Evaluation of Potential Reference Genes for Relative Quantification by RT-qPCR in Different Porcine Tissues Derived from Feeding Studies
Abstract
:1. Introduction
2. Results and Discussion
2.1. RNA Quality and Integrity
2.2. Gene Expression Results
3. Experimental Section
3.1. Animals and Tissues
3.2. One Step RT-qPCR Methods
3.3. Data Evaluation
4. Conclusions
References
- EFSA. Opinion of the Scientific Panel on additives and products or substances used in animal feed (FEEDAP) on the use of iodine in feedingstuffs. EFSA J 2005, 3, 1–42. [Google Scholar]
- Schone, F; Zimmermann, C; Quanz, G; Richter, G; Leiterer, M. A high dietary iodine increases thyroid iodine stores and iodine concentration in blood serum but has little effect on muscle iodine content in pigs. Meat Sci 2006, 72, 365–372. [Google Scholar]
- Wagner, VWW; Swoboda, S; Ettle, T. Effects of varying dietary iodine supplementation as iodide or iodate on zootechnical performance, carcass quality and iodine concentrations in tissues of fattening pigs. Proc. Soc. Nutr. Physiol 2008, 17, 59. [Google Scholar]
- Hibbeler, S; Scharsack, JP; Becker, S. Housekeeping genes for quantitative expression studies in the three-spined stickleback Gasterosteus aculeatus. BMC Mol. Biol 2008, 9, 18. [Google Scholar]
- Pfaffl, MW; Tichopad, A; Prgomet, C; Neuvians, TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett 2004, 26, 509–515. [Google Scholar]
- Brunner, AM; Yakovlev, IA; Strauss, SH. Validating internal controls for quantitative plant gene expression studies. BMC Plant Biol 2004, 4, 14. [Google Scholar]
- Aerts, JL; Gonzales, MI; Topalian, SL. Selection of appropriate control genes to assess expression of tumor antigens using real-time RT-PCR. Biotechniques 2004, 36, 84–91. [Google Scholar]
- Zhang, QJ; Chadderton, A; Clark, RL; Augustine-Rauch, KA. Selection of normalizer genes in conducting relative gene expression analysis of embryos. Birth Defects Res. A Clin. Mol. Teratol 2003, 67, 533–544. [Google Scholar]
- Loseke, S; Grage-Griebenow, E; Wagner, A; Gehlhar, K; Bufe, A. Differential expression of IFN-alpha subtypes in human PBMC: Evaluation of novel real-time PCR assays. J. Immunol. Methods 2003, 276, 207–222. [Google Scholar]
- Kim, BR; Nam, HY; Kim, SU; Kim, SI; Chang, YJ. Normalization of reverse transcription quantitative-PCR with housekeeping genes in rice. Biotechnol. Lett 2003, 25, 1869–1872. [Google Scholar]
- Sturzenbaum, SR; Kille, P. Control genes in quantitative molecular biological techniques: the variability of invariance. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol 2001, 130, 281–289. [Google Scholar]
- Bustin, SA. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol 2002, 29, 23–39. [Google Scholar]
- Matrisian, LM; Glaichenhaus, N; Gesnel, MC; Breathnach, R. Epidermal growth factor and oncogenes induce transcription of the same cellular mRNA in rat fibroblasts. EMBO J 1985, 4, 1435–1440. [Google Scholar]
- Iovanna, JL; Dusetti, N; Cadenas, B; Calvo, EL. Changes in growth and pancreatic mRNA concentrations during postnatal development of rat pancreas. Pancreas 1990, 5, 421–426. [Google Scholar]
- Kanayama, S; Liddle, RA. Influence of food deprivation on intestinal cholecystokinin and somatostatin. Gastroenterology 1991, 100, 909–915. [Google Scholar]
- Goldsworthy, SM; Goldsworthy, TL; Sprankle, CS; Butterworth, BE. Variation in expression of genes used for normalization of Northern blots after induction of cell proliferation. Cell Prolif 1993, 26, 511–518. [Google Scholar]
- Moshier, JA; Cornell, T; Majumdar, AP. Expression of protease genes in the gastric mucosa during aging. Exp. Gerontol 1993, 28, 249–258. [Google Scholar]
- Hodin, RA; Chamberlain, SM; Meng, S. Pattern of rat intestinal brush-border enzyme gene expression changes with epithelial growth state. Am. J. Physiol 1995, 269, C385–C391. [Google Scholar]
- Yamada, HCD; Monstein, HJ; Hakanson, R. Effects of fasting on the expression of gastrin, cholecystokinin, and somatostatin genes and of various housekeeping genes in the pancreas and upper digestive tract of rats. Biochem. Biophys. Res. Commun 1997, 231, 835–838. [Google Scholar]
- Foss, DL; Baarsch, MJ; Murtaugh, MP. Regulation of hypoxanthine phosphoribosyltransferase, glyceraldehyde-3-phosphate dehydrogenase and beta-actin mRNA expression in porcine immune cells and tissues. Anim. Biotechnol 1998, 9, 67–78. [Google Scholar]
- Bustin, SA; Benes, V; Garson, JA; Hellemans, J; Huggett, J; Kubista, M; Mueller, R; Nolan, T; Pfaffl, MW; Shipley, GL; Vandesompele, J; Wittwer, CT. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem 2009, 55, 611–622. [Google Scholar]
- Vandesompele, J; de Preter, K; Pattyn, F; Poppe, B; van Roy, N; de Paepe, A; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002, 3. research0034:1–research0034:11. [Google Scholar]
- Garcia-Crespo, D; Juste, RA; Hurtado, A. Selection of ovine housekeeping genes for normalisation by real-time RT-PCR; analysis of PrP gene expression and genetic susceptibility to scrapie. BMC Vet. Res 2005, 1, 3. [Google Scholar]
- Nygard, AB; Jorgensen, CB; Cirera, S; Fredholm, M. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol 2007, 8, 67. [Google Scholar]
- Skovgaard, K; Mortensen, S; Poulsen, KT; Angen, O; Heegaard, PM. Validation of putative reference genes for qRT-PCR normalization in tissues and blood from pigs infected with Actinobacillus pleuropneumoniae. Vet. Immunol. Immunopathol 2007, 118, 140–146. [Google Scholar]
- Svobodova, K; Bilek, K; Knoll, A. Verification of reference genes for relative quantification of gene expression by real-time reverse transcription PCR in the pig. J. Appl. Genet 2008, 49, 263–265. [Google Scholar]
- Bustin, SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol 2000, 25, 169–193. [Google Scholar]
- Schmittgen, TD; Zakrajsek, BA; Mills, AG; Gorn, V; Singer, MJ; Reed, MW. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal. Biochem 2000, 285, 194–204. [Google Scholar]
- Fleige, S; Pfaffl, MW. RNA integrity and the effect on the real-time qRT-PCR performance. Mol. Asp. Med 2006, 27, 126–139. [Google Scholar]
- Fleige, S; Preissinger, W; Meyer, HH; Pfaffl, MW. The immunomodulatory effect of lactulose on Enterococcus faecium fed preruminant calves. J. Anim. Sci 2009, 87, 1731–1738. [Google Scholar]
- Schedle, K; Pfaffl, MW; Plitzner, C; Meyer, HH; Windisch, W. Effect of insoluble fibre on intestinal morphology and mRNA expression pattern of inflammatory, cell cycle and growth marker genes in a piglet model. Arch. Anim. Nutr 2008, 62, 427–438. [Google Scholar]
- Pfaffl, MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001, 29, e45. [Google Scholar]
- Andersen, CL; Jensen, JL; Orntoft, TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004, 64, 5245–5250. [Google Scholar]
Liver | Kidney | Thyroid | Abdominal Fat | |||||
---|---|---|---|---|---|---|---|---|
Ranking Order | Gene Name | Average M value | Gene Name | Average M value | Gene Name | Average M value | Gene Name | Average M value |
1 | GAPDH | 0.846 | Ubiquitin | 0.760 | 18S rRNA | 0.948 | Beta Actin | 0.764 |
2 | Ubiquitin | 0.876 | Histone H3 | 0.820 | Ubiquitin | 0.975 | Ubiquitin | 0.894 |
3 | 18S rRNA | 1.040 | Beta Actin | 0.835 | Histone H3 | 0988 | 18S rRNA | 0.950 |
4 | Beta-actin | 1.071 | GAPDH | 0.860 | Beta Actin | 1.072 | GAPDH | 0.990 |
5 | Histone H3 | 1.115 | 18S rRNA | 0.971 | GAPDH | 1.536 | Histone H3 | 1.051 |
Liver | Kidney | Thyroid | Abdominal Fat | |||||
---|---|---|---|---|---|---|---|---|
Ranking Order | Gene Name | Stability Value * | Gene Name | Stability Value * | Gene Name | Stability Value * | Gene Name | Stability Value* |
1 | GAPDH | 0.258 (±0.082) | Ubiquitin | 0.291 (±0.071) | 18S rRNA | 0.281 (±0.096) | Beta Actin | 0.133 (±0.101) |
2 | Ubiquitin | 0.318 (±0.081) | Histone H3 | 0.391 (±0.077) | Ubiquitin | 0.368 (±0.095) | Ubiquitin | 0.407 (±0.081) |
3 | 18S rRNA | 0.569 (±0.099) | Beta Actin | 0.396 (±0.078) | Histone H3 | 0.381 (±0.096) | 18S rRNA | 0.491 (±0.088) |
4 | Beta-actin | 0.584 (±0.100) | GAPDH | 0.425 (±0.080) | Beta Actin | 0.534 (±0.106) | GAPDH | 0.538 (±0.093) |
5 | Histone H3 | 0.627 (±0.105) | 18S rRNA | 0.557 (±0.094) | GAPDH | 0.989 (±0.159) | Histone H3 | 0.601 (±0.100) |
Gene | Accession No. | Sequences[5′→3′] | TM | Product length [bp] | |
---|---|---|---|---|---|
GAPDH sus | AF017079 | for | gccatcactgccacccagaa | 60 °C | 153 |
rev | gccagtgagcttcccgttga | ||||
Ubiquitin sus | U72496 | for | accctgacgggcaagaccat | 60 °C | 143 |
rev | cggccatcctccagctgttt | ||||
Histone H3 sus | NM_213930 | for | actggctacaaaagccgctc | 60 °C | 232 |
rev | acttgcctcctgcaaagcac | ||||
Beta-actin bov | AY141970 | for | aactccatcatgaagtgtgacg * | 60 °C | 229 |
rev | gatccacatctgctggaagg | ||||
18S rRNA sus | DQ437859 | for | tggagcgatttgtctggtta | 60 °C | 200 |
rev | acgctgagccagtcagtgta |
© 2011 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Li, Q.; Domig, K.J.; Ettle, T.; Windisch, W.; Mair, C.; Schedle, K. Evaluation of Potential Reference Genes for Relative Quantification by RT-qPCR in Different Porcine Tissues Derived from Feeding Studies. Int. J. Mol. Sci. 2011, 12, 1727-1734. https://doi.org/10.3390/ijms12031727
Li Q, Domig KJ, Ettle T, Windisch W, Mair C, Schedle K. Evaluation of Potential Reference Genes for Relative Quantification by RT-qPCR in Different Porcine Tissues Derived from Feeding Studies. International Journal of Molecular Sciences. 2011; 12(3):1727-1734. https://doi.org/10.3390/ijms12031727
Chicago/Turabian StyleLi, Qimeng, Konrad Johann Domig, Thomas Ettle, Wilhelm Windisch, Christiane Mair, and Karl Schedle. 2011. "Evaluation of Potential Reference Genes for Relative Quantification by RT-qPCR in Different Porcine Tissues Derived from Feeding Studies" International Journal of Molecular Sciences 12, no. 3: 1727-1734. https://doi.org/10.3390/ijms12031727
APA StyleLi, Q., Domig, K. J., Ettle, T., Windisch, W., Mair, C., & Schedle, K. (2011). Evaluation of Potential Reference Genes for Relative Quantification by RT-qPCR in Different Porcine Tissues Derived from Feeding Studies. International Journal of Molecular Sciences, 12(3), 1727-1734. https://doi.org/10.3390/ijms12031727