content of crabapple (Malus sp.) petals. Acta Physiol. Plant. 2015, 37, 109. [Google Scholar] [CrossRef]
- Mouradov, A.; Spangenberg, G. Flavonoids: A metabolic network mediating plants adaptation to their real estate. Front. Plant Sci. 2014, 5, 620. [Google Scholar] [CrossRef] [PubMed]
- Strygina, K.V.; Boerner, A.; Khlestkina, E.K. Identification and characterization of regulatory network components for anthocyanin synthesis in barley aleurone. BMC Plant Biol. 2017, 17, 110–155. [Google Scholar] [CrossRef]
- Jun, J.H.; Liu, C.; Xiao, X.; Dixon, R.A. The Transcriptional repressor MYB2 regulates both spatial and temporal patterns of proanthocyandin and anthocyanin pigmentation in Medicago truncatula. Plant Cell 2015, 27, 2860–2879. [Google Scholar] [CrossRef]
- Lim, S.H.; Kim, D.H.; Kim, J.K.; Lee, J.Y.; Ha, S.H. A radish basic helix-loop-helix transcription factor, RsTT8 acts a positive regulator for anthocyanin biosynthesis. Front. Plant Sci. 2017, 8. [Google Scholar] [CrossRef]
- Yan, Y.; Wang, Z. Genetic transformation of the medicinal plant Salvia miltiorrhiza by Agrobacterium tumefaciens-mediated method. Plant Cell Tissue Organ Cult. 2007, 88, 175–184. [Google Scholar] [CrossRef]
- Staheli, J.R.; Boyce, R.; Kovarik, D.; Rose, T.M. CODEHOP PCR and CODEHOP pcr primer design. Meth. Mol. Biol. 2011, 687, 57–73. [Google Scholar] [CrossRef]
- Yang, Y.F.; Hou, S.; Cui, G.H.; Chen, S.L.; Wei, J.H.; Huang, L.Q. Characterization of reference genes for quantitative real-time pcr analysis in various tissues of Salvia miltiorrhiza. Mol. Biol. Rep. 2010, 37, 507–513. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(T)(-delta delta c) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Nelson, B.K.; Cai, X.; Nebenfuehr, A. A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J. 2007, 51, 1126–1136. [Google Scholar] [CrossRef]
- Ru, M.; Wang, K.; Bai, Z.; Peng, L.; He, S.; Pei, T.; Jia, Y.; Li, H.; Liang, Z. Molecular cloning and characterisation of two enzymes involved in the rosmarinic acid biosynthesis pathway of Prunella vulgaris L. Plant Cell Tissue Organ Cult. 2017, 128, 381–390. [Google Scholar] [CrossRef]
- Mano, H.; Ogasawara, F.; Sato, K.; Higo, H.; Minobe, Y. Isolation of a regulatory gene of anthocyanin biosynthesis in tuberous roots of purple-fleshed sweet potato. Plant Physiol. 2007, 143, 1252–1268. [Google Scholar] [CrossRef]
- Xing, B.; Liang, L.; Liu, L.; Hou, Z.; Yang, D.; Yan, K.; Zhang, X.; Liang, Z. Overexpression of SmbHLH148 induced biosynthesis of tanshinones as well as phenolic acids in Salvia miltiorrhiza hairy roots. Plant Cell Rep. 2018, 37, 1681–1692. [Google Scholar] [CrossRef]








© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Liu, J.; Pei, T.; Bai, Z.; Han, R.; Liang, Z. Overexpression of SmANS Enhances Anthocyanin Accumulation and Alters Phenolic Acids Content in Salvia miltiorrhiza and Salvia miltiorrhiza Bge f. alba Plantlets. Int. J. Mol. Sci. 2019, 20, 2225. https://doi.org/10.3390/ijms20092225
Li H, Liu J, Pei T, Bai Z, Han R, Liang Z. Overexpression of SmANS Enhances Anthocyanin Accumulation and Alters Phenolic Acids Content in Salvia miltiorrhiza and Salvia miltiorrhiza Bge f. alba Plantlets. International Journal of Molecular Sciences. 2019; 20(9):2225. https://doi.org/10.3390/ijms20092225
Chicago/Turabian StyleLi, Hongyan, Jingling Liu, Tianlin Pei, Zhenqing Bai, Ruilian Han, and Zongsuo Liang. 2019. "Overexpression of SmANS Enhances Anthocyanin Accumulation and Alters Phenolic Acids Content in Salvia miltiorrhiza and Salvia miltiorrhiza Bge f. alba Plantlets" International Journal of Molecular Sciences 20, no. 9: 2225. https://doi.org/10.3390/ijms20092225
APA StyleLi, H., Liu, J., Pei, T., Bai, Z., Han, R., & Liang, Z. (2019). Overexpression of SmANS Enhances Anthocyanin Accumulation and Alters Phenolic Acids Content in Salvia miltiorrhiza and Salvia miltiorrhiza Bge f. alba Plantlets. International Journal of Molecular Sciences, 20(9), 2225. https://doi.org/10.3390/ijms20092225
