Evaluation of Mesenchymal Stem Cell Sheets Overexpressing BMP-7 in Canine Critical-Sized Bone Defects
Abstract
1. Introduction
2. Results
2.1. Gene Transduction and BMP-7 Secretion In Vitro
2.2. Alkaline Phosphatase (ALP) Activity
2.3. Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Analysis
2.4. In Vivo Bone Regeneration in Canine Radial Defects
2.5. Histological Evaluation
3. Discussion
4. Materials and Methods
4.1. Isolation and Culture of Canine Ad-MSCs
4.2. Lentiviral Packing and Transduction
4.3. Gene Expression Analysis for Identification of BMP-7 Overexpression
4.4. Protein Expression Analysis for Identification of BMP-7 Overexpression
4.5. Preparation of Ad-MSC Sheets and BMP-7-CS
4.6. Gene Expression Analysis
4.7. ALP Activity Measurement
4.8. Fabrication of Poly ε-caprolactone/β-tricalcium phosphate Scaffolds
4.9. Animal Experiments
4.10. Micro-CT for Bone Imaging
4.11. Histological Analysis
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| Ad-MSCs | Adipose-derived mesenchymal stem cells |
| ALP | Alkaline phosphatase |
| BMP-7-CS | Bone morphogenetic proteins overexpressing adipose-derived mesenchymal stem cell sheets |
| BMP | Bone morphogenetic proteins |
| DBM | Demineralized bone matrix |
| ECM | Endogenous extracellular matrix |
| A2-P | l-Ascorbic acid 2-phosphate |
| MSC | Mesenchymal stem cells |
| PDGFB | Platelet-derived growth factor subunit B |
| PCL | Poly ε-caprolactone |
| RUNX2 | Runt-related transcription factor 2 |
| TGF | Transforming growth factor |
| VEGF | Vascular endothelial growth factor |
| β-TCP | β-Tricalcium phosphate |
References
- Cancedda, R.; Giannoni, P.; Mastrogiacomo, M. A tissue engineering approach to bone repair in large animal models and in clinical practice. Biomaterials 2007, 28, 4240–4250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, B.J.; Ryu, H.H.; Park, S.S.; Koyama, Y.; Kikuchi, M.; Woo, H.M.; Kim, W.H.; Kweon, O.K. Comparing the osteogenic potential of canine mesenchymal stem cells derived from adipose tissues, bone marrow, umbilical cord blood, and wharton’s jelly for treating bone defects. J. Vet. Sci. 2012, 13, 299–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akahane, M.; Nakamura, A.; Ohgushi, H.; Shigematsu, H.; Dohi, Y.; Takakura, Y. Osteogenic matrix sheet-cell transplantation using osteoblastic cell sheet resulted in bone formation without scaffold at an ectopic site. J. Tissue Eng. Regen. Med. 2008, 2, 196–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, T.; Zhu, Z.; Awad, H.A.; Schwarz, E.M.; Hilton, M.J.; Dong, Y. The effect of mesenchymal stem cell sheets on structural allograft healing of critical sized femoral defects in mice. Biomaterials 2014, 35, 2752–2759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alaee, F.; Hong, S.H.; Dukas, A.G.; Pensak, M.J.; Rowe, D.W.; Lieberman, J.R. Evaluation of osteogenic cell differentiation in response to bone morphogenetic protein or demineralized bone matrix in a critical sized defect model using gfp reporter mice. J. Orthop. Res. 2014, 32, 1120–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cook, S.D.; Baffes, G.C.; Wolfe, M.W.; Sampath, T.K.; Rueger, D.C. Recombinant human bone morphogenetic protein-7 induces healing in a canine long-bone segmental defect model. Clin. Orthop. Relat. Res. 1994, 301, 302–312. [Google Scholar] [CrossRef] [Scilit]
- Wang, E.A.; Rosen, V.; D’Alessandro, J.S.; Bauduy, M.; Cordes, P.; Harada, T.; Israel, D.I.; Hewick, R.M.; Kerns, K.M.; LaPan, P.; et al. Recombinant human bone morphogenetic protein induces bone formation. Proc. Natl. Acad. Sci. USA 1990, 87, 2220–2224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, W.K.; Sugiyama, O.; Park, S.H.; Conduah, A.; Feeley, B.T.; Liu, N.Q.; Krenek, L.; Virk, M.S.; An, D.S.; Chen, I.S.; et al. Lentiviral-mediated bmp-2 gene transfer enhances healing of segmental femoral defects in rats. Bone 2007, 40, 931–938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sugiyama, O.; An, D.S.; Kung, S.P.; Feeley, B.T.; Gamradt, S.; Liu, N.Q.; Chen, I.S.; Lieberman, J.R. Lentivirus-mediated gene transfer induces long-term transgene expression of bmp-2 in vitro and new bone formation in vivo. Mol. Ther. 2005, 11, 390–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mauney, J.R.; Jaquiery, C.; Volloch, V.; Heberer, M.; Martin, I.; Kaplan, D.L. In vitro and in vivo evaluation of differentially demineralized cancellous bone scaffolds combined with human bone marrow stromal cells for tissue engineering. Biomaterials 2005, 26, 3173–3185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wildemann, B.; Kadow-Romacker, A.; Pruss, A.; Haas, N.P.; Schmidmaier, G. Quantification of growth factors in allogenic bone grafts extracted with three different methods. Cell Tissue Bank 2007, 8, 107–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tuli, S.M.; Singh, A.D. The osteoninductive property of decalcified bone matrix. An experimental study. J Bone Joint Surg. Br. 1978, 60, 116–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drosos, G.I.; Touzopoulos, P.; Ververidis, A.; Tilkeridis, K.; Kazakos, K. Use of demineralized bone matrix in the extremities. World J. Orthop. 2015, 6, 269–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gruskin, E.; Doll, B.A.; Futrell, F.W.; Schmitz, J.P.; Hollinger, J.O. Demineralized bone matrix in bone repair: History and use. Adv. Drug Deliv. Rev. 2012, 64, 1063–1077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, Y.; Lee, S.H.; Kang, B.J.; Kim, W.H.; Yun, H.S.; Kweon, O.K. Comparison of osteogenesis between adipose-derived mesenchymal stem cells and their sheets on poly-epsilon-caprolactone/beta-tricalcium phosphate composite scaffolds in canine bone defects. Stem Cells Int. 2016, 2016, 8414715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Byeon, Y.E.; Ryu, H.H.; Park, S.S.; Koyama, Y.; Kikuchi, M.; Kim, W.H.; Kang, K.S.; Kweon, O.K. Paracrine effect of canine allogenic umbilical cord blood-derived mesenchymal stromal cells mixed with beta-tricalcium phosphate on bone regeneration in ectopic implantations. Cytotherapy 2010, 12, 626–636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamato, M.; Okano, T. Cell sheet engineering. Mater. Today 2004, 7, 42–47. [Google Scholar] [CrossRef] [Scilit]
- Memon, I.A.; Sawa, Y.; Fukushima, N.; Matsumiya, G.; Miyagawa, S.; Taketani, S.; Sakakida, S.K.; Kondoh, H.; Aleshin, A.N.; Shimizu, T.; et al. Repair of impaired myocardium by means of implantation of engineered autologous myoblast sheets. J. Thorac. Cardiovasc. Surg. 2005, 130, 1333–1341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Yamato, M.; Nishida, K.; Hayashida, Y.; Shimizu, T.; Kikuchi, A.; Tano, Y.; Okano, T. Corneal epithelial stem cell delivery using cell sheet engineering: Not lost in transplantation. J. Drug Target 2006, 14, 471–482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Tu, Y.K.; Tang, Y.B.; Cheng, N.C. Stemness and transdifferentiation of adipose-derived stem cells using l-ascorbic acid 2-phosphate-induced cell sheet formation. Biomaterials 2014, 35, 3516–3526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Q.; Wang, Z.; Huang, Y.; Bi, X.; Zhou, H.; Lin, M.; Yu, Z.; Wang, Y.; Ni, N.; Sun, J.; et al. Characterization of human ethmoid sinus mucosa derived mesenchymal stem cells (hesmscs) and the application of hesmscs cell sheets in bone regeneration. Biomaterials 2015, 66, 67–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burastero, G.; Scarfi, S.; Ferraris, C.; Fresia, C.; Sessarego, N.; Fruscione, F.; Monetti, F.; Scarfo, F.; Schupbach, P.; Podesta, M.; et al. The association of human mesenchymal stem cells with bmp-7 improves bone regeneration of critical-size segmental bone defects in athymic rats. Bone 2010, 47, 117–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dimitriou, R.; Jones, E.; McGonagle, D.; Giannoudis, P.V. Bone regeneration: Current concepts and future directions. BMC Med. 2011, 9, 66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pensak, M.; Hong, S.; Dukas, A.; Tinsley, B.; Drissi, H.; Tang, A.; Cote, M.; Sugiyama, O.; Lichtler, A.; Rowe, D.; et al. The role of transduced bone marrow cells overexpressing bmp-2 in healing critical-sized defects in a mouse femur. Gene Ther. 2015, 22, 467–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, G.; Deng, C.; Li, Y.P. Tgf-beta and bmp signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 2012, 8, 272–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanhatupa, S.; Ojansivu, M.; Autio, R.; Juntunen, M.; Miettinen, S. Bone morphogenetic protein-2 induces donor-dependent osteogenic and adipogenic differentiation in human adipose stem cells. Stem Cells Transl. Med. 2015, 4, 1391–1402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, M.; Chen, G.; Li, Y.P. Tgf-beta and bmp signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone Res. 2016, 4, 16009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katz, J.M.; Nataraj, C.; Jaw, R.; Deigl, E.; Bursac, P. Demineralized bone matrix as an osteoinductive biomaterial and in vitro predictors of its biological potential. J. Biomed. Mater. Res. B Appl. Biomater. 2009, 89, 127–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, S.; Gao, Y.; Huang, X.; Ling, J.; Liu, Z.; Xiao, Y. A comparative study of the proliferation and osteogenic differentiation of human periodontal ligament cells cultured on beta-tcp ceramics and demineralized bone matrix with or without osteogenic inducers in vitro. Int. J. Mol. Med. 2015, 35, 1341–1346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakamura, A.; Akahane, M.; Shigematsu, H.; Tadokoro, M.; Morita, Y.; Ohgushi, H.; Dohi, Y.; Imamura, T.; Tanaka, Y. Cell sheet transplantation of cultured mesenchymal stem cells enhances bone formation in a rat nonunion model. Bone 2010, 46, 418–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- National Institutes of Health and Recombinant DNA Advisory Committee. Assessment of adenoviral vector safety and toxicity: Report of the national institutes of health recombinant DNA advisory committee. Hum. Gene Ther. 2002, 13, 3–13. [Google Scholar]
- Milone, M.C.; O’Doherty, U. Clinical use of lentiviral vectors. Leukemia 2018, 32, 1529–1541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trono, D. Lentiviral vectors: Turning a deadly foe into a therapeutic agent. Gene Ther. 2000, 7, 20–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zufferey, R.; Dull, T.; Mandel, R.J.; Bukovsky, A.; Quiroz, D.; Naldini, L.; Trono, D. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J. Virol. 1998, 72, 9873–9880. [Google Scholar] [PubMed]
- Ryu, H.H.; Lim, J.H.; Byeon, Y.E.; Park, J.R.; Seo, M.S.; Lee, Y.W.; Kim, W.H.; Kang, K.S.; Kweon, O.K. Functional recovery and neural differentiation after transplantation of allogenic adipose-derived stem cells in a canine model of acute spinal cord injury. J. Vet. Sci. 2009, 10, 273–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Arinzeh, T.L.; Peter, S.J.; Archambault, M.P.; van den Bos, C.; Gordon, S.; Kraus, K.; Smith, A.; Kadiyala, S. Allogeneic mesenchymal stem cells regenerate bone in a critical-sized canine segmental defect. J. Bone Joint Surg. Am. 2003, 85, 1927–1935. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bruder, S.P.; Kraus, K.H.; Goldberg, V.M.; Kadiyala, S. The effect of implants loaded with autologous mesenchymal stem cells on the healing of canine segmental bone defects. J. Bone Joint Surg. Am. 1998, 80, 985–996. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Target Gene | Gene Bank Access Number | Primers Sequence (5′–3’) | bp | |
|---|---|---|---|---|
| RUNX2 | XM_022425793.1 | Forward | TGTCATGGCGGGTAACGAT | 107 |
| Reverse | TCCGGCCCACAAATCTCA | |||
| ALP | AF540075.1 | Forward | TCCGAGATGGTGGAAATAGC | 272 |
| Reverse | GGGCCAGACCAAAGATAGAG | |||
| Osteopontin | DQ195101.1 | Forward | GATGATGGAGACGATGTGGATA | 116 |
| Reverse | TGGAATGTCAGTGGGAAAATC | |||
| Osteocalcin | XM_014115322.2 | Forward | CTGGTCCAGCAGATGCAAAG | 207 |
| Reverse | GGTCAGCCAGCTCGTCACAGTT | |||
| BMP-7 | NM_001197052.1 | Forward | TCGTGGAGCATGACAAAGAG | 135 |
| Reverse | GCTCCCGAATGTAGTCCTTG | |||
| TGF-β | NM_001003309.1 | Forward | CTCAGTGCCCACTGTTCCTG | 215 |
| Reverse | TCCGTGGAGCTGAAGCAGTA | |||
| VEGF | NM_001003175.2 | Forward | CTATGGCAGGAGGAGAGCAC | 288 |
| Reverse | GCTGCAGGAAACTCATCTCC | |||
| PDGFB | NM_001003383.1 | Forward | CCGAGGAGCTCTACGAGATG | 150 |
| Reverse | AACTCTCCAGCTCGTCTCCA | |||
| GAPDH | NM_001003142.2 | Forward | CATTGCCCTCAATGACCACT | 105 |
| Reverse | TCCTTGGAGGCCATGTAGAC | |||
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.; Kang, B.-J.; Kim, W.H.; Yun, H.-s.; Kweon, O.-k. Evaluation of Mesenchymal Stem Cell Sheets Overexpressing BMP-7 in Canine Critical-Sized Bone Defects. Int. J. Mol. Sci. 2018, 19, 2073. https://doi.org/10.3390/ijms19072073
Kim Y, Kang B-J, Kim WH, Yun H-s, Kweon O-k. Evaluation of Mesenchymal Stem Cell Sheets Overexpressing BMP-7 in Canine Critical-Sized Bone Defects. International Journal of Molecular Sciences. 2018; 19(7):2073. https://doi.org/10.3390/ijms19072073
Chicago/Turabian StyleKim, Yongsun, Byung-Jae Kang, Wan Hee Kim, Hui-suk Yun, and Oh-kyeong Kweon. 2018. "Evaluation of Mesenchymal Stem Cell Sheets Overexpressing BMP-7 in Canine Critical-Sized Bone Defects" International Journal of Molecular Sciences 19, no. 7: 2073. https://doi.org/10.3390/ijms19072073
APA StyleKim, Y., Kang, B.-J., Kim, W. H., Yun, H.-s., & Kweon, O.-k. (2018). Evaluation of Mesenchymal Stem Cell Sheets Overexpressing BMP-7 in Canine Critical-Sized Bone Defects. International Journal of Molecular Sciences, 19(7), 2073. https://doi.org/10.3390/ijms19072073

