PlWRKY13: A Transcription Factor Involved in Abiotic and Biotic Stress Responses in Paeonia lactiflora
Abstract
:1. Introduction
2. Results and Analysis
2.1. Cloning and Sequence Analysis of PlWRKY13
2.2. Subcellular Localization
2.3. Expression Patterns of PlWRKY13 under Different Stresses
2.4. VIGS Treatment Reduced the Transcription of the Endogenous PlWRKY13 Gene
2.5. PlWRKY13-Silenced Plants Exhibited Increased Sensitivity to A. tenuissima
2.6. PlWRKY13 Silencing Decreased the Endogenous JA and SA Concentrations
2.7. Differential Regulation of PR Genes by PlWRKY13
3. Discussion
4. Materials and Methods
4.1. Plant and Fungal Materials
4.2. Total RNA Extraction and cDNA Synthesis
4.3. Cloning and Sequence Analysis of PlWRKY13
4.4. Subcellular Localization
4.5. Stress Treatments and Infection with A. tenuissima
4.6. VIGS in P. lactiflora
4.7. Quantitative Real-Time PCR (qRT-PCR)
4.8. Determination of Endogenous Hormones
4.9. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Phukan, U.J.; Mishra, S.; Timbre, K.; Luqman, S.; Shukla, R.K. Mentha arvensis exhibit better adaptive characters in contrast to Mentha piperita when subjugated to sustained waterlogging stress. Protoplasma 2014, 251, 603–614. [Google Scholar] [CrossRef] [PubMed]
- RoyChoudhury, A.; Gupta, B.; Sengupta, D.N. Trans-acting factor designated OSBZ8 interacts with both typical abscisic acid responsive elements as well as abscisic acid responsive element-like sequences in the vegetative tissues of indica rice cultivars. Plant Cell Rep. 2008, 27, 779–794. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Wu, J.; Zhang, Y.; Yin, L.; Lu, J. Isolation of a WRKY30 gene from Muscadinia rotundifolia (Michx) and validation of its function under biotic and abiotic stresses. Protoplasma 2015, 252, 1361–1374. [Google Scholar] [CrossRef] [PubMed]
- Ujjal, J.P.; Gajendra, S.J.; Rakesh, K.S. WRKY Transcription Factors: Molecular Regulation and Stress Responses in Plants. Front. Plant Sci. 2016, 7, 760. [Google Scholar] [CrossRef]
- Agarwal, P.; Reddy, M.P.; Chikara, J. WRKY: Its structure, evolutionary relationship, DNA-binding selectivity, role in stress tolerance and development of plants. Mol. Biol. Rep. 2011, 38, 3883–3896. [Google Scholar] [CrossRef]
- Bakshi, M.; Oelmüller, R. WRKY transcription factors: Jack of many trades in plants. Plant Signal. Behav. 2014, 9, 1–18. [Google Scholar] [CrossRef]
- Li, W.; Tian, Z.; Yu, D. WRKY13 acts in stem development in Arabidopsis thaliana. Plant Sci. 2015, 236, 205–213. [Google Scholar] [CrossRef]
- Li, W.; Wang, H.; Yu, D. Arabidopsis WRKY transcription factors WRKY12 and WRKY13 oppositely regulate flowering under short-day conditions. Mol. Plant. 2016, 9, 1492–1503. [Google Scholar] [CrossRef]
- Niu, C.F.; Wei, W.; Zhou, Q.Y.; Tian, A.G.; Hao, Y.J.; Zhang, W.K.; Ma, B.; Lin, Q.; Zhang, Z.B.; Zhang, J.S.; et al. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Env. 2012, 35, 1156–1170. [Google Scholar] [CrossRef]
- Qin, Y.; Tian, Y.; Liu, X. A wheat salinity-induced WRKY transcription factor TaWRKY93 confers multiple abiotic stress tolerance in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2015, 464, 428–433. [Google Scholar] [CrossRef]
- Wang, X.; Zeng, J.; Li, Y.; Rong, X.; Sun, J.; Sun, T.; Li, M.; Wang, L.; Feng, Y.; Chai, R.; et al. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances. Front. Plant Sci. 2015, 6, 615. [Google Scholar] [CrossRef] [PubMed]
- Raineri, J.; Ribichich, K.F.; Chan, R.L. The sunflflower transcription factor HaWRKY76 confers drought and flflood tolerance to Arabidopsis thaliana plants without yield penalty. Plant Cell Rep. 2015, 34, 2065–2080. [Google Scholar] [CrossRef] [PubMed]
- Tao, Z.; Liu, H.; Qiu, D.; Zhou, Y.; Li, X.; Xu, C.; Wang, S. A pair of allelic WRKY genes play opposite roles in rice-bacteria interactions. Plant Physiol. 2009, 151, 936–948. [Google Scholar] [CrossRef] [PubMed]
- Jimmy, J.L.; Babu, S. Gene network mediated by WRKY13 to regulate resistance against sheath infecting fungi in rice (Oryza sativa L.). Plant Sci. 2019, 280, 269–282. [Google Scholar] [CrossRef]
- Yu, F.; Huaxia, Y.; Lu, W.; Wu, C.; Cao, X.; Guo, X. GhWRKY15, a member of the WRKY transcription factor family identified from cotton (Gossypium hirsutum L.), is involved in disease resistance and plant development. BMC Plant Biol. 2012, 12, 144. [Google Scholar] [CrossRef]
- Li, J.; Brader, G.; Palva, E.T. The WRKY70 Transcription Factor: A Node of Convergence for Jasmonate-Mediated and Salicylate-Mediated Signals in Plant Defense. Plant Cell. 2004, 16, 319–331. [Google Scholar] [CrossRef]
- Liu, J.H.; Peng, T.; Dai, W. Critical cis-acting elements and interacting transcription factors: Key players associated with abiotic stress responses in plants. Plant Mol. Biol. Rep. 2014, 32, 303–317. [Google Scholar] [CrossRef]
- Llorca, C.M.; Potschin, M.; Zentgraf, U. bZIPs and WRKYs: Two large transcription factor families executing two different functional strategies. Front. Plant Sci. 2014, 5, 169. [Google Scholar] [CrossRef]
- Rushton, D.L.; Tripathi, P.; Rabara, R.C.; Lin, J.; Ringler, P.; Boken, A.K.; Langum, T.J.; Smidt, L.; Boomsma, D.D.; Emme, N.J.; et al. WRKY transcription factors: Key components inabscisic acid signalling. Plant Biotechnol. J. 2012, 10, 2–11. [Google Scholar] [CrossRef]
- Li, L.; Song, S.X.; Liu, H.X.; Guo, X.F. Identification of red spot pathogens on peony in shandong province. Acta Hortic. Sin. 2016, 43, 365–372. [Google Scholar] [CrossRef]
- Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
- Chittoor, J.M.; Leach, J.E.; White, F.F. Differential induction of a peroxidase gene family during infection of rice by Xanthomonas oryzae pv. oryzae. Mol. Plant Microbe Interact. 1997, 10, 861–871. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.Y.; Tian, A.G.; Zou, H.F.; Xie, Z.M.; Lei, G.; Huang, J.; Wang, C.M.; Wang, H.W.; Zhang, J.S.; Chen, S.Y. Soybean WRKY-type transcription factor genes, GmWRKY13, GmWRKY21 and GmWRKY54, confer differential tolerance to abiotic stresses in transgenic Arabidopsis plants. Plant Biotechnol. J. 2008, 6, 486–503. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Bartley, L.E.; Canlas, P.; Ronald, P.C. OsWRKY IIa transcription factors modulate rice innate immunity. Rice 2010, 3, 36–42. [Google Scholar] [CrossRef]
- Emanuelsson, O.; Heijne, G. Prediction of organellar targeting signals. BBA Mol. Cell Res. 2001, 1541, 114–119. [Google Scholar] [CrossRef]
- Li, J.J.; Han, L.L.; Ma, Y.; Yao, W.J.S.; Guo, J.; Guo, X.F. Cloning and expression analysis of transcription factor PlWRKY40 in peony. Plant Physiol. J. 2017, 53, 609–618. [Google Scholar]
- Mao, P.; Duan, M.; Wei, C.; Li, Y. WRKY62 Transcription Factor Acts Downstream of Cytosolic NPR1 and Negatively Regulates Jasmonate-Responsive Gene Expression. Plant Cell Physiol. 2007, 48, 833–842. [Google Scholar] [CrossRef]
- Ding, Z.J.; Yan, J.Y.; Li, C.X.; Li, G.X.; Wu, Y.R.; Zheng, S.J. Transcription factor WRKY46 modulates the development of Arabidopsis lateral roots in osmotic/salt stress conditions via regulation of ABA signaling and auxin homeostasis. Plant J. 2015, 84, 56–69. [Google Scholar] [CrossRef]
- Wang, Z.; Zhu, Y.; Wang, L.; Liu, X.; Liu, Y.; Phillips, J.; Deng, X. A WRKY transcription factor participates in dehydration tolerance in Boea hygrometrica by binding to the W-box elements of the galactinol synthase (BhGolS1) promoter. Planta 2009, 230, 1155–1166. [Google Scholar] [CrossRef]
- Mishra, S.; Triptahi, V.; Singh, S.; Phukan, U.J.; Gupta, M.M.; Shanker, K.; Shukla, R.K. Wound Induced tanscriptional regulation of benzylisoquinoline pathway and characterization of wound inducible PsWRKY transcription factor from Papaver somniferum. PLoS ONE 2013, 8, e52784. [Google Scholar] [CrossRef]
- Xiao, J.; Cheng, H.; Li, X.; Xiao, J.; Xu, C.; Wang, X. Rice WRKY13 Regulates Cross Talk between Abiotic and Biotic Stress Signaling Pathways by Selective Binding to Different cis-Elements. Plant Physiol. 2013, 163, 1868–1882. [Google Scholar] [CrossRef] [PubMed]
- Qiu, D.; Xiao, J.; Xie, W.; Cheng, H.; Li, X.; Wang, X. Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice. BMC Plant Biol. 2009, 9, 74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Narusaka, M.; Shirasu, K.; Noutoshi, Y.; Kubo, Y.; Shiraishi, T.; Iwabuchi, M.; Narusaka, Y. RRS1 and RPS4 provide a dual resistance-gene system against fungal and bacterial pathogens. Plant J. 2009, 60, 218–226. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yan, Y.; Li, Y.; Chu, X.; Wu, C.; Guo, X. GhWRKY40, a multiple stress-responsive cotton WRKY gene, plays an important role in the wounding response and enhances susceptibility to Ralstonia solanacearum infection in transgenic Nicotiana benthamiana. PLoS ONE 2014, 9, e93577. [Google Scholar] [CrossRef] [PubMed]
- Atamian, H.S.; Eulgem, T.; Kaloshian, I. SlWRKY70 is required for Mi-1-mediated resistance to aphids and nematodes in tomato. Planta 2012, 235, 299–309. [Google Scholar] [CrossRef]
- Li, C.; He, X.; Luo, X.; Xu, L.; Liu, L.; Min, L.; Jin, L.; Zhu, L.; Zhang, X. Cotton WRKY1 mediates the plant defense-to-development transition during infection of cotton by Verticillium dahliae by activating JASMONATE ZIM-DOMAIN1 expression. Plant Physiol. 2014, 166, 2179–2194. [Google Scholar] [CrossRef] [Green Version]
- Kunkel, B.N.; Brooks, D.M. Cross talk between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 2002, 5, 325–331. [Google Scholar] [CrossRef]
- Phan Tran, L.S.; Pal, S. Phytohormones: A Window to Metabolism, Signaling and Biotechnological Applications; Springer Science & Business Media: New York, NY, USA, 2014; pp. 289–321. ISBN 978-1-4939-0490-7. [Google Scholar]
- Pieterse, C.M.; Van Loon, L.C. NPR1: The spider in the web of induced resistance signaling pathways. Curr. Opin. Plant Biol. 2004, 7, 456–464. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.G.; Wu, J.; Wang, Y.; White, E.E.; Choi, Y.W.; Kim, K.K.; Choi, I.S.; Kim, Y.C.; Kim, S.H.; Kang, K.Y.; et al. Effect of phytohormones and chemical inhibitors on pathogenesis-related genes identifified by differential hybridization in rice suspension culture cells. Plant Pathol. J. 2010, 26, 386–393. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.; Kuang, J.; Wang, F.; Chen, L.; Hong, K.; Xiao, Y.; Xie, H.; Lu, W.; Chen, J. Molecular characterization of PR and WRKY genes during SA- and MeJA-induced resistance against Colletotrichum musae in banana fruit. Postharvest Biol. Technol. 2013, 79, 62–68. [Google Scholar] [CrossRef]
- Quaglia, M.; Ederli, L.; Pasqualini, S.; Zazzerini, A. Biological control agents and chemical inducers of resistance for postharvest control of Penicillium expansum Link, on apple fruit. Postharvest Biol. Technol. 2011, 59, 307–315. [Google Scholar] [CrossRef]
- Iqbal, Z.; Singh, Z.; Khangura, R.; Ahmad, S. Management of citrus blue and green moulds through application of organic elicitors. Aust. Plant Pathol. 2012, 41, 69–77. [Google Scholar] [CrossRef]
- Sherif, S.; Paliyath, G.; Jayasankar, S. Molecular characterization of peach PR genes and their induction kinetics in response to bacterial infection and signaling molecules. Plant Cell Rep. 2012, 31, 697–711. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.Y.; Kong, Q.J.; Wang, P.; Jiang, F.; Wang, H.L.; Yu, T.; Zheng, X.D. Molecular cloning of a PR-5 like protein gene from cherry tomato and analysis of the response of this gene to abiotic stresses. Mol. Biol. Rep. 2011, 38, 801–807. [Google Scholar] [CrossRef] [PubMed]
- Qiu, D.; Xiao, J.; Ding, X.; Xiong, M.; Cai, M.; Cao, Y.; Li, X.; Xu, C.; Wang, S. OsWRKY13 Mediates Rice Disease Resistance by Regulating Defense-Related Genes in Salicylate- and Jasmonate-Dependent Signaling. Mol. Plant Microbe Interact. 2007, 20, 492–499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benkovics, A.H.; Nyikó, T.; Mérai, Z.; Silhavy, D.; Bisztray, G.D. Functional analysis of the grapevine paralogs of the SMG7 NMD factor using a heterolog VIGS-based gene depletion-complementation system. Plant Mol. Biol. 2011, 75, 277–290. [Google Scholar] [CrossRef]
- Jesus, A.; María del, C.V.; Karelia, V.; José, A.P.; Luis, N.; Pedro, M.; Jose, G. Effectiveness of gene silencing induced by viral vectors based on Citrus leaf blotch virus is different in Nicotiana benthamiana and citrus plants. Virology 2014. [Google Scholar] [CrossRef] [Green Version]
- Cui, Y.; Jiang, J.; Yang, H.; Zhao, T.; Xu, X.; Li, J. Virus-induced gene silencing (VIGS) of the NBS-LRR gene SLNLC1 compromises Sm-mediated disease resistance to Stemphylium lycopersici in tomato. Biochem. Biophys. Res. Commun. 2018, 503, 1524–1529. [Google Scholar] [CrossRef]
- Seng, S.; Wu, C.; Wu, J.; Zhong, X.; He, J.; Yi, M. Silencing GhCOI1 in Gladiolus hybridus increases susceptibility to Alternaria brassicicola and impairs inducible defenses. Plant Cell Tissue Organ Cult. 2019. [Google Scholar] [CrossRef]
- Tan, G.; Li, Z.; Liu, S.; Wang, G.; Huang, Y. Mechanisms of action and efficacy of Bacillus subtilis BS80-6 active against postharvest anthracnose pathogen on apples. Acta Phytophylacica Sin. 2008, 35, 227–232. [Google Scholar] [CrossRef]
- Bachan, S.; Dinesh-Kumar, S.P. Tobacco rattle virus (TRV) based virus-induced gene silencing. Methods Mol. Biol. 2012, 894, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Dewdney, J.; Reuber, T.L.; Wildermuth, M.C.; Devoto, A.; Cui, J.; Stutius, L.M.; Drummond, E.P.; Ausubel, F.M. Three unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J. 2000, 24, 205–218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer Name | (5’ 3’) Nucleotide Sequence * | Purpose |
---|---|---|
PlActionF | ACTGCTGAACGGGAAATT | Actin Primers |
PlActionR | ATGGCTGGAACAGGACTT | |
PlWRKY13qF | GAAACCCTCCTAACTTCTAC | Specific primer for qRT-PCR |
PlWRKY13qR | AAACATTCATTCAACTCCC | |
PlWRKY13F | ATGTTAAACCAGGCG | Full-length DNA and cDNA amplification |
PlWRKY13R | CCAGAAGAAATTATT | |
PlWRKY13(X)F | GCTCTAGAATGTTAAACCAGGCG | vector construction of GFP |
PlWRKY13(K)R | GGGGTACCCCAGAAGAAATTATT | |
PlWRKY13(E)F | CGGAATTCATGTTAAACCAGGCG | vector construction of VIGS |
PlWRKY13(K)R | GGGGTACCATCAGCATCTCCATG | |
pTRV1F | TTACAGGTTATTTGGGCTAG | |
pTRV1R | CCGGGTTCAATTCCTTATC | Molecular detection of TRV |
pTRV2F | TTTATGTTCAGGCGGTTCTTGTG | |
pTRV2R | CAAACGCCGATCTCAAACAGTC | |
PR1F | TACCCAGAGACGGTTCGACT | |
PR1R | CACACGAGTTGGACCGGTAA | |
PR2F | TGGCCAAAGGGGTCTCTAGA | |
PR2R | TCCCATTTACGGCAAGCGTA | |
PR4BF | ATCCCGCTCAACACTCTTGG | |
PR4BR | TCCACAGAAAGCAGTCCACC | Primers for pathogenesis-related genes |
PR5F | CAGTCTTCCCTCAGGCAAGG | |
PR5R | GGTTTCACATGCGGGTTTCC | |
PR10F | CCGGCAAGGATTTTCAAGGC | |
PR10R | TTATCTTGATGGTCCCGGCG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Li, J.; Guo, X.; Ma, Y.; Qiao, Q.; Guo, J. PlWRKY13: A Transcription Factor Involved in Abiotic and Biotic Stress Responses in Paeonia lactiflora. Int. J. Mol. Sci. 2019, 20, 5953. https://doi.org/10.3390/ijms20235953
Wang X, Li J, Guo X, Ma Y, Qiao Q, Guo J. PlWRKY13: A Transcription Factor Involved in Abiotic and Biotic Stress Responses in Paeonia lactiflora. International Journal of Molecular Sciences. 2019; 20(23):5953. https://doi.org/10.3390/ijms20235953
Chicago/Turabian StyleWang, Xue, Junjie Li, Xianfeng Guo, Yan Ma, Qian Qiao, and Jing Guo. 2019. "PlWRKY13: A Transcription Factor Involved in Abiotic and Biotic Stress Responses in Paeonia lactiflora" International Journal of Molecular Sciences 20, no. 23: 5953. https://doi.org/10.3390/ijms20235953