Differential Expression of TFF1 and TFF3 in Patients Suffering from Chronic Rhinosinusitis with Nasal Polyposis
Abstract
:1. Introduction
2. Results
2.1. Characteristics of Subjects Enrolled in the Study
2.2. Target Genes Expression in Nasal Polyps and Nasal Mucosa of CRSwNP Patients
2.3. Effects of Bacterial Colonization and Allergy on the Target Genes Expression in Nasal Polyps and Nasal Mucosa of CRSwNP Patients
2.4. TFF1 and TFF3 Proteins Expression in Nasal Polyps and Nasal Mucosa of of CRSwNP Patients
3. Discussion
4. Materials and Methods
4.1. Study Design
4.2. Subjects
4.3. Quantitative Real-Time Polymerase Chain Reaction
4.4. Immunohistochemistry
4.5. Nasal Smear Foe Eosinophils
4.6. Acquisition of Nasal and Sinus Swabs
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AERD | Aspirin-exacerbated respiratory disease |
BE | Bulla ethmoidalis |
CRS | Chronic rhinosinusitis |
CRSwNP | Chronic rhinosinusitis with nasal polyposis |
CRSsNP | Chronic rhinosinusitis without nasal polyposis |
EGF | Epidermal growth factor |
FESS | Functional endoscopic sinus surgery |
18S | 18S ribosomal RNA |
GI | Gastrointestinal |
GUS | Beta-glucuronidase |
HPRT1 | Hypoxanthine phosphoribosyltransferase 1 |
INT | Inferior nasal turbinate |
MNT | Middle nasal turbinate |
NP | Nasal polyps |
RAST | Radioallergosorbent test |
RIST | Radioimmunosorbent Test |
RPL13A | Ribosomal Protein L13a |
TFF1 | Trefoil family factor protein 1 |
TFF2 | Trefoil factor family protein 2 |
TFF3 | Trefoil factor family protein 3 |
YWHAZ | Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta |
References
- Fokkens, W.J.; Lund, V.J.; Mullol, J.; Bachert, C.; Alobid, I.; Baroody, F.; Cohen, N.; Cervin, A.; Douglas, R.; Gevaert, P.; et al. European position paper on rhinosinusitis and nasal polyps 2012. Rhinology 2012, 50, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Hsu, J.; Peters, A.T. Pathophysiology of chronic rhinosinusitis with nasal polyp. Am. J. Rhinol. Allergy 2011, 25, 285–290. [Google Scholar] [CrossRef] [PubMed]
- Pawankar, R. Nasal polyposis: An update: Editorial review. Curr. Opin. Allergy Clin. Immunol. 2003, 3, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Hellquist, H.B. Nasal polyps update. Histopathology. Allergy Asthma Proc. 1996, 17, 237–242. [Google Scholar] [CrossRef]
- Taupin, D.; Podolsky, D.K. Trefoil factors: Initiators of mucosal healing. Nat. Rev. Mol. Cell Biol. 2003, 4, 721–732. [Google Scholar] [CrossRef]
- Kjellev, S. The trefoil factor family—small peptides with multiple functionalities. Cell. Mol. Life Sci. 2009, 66, 1350–1369. [Google Scholar] [CrossRef]
- Thim, L. A new family of growth factor-like peptides. “Trefoil” disulphide loop structures as a common feature in breast cancer associated peptide (pS2), pancreatic spasmolytic polypeptide (PSP), and frog skin peptides (spasmolysins). FEBS Lett. 1989, 250, 85–90. [Google Scholar] [CrossRef]
- Busch, M.; Dünker, N. Trefoil factor family peptides--friends or foes? Biomol. Concepts 2015, 6, 343–359. [Google Scholar] [CrossRef]
- Dos Santos Silva, E.; Ulrich, M.; Döring, G.; Botzenhart, K.; Gött, P. Trefoil factor family domain peptides in the human respiratory tract. J. Pathol. 2000, 190, 133–142. [Google Scholar] [CrossRef]
- Li, P.; Turner, J.H. Chronic rhinosinusitis without nasal polyps is associated with increased expression of trefoil factor family peptides. Int. Forum. Allergy Rhinol. 2014, 4, 571–576. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, Z.-F.; Zhang, Z.; Su, Y. Expression of Clara cell 10-kDa protein and trefoil factor family 1 in patients with chronic rhinosinusitis and nasal polyps. Exp. Ther. Med. 2018, 15, 2541–2546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aihara, E.; Engevik, K.A.; Montrose, M.H. Trefoil Factor Peptides and Gastrointestinal Function. Annu. Rev. Physiol. 2017, 79, 357–380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pera, M.; Heppell, J.; Poulsom, R.; Teixeira, F.; Williams, J. Ulcer associated cell lineage glands expressing trefoil peptide genes are induced by chronic ulceration in ileal pouch mucosa. Gut 2001, 48, 792–796. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taupin, D.; Wu, D.C.; Jeon, W.K.; Devaney, K.; Wang, T.C.; Podolsky, D.K. The trefoil gene family are coordinately expressed immediate-early genes: EGF receptor- and MAP kinase-dependent interregulation. J. Clin. Invest. 1999, 103, R31–R38. [Google Scholar] [CrossRef]
- Baus-Loncar, M.; Giraud, A.S. Multiple regulatory pathways for trefoil factor (TFF) genes. Cell. Mol. Life Sci. 2005, 62, 2921–2931. [Google Scholar] [CrossRef]
- Fu, T.; Znalesniak, E.B.; Kalinski, T.; Möhle, L.; Biswas, A.; Salm, F.; Dunay, I.R.; Hoffmann, W. TFF peptides play a role in the immune response following oral infection of mice with toxoplasma Gondii. Eur. J. Microbiol. Immunol. (Bp) 2015, 5, 221–231. [Google Scholar] [CrossRef]
- Shah, A.A.; Mihalj, M.; Ratkay, I.; Lubka-Pathak, M.; Balogh, P.; Klingel, K.; Bohn, E.; Blin, N.; Baus-Loncar, M. Increased susceptibility to Yersinia enterocolitica Infection of Tff2 deficient mice. Cell. Physiol. Biochem. 2012, 30, 853–862. [Google Scholar] [CrossRef]
- Lefebvre, O.; Chenard, M.P.; Masson, R.; Linares, J.; Dierich, A.; LeMeur, M.; Wendling, C.; Tomasetto, C.; Chambon, P.; Rio, M.C. Gastric mucosa abnormalities and tumorigenesis in mice lacking the pS2 trefoil protein. Science 1996, 274, 259–262. [Google Scholar] [CrossRef]
- Baus-Loncar, M.; Kayademir, T.; Takaishi, S.; Wang, T. Trefoil factor family 2 deficiency and immune response. Cell. Mol. Life Sci. 2005, 62, 2947–2955. [Google Scholar] [CrossRef]
- Hoffmann, W. Trefoil factors TFF (trefoil factor family) peptide-triggered signals promoting mucosal restitution. Cell. Mol. Life Sci. 2005, 62, 2932–2938. [Google Scholar] [CrossRef]
- Perry, J.K.; Kannan, N.; Grandison, P.M.; Mitchell, M.D.; Lobie, P.E. Are trefoil factors oncogenic? Trends Endocrinol. Metab. 2008, 19, 74–81. [Google Scholar] [CrossRef] [PubMed]
- Stevens, W.W.; Schleimer, R.P.; Kern, R.C. Chronic Rhinosinusitis with Nasal Polyps. J. Allergy Clin. Immunol. Pract. 2016, 4, 565–572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grigoreas, C.; Vourdas, D.; Petalas, K.; Simeonidis, G.; Demeroutis, I.; Tsioulos, T. Nasal polyps in patients with rhinitis and asthma. Allergy Asthma Proc. 2002, 23, 169–174. [Google Scholar] [PubMed]
- Dąbrowska-Bień, J.; Skarżyński, P.H.; Gwizdalska, I.; Łazęcka, K.; Skarżyński, H. Complications in septoplasty based on a large group of 5639 patients. Eur. Arch Otorhinolaryngol. 2018, 275, 1789–1794. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.H.; Park, M.D.; Otto, M. Host Response to staphylococcus epidermidis colonization and infections. Front. Cell Infect. Microbiol. 2017, 7, 90. [Google Scholar] [CrossRef] [PubMed]
- Tebbutt, N.C.; Giraud, A.S.; Inglese, M.; Jenkins, B.; Waring, P.; Clay, F.J.; Malki, S.; Alderman, B.M.; Grail, D.; Hollande, F.; et al. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and STAT-mediated trefoil gene activation in gp130 mutant mice. Nat. Med. 2002, 8, 1089–1097. [Google Scholar] [CrossRef]
- Mashimo, H.; Wu, D.C.; Podolsky, D.K.; Fishman, M.C. Impaired defense of intestinal mucosa in mice lacking intestinal trefoil factor. Science 1996, 274, 262–265. [Google Scholar] [CrossRef]
- Senior, B.A.; Kennedy, D.W.; Tanabodee, J.; Kroger, H.; Hassab, M.; Lanza, D. Long-term results of functional endoscopic sinus surgery. Laryngoscope 1998, 108, 151–157. [Google Scholar] [CrossRef]
- Mascarenhas, J.G.; da Fonseca, V.M.G.; Chen, V.G.; Itamoto, C.H.; da Silva, C.A.P.; Gregório, L.C.; Kosugi, E.M. Long-term outcomes of endoscopic sinus surgery for chronic rhinosinusitis with and without nasal polyps. Br. J. Otorhinolaryngol. 2013, 79, 306–311. [Google Scholar] [CrossRef] [Green Version]
- Miyahara, N.; Ishino, T.; Kono, T.; Go, K.; Takeno, S.; Takumida, M.; Hirakawa, K. Expression of Trefoil factor family peptides in the nasal allergic mucosa. Rhinology 2012, 50, 408–416. [Google Scholar] [CrossRef] [Green Version]
- Hoffmann, W. TFF (trefoil factor family) peptides and their potential roles for differentiation processes during airway remodeling. Curr. Med. Chem. 2007, 14, 2716–2719. [Google Scholar] [CrossRef] [PubMed]
- Peters, A.T.; Kato, A.; Zhang, N.; Conley, D.B.; Suh, L.; Tancowny, B.; Carter, D.; Carr, T.; Radtke, M.; Hulse, K.E.; et al. Evidence for altered activity of the IL-6 pathway in chronic rhinosinusitis with nasal polyps. J. Allergy Clin. Immunol. 2010, 125, 397–403. [Google Scholar] [CrossRef] [PubMed]
- Jiang, G.X.; Zhong, X.Y.; Cui, Y.F.; Liu, W.; Tai, S.; Wang, Z.D.; Shi, Y.G.; Zhao, S.Y.; Li, C.L. IL-6/STAT3/TFF3 signaling regulates human biliary epithelial cell migration and wound healing in vitro. Mol. Biol. Rep. 2010, 37, 3813–3818. [Google Scholar] [CrossRef] [PubMed]
- Nozaki, I.; Lunz, J.G., 3rd; Specht, S.; Park, J.I.; Giraud, A.S.; Murase, N.; Demetris, A.J. Regulation and function of trefoil factor family 3 expression in the biliary tree. Am. J. Pathol. 2004, 165, 1907–1920. [Google Scholar] [CrossRef]
- Nourani, M.R.; Farajpour, Z.; Najafi, A.; Imani Fooladi, A.A. Trefoil factor family 1 is involved in airway remodeling of mustard lung. Iran J. Allergy Asthma Immunol. 2016, 15, 275–282. [Google Scholar]
- Madsen, J.; Nielsen, O.; Tornøe, I.; Thim, L.; Holmskov, U. Tissue localization of human trefoil factors 1, 2, and 3. J. Histochem. Cytochem. 2007, 55, 505–513. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef]
- Vandesompele, J.; de Preter, K.; Pattyn, F.; Poppe, B.; van Roy, N.; de Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome boil. 2002, 3, research0034-1. [Google Scholar] [Green Version]
CRSwNP | Control | |
---|---|---|
N | 29 | 25 |
Age * (years old) | 53.4 ± 9.55 (26–69) | 35.4 ± 11.1 (21–60) |
Gender (M/F) | 16/13 | 14/11 |
Smokers | 4 (13.8%) | 10 (40.0%) |
RIST/RAST positive | 6 (20.7%) | 0 |
AERD | 3 (10.3%) | 0 |
Sinus swab positive | 23 (79.3%) | N/A |
Sinus swab-sterile | 6 (20.7%) | N/A |
Nasal swab-sterile | N/A | 25 (100%) |
SNOT-20 * | 41.6 ± 25.9 (6–86) | 35.9 ± 19.8 (13–77) |
CT grading score * | 12.0 ± 5.19 (2–24) | - |
Total endoscopy score * | 4.10 ± 2.16 (0–6) | - |
Sample | Middle Nasal Turbinate | Bulla Ethmoidalis | Nasal Polyp |
---|---|---|---|
Pathogenic Bacteria (n = 15) | n.a. | n.a. | n.a. |
Normal Flora (n = 8) | ↑↑TFF3 (7.16x; p = 0.004) | - | ↑↑TFF3 (7.77x; p = 0.034) |
Gene | Sequence 5’–3’ | Optimized PCRcondition (Annealing Temp/ MgCl2) | |
---|---|---|---|
TFF1 | For | TTTGGAGCAGAGAGGAGGCAATG | 57 °C/3.5 mM |
Rev | ACCACAATTCTGTCTTTCACGGGG | ||
TFF3 | For | CTTGCTGTCCTCCAGCTCT | 57 °C/3.5 mM |
Rev | CCGGTTGTTGCACTCCTT | ||
Rev | ACGAGTCAGAGCTTTGGCTAGGAA | ||
HPRT1 | For | GCTTTCCTTGGTCAGGCAGTAT | 58 °C /3.5 mM |
Rev | GGCTTATATCCAACACTTCGTGGG | ||
18S rRNA | For | GTAACCCGTTGAACCCCATT | 59 °C/3 mM |
Rev | CCATCCAATCGGTAGTAGCG | ||
GUS | For | TCACCAGGATCCACCTCTGATGTT | 59 °C/3.5 mM |
Rev | TTGGTTGTCTCTGCCGAGTGAAGA | ||
YWHAZ | For | CCCACAGACTATTTCCCTCATC | 59 °C/3 mM |
Rev | GACAGACCATTCAGGATAGGTAGG | ||
RPL13A | For | CCTGGAGGAGAAGAGGAAAGAGA | 59 °C/3 mM |
Rev | TTGAGGACCTCTGTGTATTTGTCAA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mihalj, M.; Bujak, M.; Butković, J.; Zubčić, Ž.; Tolušić Levak, M.; Čes, J.; Kopić, V.; Baus Lončar, M.; Mihalj, H. Differential Expression of TFF1 and TFF3 in Patients Suffering from Chronic Rhinosinusitis with Nasal Polyposis. Int. J. Mol. Sci. 2019, 20, 5461. https://doi.org/10.3390/ijms20215461
Mihalj M, Bujak M, Butković J, Zubčić Ž, Tolušić Levak M, Čes J, Kopić V, Baus Lončar M, Mihalj H. Differential Expression of TFF1 and TFF3 in Patients Suffering from Chronic Rhinosinusitis with Nasal Polyposis. International Journal of Molecular Sciences. 2019; 20(21):5461. https://doi.org/10.3390/ijms20215461
Chicago/Turabian StyleMihalj, Martina, Maro Bujak, Josip Butković, Željko Zubčić, Maja Tolušić Levak, Josip Čes, Vlatko Kopić, Mirela Baus Lončar, and Hrvoje Mihalj. 2019. "Differential Expression of TFF1 and TFF3 in Patients Suffering from Chronic Rhinosinusitis with Nasal Polyposis" International Journal of Molecular Sciences 20, no. 21: 5461. https://doi.org/10.3390/ijms20215461
APA StyleMihalj, M., Bujak, M., Butković, J., Zubčić, Ž., Tolušić Levak, M., Čes, J., Kopić, V., Baus Lončar, M., & Mihalj, H. (2019). Differential Expression of TFF1 and TFF3 in Patients Suffering from Chronic Rhinosinusitis with Nasal Polyposis. International Journal of Molecular Sciences, 20(21), 5461. https://doi.org/10.3390/ijms20215461