ATP Binding Cassette Transporter A1 is Involved in Extracellular Secretion of Acetylated APE1/Ref-1
Abstract
1. Introduction
2. Results
2.1. Non-Classical Secretion of APE1/Ref-1 in Response to TSA
2.2. Extracellular Secretion of APE1/Ref-1 Was Decreased by ABC Transporter Inhibitors
2.3. ABCA1 Transporter Was Involved in the Secretion of APE1/Ref-1
2.4. Acetylation of APE1/Ref-1 Was Required for Binding to ABCA1 Transporter
2.5. Intracellular Acetylation Induced APE1/Ref-1 Translocation to the Plasma Membrane
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell culture and treatment
4.3. Enzyme-linked immunosorbent assay (ELISA)
4.4. Transfection of small interfering RNA (siRNA)
4.5. Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
4.6. Fractionation of Plasma Membrane
4.7. Immunoprecipitation
4.8. Proximal Ligation Assay
4.9. Statistical analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Muesch, A.; Hartmann, E.; Rohde, K.; Rubartelli, A.; Sitia, R.; Rapoport, T.A. A novel pathway for secretory proteins? Trends Biochem. Sci. 1990, 15, 86–88. [Google Scholar] [CrossRef]
- Pakdel, M.; von Blume, J. Exploring new routes for secretory protein export from the trans-Golgi network. Mol. Biol. Cell 2018, 29, 235–240. [Google Scholar] [CrossRef] [PubMed]
- Nugent, M.A.; Iozzo, R.V. Fibroblast growth factor-2. Int. J. Biochem. Cell Biol. 2000, 32, 115–120. [Google Scholar] [CrossRef]
- Perillo, N.L.; Pace, K.E.; Seilhamer, J.J.; Baum, L.G. Apoptosis of T cells mediated by galectin-1. Nature 1995, 378, 736–739. [Google Scholar] [CrossRef] [PubMed]
- Braddock, M.; Quinn, A. Targeting IL-1 in inflammatory disease: New opportunities for therapeutic intervention. Nat. Rev. Drug. Discov. 2004, 3, 330–339. [Google Scholar] [CrossRef] [PubMed]
- Tell, G.; Damante, G.; Caldwell, D.; Kelley, M.R. The intracellular localization of APE1/Ref-1: More than a passive phenomenon? Antioxid. Redox. Signal. 2005, 7, 367–384. [Google Scholar] [CrossRef] [PubMed]
- Tell, G.; Quadrifoglio, F.; Tiribelli, C.; Kelley, M.R. The many functions of APE1/Ref-1: Not only a DNA repair enzyme. Antioxid Redox Signal 2009, 11, 601–620. [Google Scholar] [CrossRef] [PubMed]
- Qu, J.; Liu, G.H.; Huang, B.; Chen, C. Nitric oxide controls nuclear export of APE1/Ref-1 through S-nitrosation of cysteines 93 and 310. Nucleic Acids Res. 2007, 35, 2522–2532. [Google Scholar] [CrossRef]
- Choi, S.; Lee, Y.R.; Park, M.S.; Joo, H.K.; Cho, E.J.; Kim, H.S.; Kim, C.S.; Park, J.B.; Irani, K.; Jeon, B.H. Histone deacetylases inhibitor trichostatin A modulates the extracellular release of APE1/Ref-1. Biochem. Biophys. Res. Commun. 2013, 435, 403–407. [Google Scholar] [CrossRef]
- Park, M.S.; Choi, S.; Lee, Y.R.; Joo, H.K.; Kang, G.; Kim, C.S.; Kim, S.J.; Lee, S.D.; Jeon, B.H. Secreted APE1/Ref-1 inhibits TNF-alpha-stimulated endothelial inflammation via thiol-disulfide exchange in TNF receptor. Sci. Rep. 2016, 6, 23015. [Google Scholar] [CrossRef]
- Park, M.S.; Lee, Y.R.; Choi, S.; Joo, H.K.; Cho, E.J.; Kim, C.S.; Park, J.B.; Jo, E.K.; Jeon, B.H. Identification of plasma APE1/Ref-1 in lipopolysaccharide-induced endotoxemic rats: Implication of serological biomarker for an endotoxemia. Biochem. Biophys. Res. Commun. 2013, 435, 621–626. [Google Scholar] [CrossRef] [PubMed]
- Nath, S.; Roychoudhury, S.; Kling, M.J.; Song, H.; Biswas, P.; Shukla, A.; Band, H.; Joshi, S.; Bhakat, K.K. The extracellular role of DNA damage repair protein APE1 in regulation of IL-6 expression. Cell. Signal. 2017, 39, 18–31. [Google Scholar] [CrossRef]
- Shin, J.H.; Choi, S.; Lee, Y.R.; Park, M.S.; Na, Y.G.; Irani, K.; Lee, S.D.; Park, J.B.; Kim, J.M.; Lim, J.S.; et al. APE1/Ref-1 as a Serological biomarker for the detection of bladder cancer. Cancer Res. Treat. Off. J. Korean Cancer Assoc. 2015, 47, 823–833. [Google Scholar] [CrossRef] [PubMed]
- Yoo, D.G.; Song, Y.J.; Cho, E.J.; Lee, S.K.; Park, J.B.; Yu, J.H.; Lim, S.P.; Kim, J.M.; Jeon, B.H. Alteration of APE1/ref-1 expression in non-small cell lung cancer: The implications of impaired extracellular superoxide dismutase and catalase antioxidant systems. Lung Cancer 2008, 60, 277–284. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.R.; Kim, K.M.; Jeon, B.H.; Choi, S. Extracellularly secreted APE1/Ref-1 triggers apoptosis in triple-negative breast cancer cells via RAGE binding, which is mediated through acetylation. Oncotarget 2015, 6, 23383–23398. [Google Scholar] [CrossRef]
- Bonaldi, T.; Talamo, F.; Scaffidi, P.; Ferrera, D.; Porto, A.; Bachi, A.; Rubartelli, A.; Agresti, A.; Bianchi, M.E. Monocytic cells hyperacetylate chromatin protein HMGB1 to redirect it towards secretion. EMBO J. 2003, 22, 5551–5560. [Google Scholar] [CrossRef]
- Bentovim, L.; Amarilio, R.; Zelzer, E. HIF1 alpha is a central regulator of collagen hydroxylation and secretion under hypoxia during bone development. Development 2012, 139, 4473–4483. [Google Scholar] [CrossRef]
- Wang, P.; Keijer, J.; Bunschoten, A.; Bouwman, F.; Renes, J.; Mariman, E. Insulin modulates the secretion of proteins from mature 3T3-L1 adipocytes: A role for transcriptional regulation of processing. Diabetologia 2006, 49, 2453–2462. [Google Scholar] [CrossRef]
- Wilkens, S. Structure and mechanism of ABC transporters. F1000Prime Rep. 2015, 7, 14. [Google Scholar] [CrossRef]
- Flieger, O.; Engling, A.; Bucala, R.; Lue, H.; Nickel, W.; Bernhagen, J. Regulated secretion of macrophage migration inhibitory factor is mediated by a non-classical pathway involving an ABC transporter. Febs. Lett. 2003, 551, 78–86. [Google Scholar] [CrossRef]
- Andrei, C.; Dazzi, C.; Lotti, L.; Torrisi, M.R.; Chimini, G.; Rubartelli, A. The secretory route of the leaderless protein interleukin 1beta involves exocytosis of endolysosome-related vesicles. Mol. Biol. Cell 1999, 10, 1463–1475. [Google Scholar] [CrossRef] [PubMed]
- Wein, S.; Fauroux, M.; Laffitte, J.; de Nadai, P.; Guaini, C.; Pons, F.; Comera, C. Mediation of annexin 1 secretion by a probenecid-sensitive ABC-transporter in rat inflamed mucosa. Biochem. Pharm. 2004, 67, 1195–1202. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, K.O.; Topp, E.; Makagiansar, I.; Siahaan, T.; Yazdanian, M.; Audus, K.L. Multidrug resistance-associated protein-1 functional activity in Calu-3 cells. J. Pharm. Exp. Ther. 2001, 298, 1199–1205. [Google Scholar]
- Legrand, O.; Simonin, G.; Beauchamp-Nicoud, A.; Zittoun, R.; Marie, J.P. Simultaneous activity of MRP1 and Pgp is correlated with in vitro resistance to daunorubicin and with in vivo resistance in adult acute myeloid leukemia. Blood 1999, 94, 1046–1056. [Google Scholar] [PubMed]
- Leier, I.; Hummel-Eisenbeiss, J.; Cui, Y.; Keppler, D. ATP-dependent para-aminohippurate transport by apical multidrug resistance protein MRP2. Kidney Int. 2000, 57, 1636–1642. [Google Scholar] [CrossRef] [PubMed]
- Hamon, Y.; Luciani, M.F.; Becq, F.; Verrier, B.; Rubartelli, A.; Chimini, G. Interleukin-1beta secretion is impaired by inhibitors of the Atp binding cassette transporter, ABC1. Blood 1997, 90, 2911–2915. [Google Scholar]
- Vrana, D.; Hlavac, V.; Brynychova, V.; Vaclavikova, R.; Neoral, C.; Vrba, J.; Aujesky, R.; Matzenauer, M.; Melichar, B.; Soucek, P. ABC Transporters and their role in the neoadjuvant treatment of esophageal cancer. Int. J. Mol. Sci. 2018, 19, 868. [Google Scholar] [CrossRef]
- Jin, S.A.; Lim, B.K.; Seo, H.J.; Kim, S.K.; Ahn, K.T.; Jeon, B.H.; Jeong, J.O. Elevation of serum APE1/Ref-1 in experimental murine myocarditis. Int. J. Mol. Sci. 2017, 18, 2664. [Google Scholar] [CrossRef]
- Dai, N.; Cao, X.J.; Li, M.X.; Qing, Y.; Liao, L.; Lu, X.F.; Zhang, S.H.; Li, Z.; Yang, Y.X.; Wang, D. Serum APE1 autoantibodies: A novel potential tumor marker and predictor of chemotherapeutic efficacy in non-small cell lung cancer. PLoS ONE 2013, 8, e58001. [Google Scholar] [CrossRef]
- Choi, S.; Shin, J.H.; Lee, Y.R.; Joo, H.K.; Song, K.H.; Na, Y.G.; Chang, S.J.; Lim, J.S.; Jeon, B.H. Urinary APE1/Ref-1: A potential bladder cancer biomarker. Dis. Markers 2016, 2016, 7276502. [Google Scholar] [CrossRef]
- Sharff, A.; Fanutti, C.; Shi, J.Y.; Calladine, C.; Luisi, B. The role of the TolC family in protein transport and multidrug efflux—From stereochemical certainty to mechanistic hypothesis. Eur. J. Biochem. 2001, 268, 5011–5026. [Google Scholar] [CrossRef] [PubMed]
- Debarbieux, L.; Wandersman, C. Folded HasA inhibits its own secretion through its ABC exporter. EMBO J. 2001, 20, 4657–4663. [Google Scholar] [CrossRef] [PubMed]
- Backhaus, R.; Zehe, C.; Wegehingel, S.; Kehlenbach, A.; Schwappach, B.; Nickel, W. Unconventional protein secretion: Membrane translocation of FGF-2 does not require protein unfolding. J. Cell Sci. 2004, 117, 1727–1736. [Google Scholar] [CrossRef] [PubMed]
- Nickel, W. The unconventional secretory machinery of fibroblast growth factor 2. Traffic 2011, 12, 799–805. [Google Scholar] [CrossRef] [PubMed]
- Tarling, E.J.; de Aguiar Vallim, T.Q.; Edwards, P.A. Role of ABC transporters in lipid transport and human disease. Trends Endocrinol. Metab. 2013, 24, 342–350. [Google Scholar] [CrossRef] [PubMed]
- Neufeld, E.B.; Remaley, A.T.; Demosky, S.J.; Stonik, J.A.; Cooney, A.M.; Comly, M.; Dwyer, N.K.; Zhang, M.; Blanchette-Mackie, J.; Santamarina-Fojo, S.; et al. Cellular localization and trafficking of the human ABCA1 transporter. J. Biol. Chem. 2001, 276, 27584–27590. [Google Scholar] [CrossRef]
- Bhakat, K.K.; Izumi, T.; Yang, S.H.; Hazra, T.K.; Mitra, S. Role of acetylated human AP-endonuclease (APE1/Ref-1) in regulation of the parathyroid hormone gene. EMBO J. 2003, 22, 6299–6309. [Google Scholar] [CrossRef]
- Jackson, E.B.; Theriot, C.A.; Chattopadhyay, R.; Mitra, S.; Izumi, T. Analysis of nuclear transport signals in the human apurinic/apyrimidinic endonuclease (APE1/Ref1). Nucleic Acids Res. 2005, 33, 3303–3312. [Google Scholar] [CrossRef]
- Barnes, P.J.; Adcock, I.M.; Ito, K. Histone acetylation and deacetylation: Importance in inflammatory lung diseases. Eur. Respir. J. 2005, 25, 552–563. [Google Scholar] [CrossRef]
- Soe, N.N.; Sowden, M.; Baskaran, P.; Kim, Y.; Nigro, P.; Smolock, E.M.; Berk, B.C. Acetylation of cyclophilin A is required for its secretion and vascular cell activation. Cardiovasc. Res. 2014, 101, 444–453. [Google Scholar] [CrossRef]
- Li, Y.; Alam, H.B. Modulation of acetylation: Creating a pro-survival and anti-inflammatory phenotype in lethal hemorrhagic and septic shock. J. Biomed. Biotechnol. 2011, 2011, 523481. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.M.; Lee, E.O.; Lee, Y.R.; Joo, H.K.; Park, M.S.; Kim, C.S.; Choi, S.; Jeong, J.O.; Jeon, B.H. APE1/Ref-1 inhibits phosphate-induced calcification and osteoblastic phenotype changes in vascular smooth muscle cells. Int. J. Mol. Sci. 2017, 18, 2053. [Google Scholar] [CrossRef] [PubMed]
- Joo, H.K.; Lee, Y.R.; Lee, E.O.; Park, M.S.; Choi, S.; Kim, C.S.; Park, J.B.; Jeon, B.H. The extracellular role of Ref-1 as anti-inflammatory function in lipopolysaccharide-induced septic mice. Free Radic. Biol. Med. 2019, 139, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Schunke, S.; Stoldt, M.; Novak, K.; Kaupp, U.B.; Willbold, D. Solution structure of the Mesorhizobium loti K1 channel cyclic nucleotide-binding domain in complex with cAMP. EMBO Rep. 2009, 10, 729–735. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.R.; Lim, J.S.; Shin, J.H.; Choi, S.; Joo, H.K.; Jeon, B.H. Altered secretory activity of APE1/Ref-1 D148E variants identified in human patients with bladder cancer. Int. Neurourol. J. 2016, 20, S30–S37. [Google Scholar] [CrossRef] [PubMed]
- Yamamori, T.; DeRicco, J.; Naqvi, A.; Hoffman, T.A.; Mattagajasingh, I.; Kasuno, K.; Jung, S.B.; Kim, C.S.; Irani, K. SIRT1 deacetylates APE1 and regulates cellular base excision repair. Nucleic Acids Res. 2010, 38, 832–845. [Google Scholar] [CrossRef] [PubMed]





| Target Gene | Accession No. | siRNA sequence (5′–3′) | 
|---|---|---|
| ABCA1 | NM_005502 | GUGUCUAUAUGCAACAGAU | 
| ABCB1 | NM_000927 | CAGCAAUUAGAACUGUGAU | 
| ABCC1 | NM_004996 | CUGACAAGCUAGACCAUGA | 
| ABCC2 | NM_000392 | ACAAGGUAAUGGUCCUAGA | 
| ABCC8 | NM_000352 | CGUCAUCUCCUAUGUCACA | 
| Target Gene | Accession No. | Forward (5′–3′) | Reverse (5′–3′) | TM (℃) | Cycle | 
|---|---|---|---|---|---|
| ABCA1 | NM_005502 | actgtggacaagatgctgagg | aaacatcacctcctgtcgcat | 60 | 25 | 
| ABCB1 | NM_000927 | cacaagcccaagacagaaagc | tgagcatggatcggaaaacca | 60 | 25 | 
| ABCB11 | NM_003742 | gaagctgagcctggtcatctt | gcagagatcaccctgaacaca | 60 | 25 | 
| ABCC1 | NM_004996 | tgctcactttctggctggtag | ccgacgtgtcctccttgttta | 60 | 25 | 
| ABCC2 | NM_000392 | tgcggctctcattcagtcttt | atcaccccaacacctgctaag | 60 | 25 | 
| ABCC3 | NM_003786 | cgtggctacatcatcctctcc | gtagaaggtggtgaagcggaa | 60 | 25 | 
| ABCC8 | NM_000352 | atccccacactgtccaacatc | agagagcaggcttcaatgacc | 60 | 25 | 
| ABCC9 | NM_020297 | caggacggattatctgggagc | tgatgtaagccttgacgtgct | 60 | 25 | 
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, Y.R.; Joo, H.K.; Lee, E.O.; Cho, H.S.; Choi, S.; Kim, C.-S.; Jeon, B.H. ATP Binding Cassette Transporter A1 is Involved in Extracellular Secretion of Acetylated APE1/Ref-1. Int. J. Mol. Sci. 2019, 20, 3178. https://doi.org/10.3390/ijms20133178
Lee YR, Joo HK, Lee EO, Cho HS, Choi S, Kim C-S, Jeon BH. ATP Binding Cassette Transporter A1 is Involved in Extracellular Secretion of Acetylated APE1/Ref-1. International Journal of Molecular Sciences. 2019; 20(13):3178. https://doi.org/10.3390/ijms20133178
Chicago/Turabian StyleLee, Yu Ran, Hee Kyoung Joo, Eun Ok Lee, Hyun Sil Cho, Sunga Choi, Cuk-Seong Kim, and Byeong Hwa Jeon. 2019. "ATP Binding Cassette Transporter A1 is Involved in Extracellular Secretion of Acetylated APE1/Ref-1" International Journal of Molecular Sciences 20, no. 13: 3178. https://doi.org/10.3390/ijms20133178
APA StyleLee, Y. R., Joo, H. K., Lee, E. O., Cho, H. S., Choi, S., Kim, C.-S., & Jeon, B. H. (2019). ATP Binding Cassette Transporter A1 is Involved in Extracellular Secretion of Acetylated APE1/Ref-1. International Journal of Molecular Sciences, 20(13), 3178. https://doi.org/10.3390/ijms20133178
 
        



 
                         
       