Mettl3 Regulates Osteogenic Differentiation and Alternative Splicing of Vegfa in Bone Marrow Mesenchymal Stem Cells
Abstract
1. Introduction
2. Results
2.1. Selection and Identification of BMSCs
2.2. Expression of m6A Methyltransferase and Demethylases in BMSCs Undergoing Osteogenic Differentiation
2.3. Effect of Mettl3 Knockdown on the Osteogenic Differentiation Potential of BMSCs
2.4. Differentially Expressed Genes in Mettl3-Knockdown BMSCs
2.5. Effect of Mettl3 Knockdown on the Expression of Vegfa and Its Splice Variants
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Osteogenic Differentiation
4.2. Mettl3 Knockdown Using shRNA Transfection
4.3. Western Blot Analysis
4.4. Alizarin Red S Staining
4.5. Alkaline Phosphatase Activity Assay
4.6. Quantitative Real-Time PCR (qPCR) and Reverse Transcription PCR (RT-PCR) Monitoring of mRNA Levels
4.7. RNA Sequencing
4.8. Statistical Analyses
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| BMSCs | Bone mesenchymal stem cells |
| m6A | N6-methyl-adenosine |
| METTL3 | methyltransferase-like 3 |
| METTL14 | methyltransferase-like 14 |
| WTAP | Wilms’ tumor 1-associated protein |
| FTO | fat-mass and obesity-associated protein |
| ALKBH5 | α-ketoglutarate-dependent dioxygenase alkB homolog 5 |
| VEGF | vascular endothelial growth factor |
| ESCs | embryonic stem cells |
References
- Amort, T.; Rieder, D.; Wille, A.; Khokhlova-Cubberley, D.; Riml, C.; Trixl, L.; Jia, X.Y.; Micura, R.; Lusser, A. Distinct 5-methylcytosine profiles in poly(A) RNA from mouse embryonic stem cells and brain. Genome Biol. 2017, 18, 1. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zeng, P.; Li, Y.H.; Zhang, Z.; Cui, Q. SRAMP: Prediction of mammalian N6-methyladenosine (m6A) sites based on sequence-derived features. Nucleic Acids Res. 2016, 44, e91. [Google Scholar] [CrossRef] [PubMed]
- Dominissini, D.; Moshitch-Moshkovitz, S.; Schwartz, S.; Salmon-Divon, M.; Ungar, L.; Osenberg, S.; Cesarkas, K.; Jacob-Hirsch, J.; Amariglio, N.; Kupiec, M.; et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 2012, 485, 201–206. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Nie, P.; Peng, D.; He, Z.; Liu, M.; Xie, Y.; Miao, Y.; Zuo, Z.; Ren, J. m6AVar: A database of functional variants involved in m6A modification. Nucleic Acids Res. 2018, 46, D139–D145. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Zhang, J. Most m6A RNA modifications in protein-coding regions are evolutionarily unconserved and likely nonfunctional. Mol. Biol. Evol. 2017, 35, 666–675. [Google Scholar] [CrossRef] [PubMed]
- Schwartz, S.; Mumbach, M.R.; Jovanovic, M.; Wang, T.; Maciag, K.; Bushkin, G.G.; Mertins, P.; Ter-Ovanesyan, D.; Habib, N.; Cacchiarelli, D.; et al. Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5′ sites. Cell Rep. 2014, 8, 284–296. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Doxtader, K.A.; Nam, Y. Structural Basis for Cooperative Function of Mettl3 and Mettl14 Methyltransferases. Mol. Cell 2016, 63, 306–317. [Google Scholar] [CrossRef]
- Punekar, A.S.; Liljeruhm, J.; Shepherd, T.R.; Forster, A.C.; Selmer, M. Structural and functional insights into the molecular mechanism of rRNA m6A methyltransferase RlmJ. Nucleic Acids Res. 2013, 41, 9537–9548. [Google Scholar] [CrossRef]
- Zhang, C.; Samanta, D.; Lu, H.; Bullen, J.W.; Zhang, H.; Chen, I.; He, X.; Semenza, G.L. Hypoxia induces the breast cancer stem cell phenotype by HIF-dependent and ALKBH5-mediated m(6)A-demethylation of NANOG mRNA. Proc. Natl. Acad. Sci. USA. 2016, 113, E2047–E2056. [Google Scholar] [CrossRef]
- Jia, G.; Fu, Y.; He, C. Reversible RNA adenosine methylation in biological regulation. Trends Genet. 2013, 29, 108–115. [Google Scholar] [CrossRef]
- Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014, 505, 117–120. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Dai, Q.; Zheng, G.; He, C.; Parisien, M.; Pan, T. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature 2015, 518, 560–564. [Google Scholar] [CrossRef] [PubMed]
- Maity, A.; Das, B. N6-methyladenosine modification in mRNA: Machinery, function and implications for health and diseases. FEBS J. 2016, 283, 1607–1630. [Google Scholar] [CrossRef] [PubMed]
- Cui, Q.; Shi, H.; Ye, P.; Li, L.; Qu, Q.; Sun, G.; Sun, G.; Lu, Z.; Huang, Y.; Yang, C.G.; et al. m(6)A RNA methylation regulates the self-renewal and tumorigenesis of glioblastoma stem cells. Cell Rep. 2017, 18, 2622–2634. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.S.; Roundtree, I.A.; He, C. Post-transcriptional gene regulation by mRNA modifications. Nat. Rev. Mol. Cell Biol. 2017, 18, 31–42. [Google Scholar] [CrossRef] [PubMed]
- Macrin, D.; Joseph, J.P.; Pillai, A.A.; Devi, A. Eminent sources of adult mesenchymal stem cells and their therapeutic imminence. Stem Cell Rev. 2017, 13, 741–756. [Google Scholar] [CrossRef] [PubMed]
- Kadekar, D.; Kale, V.; Limaye, L. Differential ability of MSCs isolated from placenta and cord as feeders for supporting ex vivo expansion of umbilical cord blood derived CD34(+) cells. Stem Cell Res. Ther. 2015, 6, 201. [Google Scholar] [CrossRef]
- Xu, Y.; Li, Z.; Li, X.; Fan, Z.; Liu, Z.; Xie, X.; Guan, J. Regulating myogenic differentiation of mesenchymal stem cells using thermosensitive hydrogels. Acta Biomater. 2015, 26, 23–33. [Google Scholar] [CrossRef]
- Li, Q.; Gao, Z.; Chen, Y.; Guan, M.X. The role of mitochondria in osteogenic, adipogenic and chondrogenic differentiation of mesenchymal stem cells. Protein Cell 2017, 8, 439–445. [Google Scholar] [CrossRef]
- Van Zoelen, E.J.; Duarte, I.; Hendriks, J.M.; van der Woning, S.P. TGFbeta-induced switch from adipogenic to osteogenic differentiation of human mesenchymal stem cells: Identification of drug targets for prevention of fat cell differentiation. Stem Cell Res. Ther. 2016, 7, 123. [Google Scholar] [CrossRef]
- Dzobo, K.; Vogelsang, M.; Thomford, N.E.; Dandara, C.; Kallmeyer, K.; Pepper, M.S.; Parker, M.I. Wharton’s Jelly-derived mesenchymal stromal cells and fibroblast-derived extracellular matrix synergistically activate apoptosis in a p21-dependent mechanism in WHCO1 and MDA MB 231 cancer cells in vitro. Stem Cells Int. 2016, 2016, 4842134. [Google Scholar] [CrossRef] [PubMed]
- Dzobo, K.; Turnley, T.; Wishart, A.; Rowe, A.; Kallmeyer, K.; van Vollenstee, F.A.; Thomford, N.E.; Dandara, C.; Chopera, D.; Pepper, M.S.; et al. Fibroblast-derived extracellular matrix induces chondrogenic differentiation in human adipose-derived mesenchymal stromal/stem cells in Vitro. Int. J. Mol. Sci. 2016, 17, 1259. [Google Scholar] [CrossRef] [PubMed]
- Tu, C.; Xiao, Y.; Ma, Y.; Wu, H.; Song, M. The legacy effects of electromagnetic fields on bone marrow mesenchymal stem cell self-renewal and multiple differentiation potential. Stem Cell Res. Ther. 2018, 9, 215. [Google Scholar] [CrossRef] [PubMed]
- Waldner, M.; Zhang, W.; James, I.B.; Allbright, K.; Havis, E.; Bliley, J.M.; Almadori, A.; Schweizer, R.; Plock, J.A.; Washington, K.M.; et al. Characteristics and immunomodulating functions of adipose-derived and bone marrow-derived mesenchymal stem cells across defined human leukocyte antigen barriers. Front. Immunol. 2018, 9, 1642. [Google Scholar] [CrossRef] [PubMed]
- Dzobo, K.; Thomford, N.E.; Senthebane, D.A.; Shipanga, H.; Rowe, A.; Dandara, C.; Pillay, M.; Motaung, K. Advances in Regenerative Medicine and Tissue Engineering: Innovation and Transformation of Medicine. Stem Cells Int. 2018, 2018, 2495848. [Google Scholar] [CrossRef] [PubMed]
- Liao, L.; Shi, B.; Chang, H.; Su, X.; Zhang, L.; Bi, C.; Shuai, Y.; Du, X.; Deng, Z.; Jin, Y. Heparin improves BMSC cell therapy: Anticoagulant treatment by heparin improves the safety and therapeutic effect of bone marrow-derived mesenchymal stem cell cytotherapy. Theranostics 2017, 7, 106–116. [Google Scholar] [CrossRef] [PubMed]
- Forostyak, S.; Jendelova, P.; Sykova, E. The role of mesenchymal stromal cells in spinal cord injury, regenerative medicine and possible clinical applications. Biochimie 2013, 95, 2257–2270. [Google Scholar] [CrossRef]
- Vaquero, J.; Zurita, M. Functional recovery after severe CNS trauma: Current perspectives for cell therapy with bone marrow stromal cells. Prog. Neurobiol. 2011, 93, 341–349. [Google Scholar] [CrossRef] [PubMed]
- Tsai, T.L.; Li, W.J. Identification of bone marrow-derived soluble factors regulating human mesenchymal stem cells for bone regeneration. Stem Cell Rep. 2017, 8, 387–400. [Google Scholar] [CrossRef] [PubMed]
- Shu, Y.; Yu, Y.; Zhang, S.; Wang, J.; Xiao, Y.; Liu, C. The immunomodulatory role of sulfated chitosan in BMP-2-mediated bone regeneration. Biomater. Sci. 2018, 6, 2496–2507. [Google Scholar] [CrossRef]
- Hu, K.; Olsen, B.R. The roles of vascular endothelial growth factor in bone repair and regeneration. Bone 2016, 91, 30–38. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Bao, C.; Xu, H.; Pan, J.; Hu, J.; Wang, P.; Luo, E. Osteoprotegerin gene-modified BMSCs with hydroxyapatite scaffold for treating critical-sized mandibular defects in ovariectomized osteoporotic rats. Acta Biomater. 2016, 42, 378–388. [Google Scholar] [CrossRef] [PubMed]
- Hankenson, K.D.; Gagne, K.; Shaughnessy, M. Extracellular signaling molecules to promote fracture healing and bone regeneration. Adv. Drug Deliv. Rev. 2015, 94, 3–12. [Google Scholar] [CrossRef] [PubMed]
- Stegen, S.; van Gastel, N.; Carmeliet, G. Bringing new life to damaged bone: The importance of angiogenesis in bone repair and regeneration. Bone 2015, 70, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Montespan, F.; Deschaseaux, F.; Sensebe, L.; Carosella, E.D.; Rouas-Freiss, N. Osteodifferentiated mesenchymal stem cells from bone marrow and adipose tissue express HLA-G and display immunomodulatory properties in HLA-mismatched settings: Implications in bone repair therapy. J. Immunol. Res. 2014, 2014, 230346. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Tang, Y.; Zhu, X.; Tu, T.; Sui, L.; Han, Q.; Yu, L.; Meng, S.; Zheng, L.; Valverde, P.; et al. Overexpression of MiR-335-5p Promotes Bone Formation and Regeneration in Mice. J. Bone Miner. Res. 2017, 32, 2466–2475. [Google Scholar] [CrossRef] [PubMed]
- Cipitria, A.; Boettcher, K.; Schoenhals, S.; Garske, D.S.; Schmidt-Bleek, K.; Ellinghaus, A.; Dienelt, A.; Peters, A.; Mehta, M.; Madl, C.M.; et al. In-situ tissue regeneration through SDF-1alpha driven cell recruitment and stiffness-mediated bone regeneration in a critical-sized segmental femoral defect. Acta Biomater. 2017, 60, 50–63. [Google Scholar] [CrossRef] [PubMed]
- Yan, P.; Xia, C.; Duan, C.; Li, S.; Mei, Z. Biological characteristics of foam cell formation in smooth muscle cells derived from bone marrow stem cells. Int. J. Biol. Sci. 2011, 7, 937–946. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Li, Y.; Wang, M.; Zhu, Y.; Zhou, Y.; Sui, B.; Tan, Y.; Ning, Y.; Wang, J.; He, J.; et al. Functional reconstruction of critical-sized load-bearing bone defects using a Sclerostin-targeting miR-210-3p-based construct to enhance osteogenic activity. Acta Biomater. 2018, 76, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Kang, M.L.; Kim, J.E.; Im, G.I. Vascular endothelial growth factor-transfected adipose-derived stromal cells enhance bone regeneration and neovascularization from bone marrow stromal cells. J. Tissue Eng. Regen. Med. 2017, 11, 3337–3348. [Google Scholar] [CrossRef]
- Qiu, G.; Shi, Z.; Xu, H.; Yang, B.; Weir, M.D.; Li, G.; Song, Y.; Wang, J.; Hu, K.; Wang, P.; et al. Bone regeneration in minipigs via calcium phosphate cement scaffold delivering autologous bone marrow mesenchymal stem cells and platelet-rich plasma. J. Tissue Eng. Regen. Med. 2018, 12, e937–e948. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Wang, Q.; Kang, N.; Wu, J.; Gu, C.; Bi, J.; Lv, T.; Xie, F.; Hu, J.; Liu, X.; et al. The effects of different vascular carrier patterns on the angiogenesis and osteogenesis of BMSC-TCP-based tissue-engineered bone in beagle dogs. J. Tissue Eng. Regen. Med. 2017, 11, 542–552. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Xu, B.; Xu, H.G. Up-regulation of TGF-beta promotes tendon-to-bone healing after anterior cruciate ligament reconstruction using bone marrow-derived mesenchymal stem cells through the TGF-beta/MAPK signaling pathway in a new zealand white rabbit model. Cell. Physiol. Biochem. 2017, 41, 213–226. [Google Scholar] [CrossRef] [PubMed]
- Kuttapitiya, A.; Assi, L.; Laing, K.; Hing, C.; Mitchell, P.; Whitley, G.; Harrison, A.; Howe, F.A.; Ejindu, V.; Heron, C.; et al. Microarray analysis of bone marrow lesions in osteoarthritis demonstrates upregulation of genes implicated in osteochondral turnover, neurogenesis and inflammation. Ann. Rheum. Dis. 2017, 76, 1764–1773. [Google Scholar] [CrossRef] [PubMed]
- Chimutengwende-Gordon, M.; Mbogo, A.; Khan, W.; Wilkes, R. Limb reconstruction after traumatic bone loss. Injury 2017, 48, 206–213. [Google Scholar] [CrossRef]
- Emori, M.; Kaya, M.; Irifune, H.; Takahashi, N.; Shimizu, J.; Mizushima, E.; Murahashi, Y.; Yamashita, T. Vascularised fibular grafts for reconstruction of extremity bone defects after resection of bone and soft-tissue tumours: A single institutional study of 49 patients. Bone Joint J. 2017, 99, 1237–1243. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.L.; Sun, Y.; Ho, C.K.; Liu, K.; Tang, Q.Q.; Xie, Y.; Li, Q. IL-6 potentiates BMP-2-induced osteogenesis and adipogenesis via two different BMPR1A-mediated pathways. Cell Death Dis. 2018, 9, 144. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.B.; Zhong, W.J.; Wang, L. A signal-amplification circuit between miR-218 and Wnt/beta-catenin signal promotes human adipose tissue-derived stem cells osteogenic differentiation. Bone 2014, 58, 59–66. [Google Scholar] [CrossRef]
- Meng, J.; Ma, X.; Wang, N.; Jia, M.; Bi, L.; Wang, Y.; Li, M.; Zhang, H.; Xue, X.; Hou, Z.; et al. Activation of GLP-1 receptor promotes bone marrow stromal cell osteogenic differentiation through beta-Catenin. Stem Cell Rep. 2016, 6, 579–591. [Google Scholar] [CrossRef] [PubMed]
- Jiao, X.; Cai, J.; Yu, X.; Ding, X. Paracrine activation of the Wnt/beta-catenin pathway by bone marrow stem cell attenuates cisplatin-induced kidney injury. Cell. Physiol. Biochem. 2017, 44, 1980–1994. [Google Scholar] [CrossRef] [PubMed]
- Wen, Q.; Zhang, S.; Du, X.; Wang, R.; Li, Y.; Liu, H.; Hu, S.; Zhou, C.; Zhou, X.; Ma, L. The multiplicity of infection-dependent effects of recombinant adenovirus carrying HGF gene on the proliferation and osteogenic differentiation of human bone marrow mesenchymal stem cells. Int. J. Mol. Sci. 2018, 19, 734. [Google Scholar]
- Ramasamy, S.K.; Kusumbe, A.P.; Wang, L.; Adams, R.H. Endothelial Notch activity promotes angiogenesis and osteogenesis in bone. Nature 2014, 507, 376–380. [Google Scholar] [CrossRef]
- Mao, L.; Xia, L.; Chang, J.; Liu, J.; Jiang, L.; Wu, C.; Fang, B. The synergistic effects of Sr and Si bioactive ions on osteogenesis, osteoclastogenesis and angiogenesis for osteoporotic bone regeneration. Acta Biomater. 2017, 61, 217–232. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Ness, V.P.; Yang, X.; Chen, H.; Luo, J.; Brown, E.B.; Zhang, X. Spatiotemporal analyses of osteogenesis and angiogenesis via intravital imaging in cranial bone defect repair. J. Bone Miner. Res. 2015, 30, 1217–1230. [Google Scholar] [CrossRef]
- Busilacchi, A.; Gigante, A.; Mattioli-Belmonte, M.; Manzotti, S.; Muzzarelli, R.A. Chitosan stabilizes platelet growth factors and modulates stem cell differentiation toward tissue regeneration. Carbohydr. Polym. 2013, 98, 665–676. [Google Scholar] [CrossRef] [PubMed]
- Hu, K.; Olsen, B.R. Osteoblast-derived VEGF regulates osteoblast differentiation and bone formation during bone repair. J. Clin. Investig. 2016, 126, 509–526. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Wang, H.; Qiu, G.; Su, X.; Wu, Z. Synergistic Effects of vascular endothelial growth factor on bone morphogenetic proteins induced bone formation in Vivo: Influencing factors and future research directions. Biomed Res. Int. 2016, 2016, 2869572. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.S.; Yang, S.S.; You, H.K.; Shin, H.I.; Lee, J. Fucoidan-induced osteogenic differentiation promotes angiogenesis by inducing vascular endothelial growth factor secretion and accelerates bone repair. J. Tissue Eng. Regen. Med. 2018, 12, e1311–e1324. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ma, C.; Liu, X.; Wu, Z.; Yan, P.; Ma, N.; Fan, Q.; Zhao, Q. Epigenetic landscape in PPARgamma2 in the enhancement of adipogenesis of mouse osteoporotic bone marrow stromal cell. Biochim. Biophys. Acta 2015, 1852, 2504–2516. [Google Scholar] [CrossRef] [PubMed]
- Lv, L.; Liu, Y.; Zhang, P.; Bai, X.; Ma, X.; Wang, Y.; Li, H.; Wang, L.; Zhou, Y. The epigenetic mechanisms of nanotopography-guided osteogenic differentiation of mesenchymal stem cells via high-throughput transcriptome sequencing. Int. J. Nanomed. 2018, 13, 5605–5623. [Google Scholar] [CrossRef] [PubMed]
- Sepulveda, H.; Aguilar, R.; Prieto, C.P.; Bustos, F.; Aedo, S.; Lattus, J.; van Zundert, B.; Palma, V.; Montecino, M. Epigenetic signatures at the RUNX2-P1 and Sp7 gene promoters control osteogenic lineage commitment of umbilical cord-derived mesenchymal stem cells. J. Cell. Physiol. 2017, 232, 2519–2527. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Yang, H.; Jin, L.; Du, J.; Fan, Z. Genome-Wide DNA Methylation analysis during osteogenic differentiation of human bone marrow mesenchymal stem cells. Stem Cells Int. 2018, 2018, 8238496. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Xia, M.; Yang, J.; Shao, J.; Liao, X.; Zhu, J.; Jiang, H. Novel insights into a treatment for aplastic anemia based on the advanced proliferation of bone marrowderived mesenchymal stem cells induced by fibroblast growth factor 1. Mol. Med. Rep. 2015, 12, 7877–7882. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Qiao, J.; Wang, G.; Lan, Y.; Li, G.; Guo, X.; Xi, J.; Ye, D.; Zhu, S.; Chen, W.; et al. N6-Methyladenosine modification of lincRNA 1281 is critically required for mESC differentiation potential. Nucleic Acids Res. 2018, 46, 3906–3920. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, Y.; Yue, M.; Wang, J.; Kumar, S.; Wechsler-Reya, R.J.; Zhang, Z.; Ogawa, Y.; Kellis, M.; Duester, G.; et al. N(6)-methyladenosine RNA modification regulates embryonic neural stem cell self-renewal through histone modifications. Nat. Neurosci. 2018, 21, 195–206. [Google Scholar] [CrossRef] [PubMed]
- Visvanathan, A.; Patil, V.; Arora, A.; Hegde, A.S.; Arivazhagan, A.; Santosh, V.; Somasundaram, K. Essential role of METTL3-mediated m(6)A modification in glioma stem-like cells maintenance and radioresistance. Oncogene 2018, 37, 522–533. [Google Scholar] [CrossRef]
- Baralle, F.E.; Giudice, J. Alternative splicing as a regulator of development and tissue identity. Nat. Rev. Mol. Cell Biol. 2017, 18, 437–451. [Google Scholar] [CrossRef]
- Naftelberg, S.; Schor, I.E.; Ast, G.; Kornblihtt, A.R. Regulation of alternative splicing through coupling with transcription and chromatin structure. Annu. Rev. Biochem. 2015, 84, 165–198. [Google Scholar] [CrossRef]
- Feng, Z.; Li, Q.; Meng, R.; Yi, B.; Xu, Q. METTL3 regulates alternative splicing of MyD88 upon the lipopolysaccharide-induced inflammatory response in human dental pulp cells. J. Cell. Mol. Med. 2018, 22, 2558–2568. [Google Scholar] [CrossRef]
- Xu, K.; Yang, Y.; Feng, G.H.; Sun, B.F.; Chen, J.Q.; Li, Y.F.; Chen, Y.S.; Zhang, X.X.; Wang, C.X.; Jiang, L.Y.; et al. Mettl3-mediated m(6)A regulates spermatogonial differentiation and meiosis initiation. Cell Res. 2017, 27, 1100–1114. [Google Scholar] [CrossRef]
- Haussmann, I.U.; Bodi, Z.; Sanchez-Moran, E.; Mongan, N.P.; Archer, N.; Fray, R.G.; Soller, M. m(6)A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. Nature 2016, 540, 301–304. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Shabbir, A.; Molnar, M.; Yang, J.; Marion, S.; Canty, J.J.; Lee, T. Adenoviral expression of vascular endothelial growth factor splice variants differentially regulate bone marrow-derived mesenchymal stem cells. J. Cell. Physiol. 2008, 216, 458–468. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Nauth, A.; Li, C.; Qamirani, E.; Atesok, K.; Schemitsch, E.H. Expression of VEGF gene isoforms in a rat segmental bone defect model treated with EPCs. J. Orthop. Trauma. 2012, 26, 689–692. [Google Scholar] [CrossRef] [PubMed]
- Breier, G.; Albrecht, U.; Sterrer, S.; Risau, W. Expression of vascular endothelial growth factor during embryonic angiogenesis and endothelial cell differentiation. Development 1992, 114, 521–532. [Google Scholar] [PubMed]
- Linder, B.; Grozhik, A.V.; Olarerin-George, A.O.; Meydan, C.; Mason, C.E.; Jaffrey, S.R. Single-nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome. Nat. Methods 2015, 12, 767–772. [Google Scholar] [CrossRef] [PubMed]
- Luo, G.Z.; MacQueen, A.; Zheng, G.; Duan, H.; Dore, L.C.; Lu, Z.; Liu, J.; Chen, K.; Jia, G.; Bergelson, J.; et al. Unique features of the m6A methylome in Arabidopsis thaliana. Nat. Commun. 2014, 5, 5630. [Google Scholar] [CrossRef]
- Martínez-Pérez, M.; Aparicio, F.; López-Gresa, M.P.; Bellés, J.M.; Sánchez-Navarro, J.A.; Pallás, V. Arabidopsis m6A demethylase activity modulates viral infection of a plant virus and the m6A abundance in its genomic RNAs. Proc. Natl. Acad. Sci. USA 2017, 114, 10755–10760. [Google Scholar] [CrossRef]
- Wang, Y.; Li, Y.; Toth, J.I.; Petroski, M.D.; Zhang, Z.; Zhao, J.C. N6-methyladenosine modification destabilizes developmental regulators in embryonic stem cells. Nat. Cell Biol. 2014, 16, 191–198. [Google Scholar] [CrossRef]
- Geula, S.; Moshitch-Moshkovitz, S.; Dominissini, D.; Mansour, A.A.; Kol, N.; Salmon-Divon, M.; Hershkovitz, V.; Peer, E.; Mor, N.; Manor, Y.S.; et al. Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Science 2015, 347, 1002–1006. [Google Scholar] [CrossRef]
- Chen, T.; Hao, Y.J.; Zhang, Y.; Li, M.M.; Wang, M.; Han, W.; Wu, Y.; Lv, Y.; Hao, J.; Wang, L.; et al. m(6)A RNA methylation is regulated by microRNAs and promotes reprogramming to pluripotency. Cell Stem Cell 2015, 16, 289–301. [Google Scholar] [CrossRef]
- Wang, C.X.; Cui, G.S.; Liu, X.; Xu, K.; Wang, M.; Zhang, X.X.; Jiang, L.Y.; Li, A.; Yang, Y.; Lai, W.Y.; et al. METTL3-mediated m6A modification is required for cerebellar development. PLoS Biol. 2018, 16, e2004880. [Google Scholar] [CrossRef] [PubMed]
- Barbieri, I.; Tzelepis, K.; Pandolfini, L.; Shi, J.; Millan-Zambrano, G.; Robson, S.C.; Aspris, D.; Migliori, V.; Bannister, A.J.; Han, N.; et al. Promoter-bound METTL3 maintains myeloid leukaemia by m(6)A-dependent translation control. Nature 2017, 552, 126–131. [Google Scholar] [CrossRef] [PubMed]
- Ping, X.L.; Sun, B.F.; Wang, L.; Xiao, W.; Yang, X.; Wang, W.J.; Adhikari, S.; Shi, Y.; Lv, Y.; Chen, Y.S.; et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res. 2014, 24, 177–189. [Google Scholar] [CrossRef] [PubMed]
- Batista, P.J.; Molinie, B.; Wang, J.; Qu, K.; Zhang, J.; Li, L.; Bouley, D.M.; Lujan, E.; Haddad, B.; Daneshvar, K.; et al. m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell 2014, 15, 707–719. [Google Scholar] [CrossRef]
- Dominissini, D.; Moshitch-Moshkovitz, S.; Salmon-Divon, M.; Amariglio, N.; Rechavi, G. Transcriptome-wide mapping of N(6)-methyladenosine by m(6)A-seq based on immunocapturing and massively parallel sequencing. Nat. Protoc. 2013, 8, 176–189. [Google Scholar] [CrossRef] [PubMed]
- Bodi, Z.; Zhong, S.; Mehra, S.; Song, J.; Graham, N.; Li, H.; May, S.; Fray, R.G. Adenosine methylation in Arabidopsis mRNA is associated with the 3𠄲 end and reduced levels cause developmental defects. Front. Plant Sci. 2012, 3, 48. [Google Scholar] [CrossRef]
- Hongay, C.F.; Orr-Weaver, T.L. Drosophila Inducer of MEiosis 4 (IME4) is required for Notch signaling during oogenesis. Proc. Natl. Acad. Sci. USA 2011, 108, 14855–14860. [Google Scholar] [CrossRef] [PubMed]
- Yue, Y.; Liu, J.; He, C. RNA N6-methyladenosine methylation in post-transcriptional gene expression regulation. Genes Dev. 2015, 29, 1343–1355. [Google Scholar] [CrossRef] [PubMed]
- Tong, Y.; Feng, W.; Wu, Y.; Lv, H.; Jia, Y.; Jiang, D. Mechano-growth factor accelerates the proliferation and osteogenic differentiation of rabbit mesenchymal stem cells through the PI3K/AKT pathway. BMC Biochem. 2015, 16, 1. [Google Scholar] [CrossRef] [PubMed]
- Baker, N.; Sohn, J.; Tuan, R.S. Promotion of human mesenchymal stem cell osteogenesis by PI3-kinase/Akt signaling, and the influence of caveolin-1/cholesterol homeostasis. Stem Cell Res. Ther. 2015, 6, 238. [Google Scholar] [CrossRef]
- Marie, P.J. Signaling pathways affecting skeletal health. Curr. Osteoporos. Rep. 2012, 10, 190–198. [Google Scholar] [CrossRef] [PubMed]
- Garcia, J.R.; Clark, A.Y.; Garcia, A.J. Integrin-specific hydrogels functionalized with VEGF for vascularization and bone regeneration of critical-size bone defects. J. Biomed. Mater. Res. 2016, 104, 889–900. [Google Scholar] [CrossRef] [PubMed]
- Zigdon-Giladi, H.; Bick, T.; Lewinson, D.; Machtei, E.E. Mesenchymal stem cells and endothelial progenitor cells stimulate bone regeneration and mineral density. J. Periodontol. 2014, 85, 984–990. [Google Scholar] [CrossRef] [PubMed]
- Kaner, D.; Zhao, H.; Terheyden, H.; Friedmann, A. Improvement of microcirculation and wound healing in vertical ridge augmentation after pre-treatment with self-inflating soft tissue expanders—A randomized study in dogs. Clin. Oral Implants Res. 2015, 26, 720–724. [Google Scholar] [CrossRef] [PubMed]
- Duda, G.N.; Taylor, W.R.; Winkler, T.; Matziolis, G.; Heller, M.O.; Haas, N.P.; Perka, C.; Schaser, K.D. Biomechanical, microvascular, and cellular factors promote muscle and bone regeneration. Exerc. Sport Sci. Rev. 2008, 36, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Egri, S.; Eczacioglu, N. Sequential VEGF and BMP-2 releasing PLA-PEG-PLA scaffolds for bone tissue engineering: I. Design and in vitro tests. Artif. Cells Nanomed. Biotechnol. 2017, 45, 321–329. [Google Scholar] [CrossRef]
- Pi, C.J.; Liang, K.L.; Ke, Z.Y.; Chen, F.; Cheng, Y.; Yin, L.J.; Deng, Z.L.; He, B.C.; Chen, L. Adenovirus-mediated expression of vascular endothelial growth factor-a potentiates bone morphogenetic protein9-induced osteogenic differentiation and bone formation. Biol. Chem. 2016, 397, 765–775. [Google Scholar] [CrossRef] [PubMed]
- Khojasteh, A.; Fahimipour, F.; Eslaminejad, M.B.; Jafarian, M.; Jahangir, S.; Bastami, F.; Tahriri, M.; Karkhaneh, A.; Tayebi, L. Development of PLGA-coated beta-TCP scaffolds containing VEGF for bone tissue engineering. Mater. Sci. Eng. C Mater. Biol. Appl. 2016, 69, 780–788. [Google Scholar] [CrossRef] [PubMed]
- Carmeliet, P.; Ng, Y.S.; Nuyens, D.; Theilmeier, G.; Brusselmans, K.; Cornelissen, I.; Ehler, E.; Kakkar, V.V.; Stalmans, I.; Mattot, V.; et al. Impaired myocardial angiogenesis and ischemic cardiomyopathy in mice lacking the vascular endothelial growth factor isoforms VEGF164 and VEGF188. Nat. Med. 1999, 5, 495–502. [Google Scholar] [CrossRef] [PubMed]
- Ke, S.; Pandya-Jones, A.; Saito, Y.; Fak, J.J.; Vagbo, C.B.; Geula, S.; Hanna, J.H.; Black, D.L.; Darnell, J.J.; Darnell, R.B. m(6)A mRNA modifications are deposited in nascent pre-mRNA and are not required for splicing but do specify cytoplasmic turnover. Genes Dev. 2017, 31, 990–1006. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Ming, L.; Luo, H.; Liu, W.; Zhang, Y.; Liu, H.; Jin, Y. Integration of a calcined bovine bone and BMSC-sheet 3D scaffold and the promotion of bone regeneration in large defects. Biomaterials 2013, 34, 9998–10006. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Li, C.H.; Nauth, A.; McKee, M.D.; Schemitsch, E.H. Effect of human vascular endothelial growth factor gene transfer on endogenous vascular endothelial growth factor mRNA expression in a rat fibroblast and osteoblast culture model. J. Orthop. Trauma 2010, 24, 547–551. [Google Scholar] [CrossRef] [PubMed]





| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Ocn | 5′ ATCCATGCAGGCATCTCACC 3′ | 5′ ACCTAACCAATTGCCCCCAG 3′ |
| Alp | 5′ TCGATGGCTTTGGTACGGAG 3′ | 5′ TGCGGGACATAAGCGAGTTT 3′ |
| Runx2 | 5′ GGCCAGGTTCAACGATCTGA 3′ | 5′ GGACCGTCCACTGTCACTTTA 3′ |
| Mettl3 | 5′ CTTTAGCATCTGGTCTGGGCT 3′ | 5′ CCTTCTTGCTCTGCTGTTCCT 3′ |
| Alkbh5 | 5′ ACCACCAAACGGAAGTACCAG 3′ | 5′ TCATCCTGGCTGAAGAGACG 3′ |
| Fto | 5′ ACTGGTTTTCCGAGAGGCTG 3′ | 5′ GTGAGCACGTCTTTGCCTTG 3′ |
| Vegfa | 5′ CTGCTCTCTTGGGTGCACTGG 3′ | 5′ CACCGCCTTGGCTTGTCACAT 3′ |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, C.; Huang, Y.; Li, Q.; Feng, Z.; Xu, Q. Mettl3 Regulates Osteogenic Differentiation and Alternative Splicing of Vegfa in Bone Marrow Mesenchymal Stem Cells. Int. J. Mol. Sci. 2019, 20, 551. https://doi.org/10.3390/ijms20030551
Tian C, Huang Y, Li Q, Feng Z, Xu Q. Mettl3 Regulates Osteogenic Differentiation and Alternative Splicing of Vegfa in Bone Marrow Mesenchymal Stem Cells. International Journal of Molecular Sciences. 2019; 20(3):551. https://doi.org/10.3390/ijms20030551
Chicago/Turabian StyleTian, Cheng, Yanlan Huang, Qimeng Li, Zhihui Feng, and Qiong Xu. 2019. "Mettl3 Regulates Osteogenic Differentiation and Alternative Splicing of Vegfa in Bone Marrow Mesenchymal Stem Cells" International Journal of Molecular Sciences 20, no. 3: 551. https://doi.org/10.3390/ijms20030551
APA StyleTian, C., Huang, Y., Li, Q., Feng, Z., & Xu, Q. (2019). Mettl3 Regulates Osteogenic Differentiation and Alternative Splicing of Vegfa in Bone Marrow Mesenchymal Stem Cells. International Journal of Molecular Sciences, 20(3), 551. https://doi.org/10.3390/ijms20030551

