Molecular and Functional Verification of Wharton’s Jelly Mesenchymal Stem Cells (WJ-MSCs) Pluripotency
Abstract
1. Introduction
2. Results
2.1. Characterization of WJ-MSCs
2.2. Pluripotency Marker Expression in Normoxic and Hypoxic Conditions
2.3. In Vivo Safety of WJ-MSCs—Tumorogenicity Assay
3. Discussion
4. Materials and Methods
4.1. Collection, Isolation, and Expansion of WJ-MSCs
4.2. iPS Cell Cultures
4.3. Flow Cytometry Analysis
4.3.1. Immunophenotype Analysis
4.3.2. Lyoplate Screening Panel
4.3.3. Expression of Pluripotent Markers
4.3.4. Intracellular Staining
4.4. Immunocytochemistry
4.5. Real-Time PCR (qPCR), RNA Isolation, Reverse Transcription
4.6. RNA Preparation for Whole-Genome Sequencing
4.7. Gene Expression Quantification
4.8. Tumorogencity Assay (In Vivo)
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| MSCs | Mesenchymal Stem Cells |
| WJ-MSCs | Wharton’s Jelly Mesenchymal Stem Cells |
| iPS | Induced Pluripotent Stem Cells |
| SCs | Stem Cells |
| ESCs | Embryonic Stem Cells |
References
- Melton, D. ‘Stemness’: Definitions, Criteria, and Standards. In Essentials of Stem Cell Biology, 3rd ed.; Elsevier: Amsterdam, The Netherlands, 2013. [Google Scholar] [CrossRef]
- Kim, D.; Kim, C.H.; Moon, J.J.; Chung, Y.G.; Chang, M.Y.; Han, B.S.; Ko, S.; Yang, E.; Cha, K.Y.; Lanza, R.; et al. Generation of Human Induced Pluripotent Stem Cells by Direct Delivery of Reprogramming Proteins. Cell Stem Cell. 2009, 4, 472–476. [Google Scholar] [CrossRef] [PubMed]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.C.; Krause, D.S.; Deans, R.J.; Keating, A.; Prockop, D.J.; Horwitz, E.M.; et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef]
- Secunda, R.; Vennila, R.; Mohanashankar, A.M.; Rajasundari, M.; Jeswanth, S.; Surendran, R. Isolation, expansion and characterisation of mesenchymal stem cells from human bone marrow, adipose tissue, umbilical cord blood and matrix: A comparative study. Cytotechnology 2015, 67, 793–807. [Google Scholar] [CrossRef] [PubMed]
- Wobus, A.M.; Boheler, K.R. Embryonic Stem Cells: Prospects for Developmental Biology and Cell Therapy. Physiol. Rev. 2005, 85, 635–678. [Google Scholar] [CrossRef] [PubMed]
- Sachs, P.C.; Francis, M.P.; Zhao, M.; Brumelle, J.; Rao, R.R.; Elmore, L.W.; Holt, S.E. Defining essential stem cell characteristics in adipose-derived stromal cells extracted from distinct anatomical sites. Cell Tissue Res. 2012, 349, 505–515. [Google Scholar] [CrossRef]
- Takemitsu, H.; Zhao, D.; Yamamoto, I.; Harada, Y.; Michishita, M.; Arai, T. Comparison of bone marrow and adipose tissue-derived canine mesenchymal stem cells. BMC Vet Res. 2012, 8, 150–159. [Google Scholar] [CrossRef]
- Nichols, J.; Zevnik, B.; Anastassiadis, K.; Niwa, H.; Klewe-Nebenius, D.; Chambers, I.; Schöler, H.; Smith, A. Formation of pluripotent stem cells in the mammalian embryo dependes on the POU transcription factor Oct4. Cell 1998, 95, 379–391. [Google Scholar] [CrossRef]
- Mitsui, K.; Tokuzawa, Y.; Itoh, H.; Segawa, K.; Murakami, M.; Takahashi, K.; Maruyama, M.; Maeda, M.; Yamanaka, S. The Homeoprotein Nanog Is Required for Maintenance of Pluripotency in Mouse Epiblast and ES Cells avoid such ethical issues is to generate pluripotent cells directly from somatic stem and other cells. The first step toward this goal is to understand molecular mechanisms. Cell 2003, 113, 631–642. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.R.; Zhang, N.K.; Ding, Q.A.; Chen, H.Y.; Hu, X.; Jiang, S.; Li, T.C.; Chen, Y.; Wang, Z.G.; Ye, Y.; et al. Common expression of stemness molecular markers and early cardiac transcription factors in human Wharton’s jelly-derived mesenchymal stem cells and embryonic stem cells. Cell Transpl. 2013, 22, 1883–1900. [Google Scholar] [CrossRef]
- Smyth, D. A Guide to Irish Mythology, 2nd ed.; Irish Academic Press: Dublin, Ireland, 1996. [Google Scholar]
- Chambers, I.; Colby, D.; Robertson, M.; Nichols, J.; Lee, S.; Tweedie, S.; Smith, A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003, 113, 643–655. [Google Scholar] [CrossRef]
- Kumazaki, T.; Kurata, S.; Matsuo, T.; Mitsui, Y.; Takahashi, T. Establishment of human induced pluripotent stem cell lines from normal fibroblast TIG-1. Hum. Cell 2011, 24, 96–103. [Google Scholar] [CrossRef]
- Abumaree, M.H.; Abomaray, F.M.; Alshehri, N.A.; Almutairi, A.; Alaskar, A.S.; Kalionis, B. Phenotypic and Functional Characterization of Mesenchymal Stem/Multipotent Stromal Cells from Decidua Parietalis of Human Term Placenta. Reprod. Sci. 2016, 23, 1193–1207. [Google Scholar] [CrossRef]
- Wegmeyer, H.; Bröske, A.M.; Leddin, M.; Kuentzer, K.; Nisslbeck, A.K.; Hupfeld, J.; Wiechmann, K.; Kuhlen, J.; von Schwerin, C.; Stein, C.; et al. Mesenchymal Stromal Cell Characteristics Vary Depending on Their Origin. Stem Cells Dev. 2013, 22, 2606–2618. [Google Scholar] [CrossRef]
- Majka, M.; Sułkowski, M.; Badyra, B.; Musiałek, P. Concise Review: Mesenchymal Stem Cells in Cardiovascular Regeneration: Emerging Research Directions and Clinical Applications. Stem Cells Transl. Med. 2017, 6, 1859–1867. [Google Scholar] [CrossRef]
- Zhao, G.; Liu, F.; Lan, S.; Li, P.; Wang, L.; Kou, J.; Qi, X.; Fan, R.; Hao, D.; Wu, C.; et al. Large-scale expansion of Wharton’s jelly-derived mesenchymal stem cells on gelatin microbeads, with retention of self-renewal and multipotency characteristics and the capacity for enhancing skin wound healing. Stem Cell Res Ther. 2015, 6, 1–16. [Google Scholar] [CrossRef]
- Bobis, S.; Jarocha, D.; Majka, M. Mesenchymal stem cells: Characteristics and clinical applications. Folia Histochem. Cytobiol. 2006, 44, 215–230. [Google Scholar]
- D Teng, Y.; Yu, D.; E Ropper, A.; Li, J.; Kabatas, S.; R Wakeman, D.; Wang, J.; P Sullivan, M.; Redmond, E., Jr.; Langer, R.; Y Snyder, E. Functional multipotency of stem cells: A conceptual review of neurotrophic factor-based evidence and its role in translational research. Curr. Neuropharmacol. 2011, 9, 574–585. [Google Scholar] [CrossRef][Green Version]
- Teng, Y.D. Functional multipotency of stem cells: Biological traits gleaned from neural progeny studies. Semin. Cell Dev Biol. 2019. [Google Scholar] [CrossRef]
- Zomer, H.D.; Vidane, A.S.; Goncalves, N.N.; Ambrosio, C.E. Mesenchymal and induced pluripotent stem cells: General insights and clinical perspectives. Stem Cells Cloning 2015, 8, 125–134. [Google Scholar] [CrossRef]
- Rachakatla, R.S.; Marini, F.; Weiss, M.L.; Tamura, M.; Troyer, D. Development of human umbilical cord matrix stem cell-based gene therapy for experimental lung tumors. Cancer Gene Ther. 2007, 14, 828–835. [Google Scholar] [CrossRef]
- Bongso, A.; Fong, C.Y.; Gauthaman, K. Taking stem cells to the clinic: Major challenges. J. Cell. Biochem. 2008, 105, 1352–1360. [Google Scholar] [CrossRef]
- Amiri, F.; Halabian, R.; Dehgan Harati, M.; Bahadori, M.; Mehdipour, A.; Mohammadi Roushandeh, A.; Habibi Roudkenar, M. Positive selection of Wharton’s jelly-derived CD105(+) cells by MACS technique and their subsequent cultivation under suspension culture condition: A simple, versatile culturing method to enhance the multipotentiality of mesenchymal stem cells. Hematology 2015, 20, 208–216. [Google Scholar] [CrossRef]
- Kim, D.W.; Staples, M.; Shinozuka, K.; Pantcheva, P.; Kang, S.D.; Borlongan, C.V. Wharton’s Jelly-Derived Mesenchymal Stem Cells: Phenotypic Characterization and Optimizing Their Therapeutic Potential for Clinical Applications. Int. J. Mol. Sci. 2013, 14, 11692–11712. [Google Scholar] [CrossRef]
- Takahashi, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef]
- Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors. Cell 2007, 131, 861–872. [Google Scholar] [CrossRef]
- Parsons, X.H.; Teng, Y.D.; Parsons, J.F.; Snyder, E.Y.; Smotrich, D.B.; Moore, D.A. Efficient derivation of human cardiac precursors and cardiomiocytes from pluripotent human embryonic stem cells with small molecule induction. J. Vis. Exp. 2011, 57, 3274–3279. [Google Scholar] [CrossRef]
- Teixeira, F.G.; Panchalingam, K.M.; Anjo, S.I.; Manadas, B.; Pereira, R.; Sousa, N.; Salgado, A.J.; Behie, L.A. Do hypoxia/normoxia culturing conditions change the neuroregulatory profile of Wharton Jelly mesenchymal stem cell secretome? Stem Cell Res Ther. 2015, 6, 1–14. [Google Scholar] [CrossRef]
- Ejtehadifar, M.; Shamsasenjan, K.; Movassaghpour, A.; Akbarzadehlaleh, P.; Dehdilani, N.; Abbasi, P.; Molaeipour, Z.; Saleh, M. The effect of hypoxia on mesenchymal stem cell biology. Adv. Pharm. Bull. 2015, 5, 141–149. [Google Scholar] [CrossRef]
- Drela, K.; Sarnowska, A.; Siedlecka, P.; Szablowska-Gadomska, I.; Wielgos, M.; Jurga, M.; Lukomska, B.; Domanska-Janik, K. Low oxygen atmosphere facilitates proliferation and maintains undifferentiated state of umbilical cord mesenchymal stem cells in an hypoxia inducible factor-dependent manner. Cytotherapy 2014, 16, 881–892. [Google Scholar] [CrossRef]
- Wu, D.; Yotnda, P. Induction and testing an hypoxia in cell culture. J. Vis. Exp. 2011, 54, 2899–2995. [Google Scholar] [CrossRef]
- Dos Santos, F.; Andrade, P.Z.; Boura, J.S.; Abecasis, M.M.; da Silva, C.L.; Cabral, J.M. Ex vivo expansion of human mesenchymal stem cells: A more effective cell proliferation kinetics and metabolism under hypoxia. J. Cell. Physiol. 2010, 223, 27–35. [Google Scholar] [CrossRef]
- Bakmiwewa, S.M.; Heng, B.; Guillemin, G.J.; Ball, H.J.; Hunt, N.A. An effective, low-cost method for achieving and maintaining hypoxia during cell culture studies. Biotechniques 2015, 59, 223–229. [Google Scholar] [CrossRef]
- Fisher, S.A.; Doree, C.; Mathur, A.; Taggart, D.P.; Martin-Rendon, E. Stem cell therapy for chronic ischaemic heart disease and congestive heart failure. Cochrane Database Syst. Rev. 2016, 29, 265–278. [Google Scholar] [CrossRef]
- Cui, Y.; Ma, S.; Zhang, C.; Cao, W.; Liu, M.; Li, D.; Lv, P.; Xing, Q.; Qu, R.; Yao, N.; et al. Human umbilical cord mesenchymal stem cells transplantation improves cognitive function in Alzheimer’s disease mice by decreasing oxidative stress and promoting hippocampal neurogenesis. Behav. Brain Res. 2017, 320, 291–301. [Google Scholar] [CrossRef]
- Prasad, V.K.; Lucas, K.G.; Kleiner, G.I.; Talano, J.A.; Jacobsohn, D.; Broadwater, G.; Monroy, R.; Kurtzberg, J. Efficacy and safety of ex vivo cultured adult human mesenchymal stem cells (Prochymal) in pediatric patients with severe refractory acute graft-versus-host disease in a compassionate use study. Biol. Blood Marrow Transpl. 2011, 17, 534–541. [Google Scholar] [CrossRef]
- Fong, C.Y.; Chak, L.L.; Biswas, A.; Tan, J.H.; Gauthaman, K.; Chan, W.K.; Bongso, A. Human Wharton’s Jelly Stem Cells Have Unique Transcriptome Profiles Compared to Human Embryonic Stem Cells and Other Mesenchymal. Stem Cells Stem Cell Rev. Rep. 2011, 7, 1–16. [Google Scholar] [CrossRef]
- Nekanti, U.; Dastidar, S.; Venugopal, P.; Totey, S.; Ta, M. Increased proliferation and analysis of differential gene expression in human Wharton’s jelly-derived mesenchymal stromal cells under hypoxia. Int. J. Biol. Sci. 2010, 6, 499–512. [Google Scholar] [CrossRef]
- Doi, D.; Morizane, A.; Kikuchi, T.; Onoe, H.; Hayashi, T.; Kawasaki, T. Prolonged maturation culture favors a reduction in the tumorigenicity and the dopaminergic function of human ESC-derived neural cells in a primate model of Parkinson’s disease. Stem Cells 2012, 30, 935–945. [Google Scholar] [CrossRef]
- Kwon, A.; Kim, Y.; Kim, M.; Kim, J.; Choi, H.; Jekarl, D.W.; Lee, S.; Kim, J.M.; Shin, J.C.; Park, I.Y. Tissue-specific Differentiation Potency of Mesenchymal Stromal Cells from Perinatal Tissues. Nat. Publ. Gr. 2016, 6, 1–11. [Google Scholar] [CrossRef]
- Toma, C.; Pittenger, M.F.; Cahill, K.S.; Byrne, B.J.; Kessler, P.D. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 2002, 105, 93–98. [Google Scholar] [CrossRef]
- Gyöngyösi, M.; Blanco, J.; Marian, T.; Trón, L.; Petneházy, Ö.; Petrasi, Z.; Hemetsberger, R.; Rodriguez, J.; Font, G.; Pavo, I.J.; et al. Serial noninvasive in vivo positron emission tomographic tracking of percutaneously intramyocardially injected autologous porcine mesenchymal stem cells modified for transgene reporter gene expression. Circ. Cardiovasc. Imaging 2008, 1, 94–103. [Google Scholar] [CrossRef]
- McGinley, L.M.; McMahon, J.; Stocca, A.; Duffy, A.; Flynn, A.; O’Toole, D.; O’Brien, T. Mesenchymal stem cell survival in the infarcted heart is enhanced by lentivirus vector-mediated heat shock protein 27 expression. Hum. Gene Ther. 2013, 24, 840–851. [Google Scholar] [CrossRef]
- Bieback, K.; Brinkmann, I. Mesenchymal stromal cells from human perinatal tissues: From biology to cell therapy. World J. Stem Cells 2010, 2, 81–92. [Google Scholar] [CrossRef]
- Moldovan, N.I.; Goldschmidt-Clermont, P.J.; Parker-Thornburg, J.; Shapiro, S.D.; Kolattukudy, P.E. Contribution of Monocytes / Macrophages to The Drilling of Metalloelastase-Positive Tunnels in Ischemic Myocardium. Circ. Res. 2000, 4, 378–385. [Google Scholar] [CrossRef]
- Wang, H.S.; Hung, S.C.; Peng, S.T.; Huang, C.C.; Wei, H.M.; Guo, Y.J.; Fu, Y.S.; Lai, M.C.; Chen, C.C. Mesenchymal stem cells in the Wharton’s jelly of the human umbilical cord. Stem Cells 2004, 22, 1330–1337. [Google Scholar] [CrossRef]
- Tong, C.K.; Vellasamy, S.; Chong Tan, B.; Abdullah, M.; Vidyadaran, S.; Seow, H.F.; Ramasamy, R. Generation of mesenchymal stem cell from human umbilical cord tissue using a combination enzymatic and mechanical disassociation method. Cell Biol. Int. 2011, 35, 221–226. [Google Scholar] [CrossRef]
- Dehkordi, M.B.; Madjd, Z.; Chaleshtori, M.H.; Meshkani, R.; Nikfarjam, L.; Kajbafzadeh, A.M. A simple, rapid, and efficient method for isolating mesenchymal stem cells from the entire umbilical cord. Cell Transpl. 2016, 25, 1287–1297. [Google Scholar] [CrossRef]
- Du, Y.; Roh, D.S.; Funderburgh, M.L.; Mann, M.M.; Marra, K.G.; Rubin, J.P.; Li, X.; Funderburgh, J.L. Adipose-derived stem cells differentiate to keratocytes in vitro. Mol. Vis. 2010, 16, 2680–2689. [Google Scholar]
- Krampera, M.; Marconi, S.; Pasini, A.; Galiè, M.; Rigotti, G.; Mosna, F.; Tinelli, M.; Lovato, L.; Anghileri, E.; Andreini, A.; et al. Induction of neural-like differentiation in human mesenchymal stem cells derived from bone marrow, fat, spleen and thymus. Bone 2007, 40, 382–390. [Google Scholar] [CrossRef]
- Strioga, M.; Viswanathan, S.; Darinskas, A.; Slaby, O.; Michalek, J. Same or Not the Same? Comparison of Adipose Tissue-Derived Versus Bone Marrow-Derived Mesenchymal Stem and Stromal Cells. Stem Cells Dev. 2012, 21, 2724–2752. [Google Scholar] [CrossRef]
- Spaeth, E.; Klopp, A.; Dembinski, J.; Andreeff, M.; Marini, F. Inflammation and tumor microenvironments: Defining the migratory itinerary of mesenchymal stem cells. Gene Ther. 2008, 15, 730–738. [Google Scholar] [CrossRef]
- Yi, T.; Song, S.U. Immunomodulatory properties of mesenchymal stem cells and their therapeutic applications. Arch. Pharm. Res. 2012, 35, 213–221. [Google Scholar] [CrossRef]




| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| OCT-4 | ATGGCGGGACACCTGGCTT | GGGAGAGCCCAGAGTGGTGACG |
| NANOG | TGAACCTCAGCTACAAACAG | TGGTGGTAGGAAGAGTAAAG |
| GAPDH | CAAAGTTGTCATGGATGACC | CCATGGAGAAGGCTGGGG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Musiał-Wysocka, A.; Kot, M.; Sułkowski, M.; Badyra, B.; Majka, M. Molecular and Functional Verification of Wharton’s Jelly Mesenchymal Stem Cells (WJ-MSCs) Pluripotency. Int. J. Mol. Sci. 2019, 20, 1807. https://doi.org/10.3390/ijms20081807
Musiał-Wysocka A, Kot M, Sułkowski M, Badyra B, Majka M. Molecular and Functional Verification of Wharton’s Jelly Mesenchymal Stem Cells (WJ-MSCs) Pluripotency. International Journal of Molecular Sciences. 2019; 20(8):1807. https://doi.org/10.3390/ijms20081807
Chicago/Turabian StyleMusiał-Wysocka, Aleksandra, Marta Kot, Maciej Sułkowski, Bogna Badyra, and Marcin Majka. 2019. "Molecular and Functional Verification of Wharton’s Jelly Mesenchymal Stem Cells (WJ-MSCs) Pluripotency" International Journal of Molecular Sciences 20, no. 8: 1807. https://doi.org/10.3390/ijms20081807
APA StyleMusiał-Wysocka, A., Kot, M., Sułkowski, M., Badyra, B., & Majka, M. (2019). Molecular and Functional Verification of Wharton’s Jelly Mesenchymal Stem Cells (WJ-MSCs) Pluripotency. International Journal of Molecular Sciences, 20(8), 1807. https://doi.org/10.3390/ijms20081807

