Expression Patterns of Glutathione Transferase Gene (GstI) in Maize Seedlings Under Juglone-Induced Oxidative Stress
Abstract
:1. Introduction
2. Results and Discussion
2.1. The Impact of Juglone Treatments on Seed Germination and Post-Germinative Growth of Maize
2.2. Expression of GstI Gene in Juglone-Stressed Maize Seedlings
3. Experimental Section
3.1. Reagents
3.2. Plant Material and Treatment Conditions
3.3. Total RNA Isolation and Quantification
3.4. cDNA Synthesis
3.5. Gene Expression Analysis
3.6. Statistical Analysis
4. Conclusions
Acknowledgments
References
- Cosmulescu, S.; Trandafir, I.; Achim, G.; Baciu, A. Juglone content in leaf and green husk of five walnut (Juglans regia L.) cultivars. Not. Bot. Hort. Agrobot. Cluj 2011, 39, 237–240. [Google Scholar]
- Jakopič, J.R.; Veberič, R.; Štampar, F. Extraction of phenolic compounds from green walnut fruits in different solvents. Acta Agric. Slov 2009, 93, 11–15. [Google Scholar]
- Thakur, A.; Cahalan, C. Geographical variation of Juglans regia L. in juglone content: rapid analysis using micro-plate reader. Curr. Sci 2011, 100, 1483–1485. [Google Scholar]
- Bertin, C.; Yang, X.; Weston, L.A. The role of root exudates and allelochemicals in the rhizosphere. Plant Soil 2003, 256, 67–83. [Google Scholar]
- Duroux, L.; Delmotte, F.M.; Lancelin, J.M.; Kéravis, G.; Jay-Allemand, C. Insight into naphthoquinone metabolism: beta-glucosidase-catalysed hydrolysis of hydrojuglone beta-d-glucopyranoside. Biochem. J 1998, 333, 275–283. [Google Scholar]
- Böhm, P.A.F.; Zanardo, F.M.L.; Ferrarese, M.L.L.; Ferrarese-Filho, O. Peroxidase activity and lignification in soybean root growth-inhibition by juglone. Biol. Plant 2006, 50, 315–317. [Google Scholar]
- Böhm, P.A.F.; Böhm, F.M.L.Z.; Ferrarese, M.L.L.; Salvador, V.H.; Soares, A.R.; Ferrarese-Filho, O. Effects of juglone on soybean root growth and induction of lignification. Allelopath. J 2010, 25, 465–474. [Google Scholar]
- Kocaçalişkan, I.; Turan, E.; Terzi, I. Juglone effects on seedling growth in intact and coatless seeds of muskmelon. Afr. J. Biotechnol 2008, 7, 4446–4449. [Google Scholar]
- Terzi, I. Allelopathic effects of juglone and decomposed walnut leaf juice on muskmelon and cucumber seed germination and seedling growth. Afr. J. Biotechnol 2008, 7, 1870–1874. [Google Scholar]
- Terzi, I.; Kocaçalişkan, I. Alleviation of juglone stress by plant growth regulators in germination of cress seeds. Sci. Res. Essays 2009, 4, 436–439. [Google Scholar]
- Hernández-Muñoz, L.S.; Gómez, M.; González, F.J.; González, I.; Frontana, C. Towards a molecular-level understanding of the reactivity differences for radical anions of juglone and plumbagin: An electrochemical and spectroelectrochemical approach. Org. Biomol. Chem 2009, 7, 1896–1903. [Google Scholar]
- Kot, M.; Karcz, W.; Zaborska, W. 5-Hydroxy-1,4-naphthoquinone (juglone) and 2-hydroxy-1,4- naphthoquinone (lawsone) influence on jack bean urease activity: Elucidation of the difference in inhibition activity. Bioorg. Chem 2010, 38, 132–137. [Google Scholar]
- Terzi, I.; Kocaçalişkan, I.; Benlioğlu, O.; Solak, K. Effects of juglone on growth cucumber seedlings with respect to physiological and anatomical parameters. Acta Physiol. Plant 2003, 25, 353–356. [Google Scholar]
- Hejl, A.M.; Koster, K.L. Juglone disrupts root plasma membrane H+-ATPase activity and impairs water uptake, root respiration, and growth in soybean (Glycine max) and corn (Zea mays). J. Chem. Ecol 2004, 30, 453–471. [Google Scholar]
- Jose, S.; Gillespie, A.R. Allelopathy in black walnut (Juglans nigra L.) alley cropping. II. Effects of juglone on hydroponically grown corn (Zea mays L.) and soybean (Glycine max L. Merr.) growth and physiology. Plant Soil 1998, 203, 199–206. [Google Scholar]
- Kocaçalişkan, I.; Ceylan, M.; Terzi, I. Effects of juglone on seedling growth in intact and coatless seeds of cucumber (Cucumis sativus cv. Beith Alpha). Sci. Res. Essays 2009, 4, 039–041. [Google Scholar]
- El Hadrami, A.; Kone, D.; Lepoivre, P. Effect of juglone on active oxygen species and antioxidant enzymes in susceptible and partially resistant banana cultivars to black leaf streak disease. Eur. J. Plant Pathol 2005, 113, 241–254. [Google Scholar]
- Murakami, K.; Haneda, M.; Iwata, S.; Yoshino, M. Effect of hydroxy substituent on the prooxidant action of naphthoquinone compounds. Toxicol. In Vitro 2010, 24, 905–909. [Google Scholar]
- Chobot, V. Simultaneous detection of pro- and antioxidative effects in the variants of the deoxyribose degradation assay. J. Agric. Food Chem 2010, 58, 2088–2094. [Google Scholar]
- Kong, Y.H.; Zhang, L.; Yang, Z.Y.; Han, C.; Hu, L.H.; Jiang, H.L.; Shen, X. Natural product juglone targets three key enzymes from Helicobacter pylori: Inhibition assay with crystal structure characterization. Acta Pharmacol. Sin 2008, 29, 870–876. [Google Scholar]
- Yang, D.; Li, S.; Li, S.; Li, J.; Sun, M.; Jin, Y. Effect of juglone from Juglans mandshurica bark on the activity of wood decay fungi. For. Prod. J 2009, 59, 79–82. [Google Scholar]
- Aithal, B.K.; Sunil Kumar, M.R.; Rao, B.N.; Upadhya, R.; Prabhu, V.; Shavi, G.; Arumugam, K.; Sajankila, S.P.; Udupa, N.; Satyamoorthy, K.; Satish Rao, B.S. Evaluation of pharmacokinetic, biodistribution, pharmacodynamic, and toxicity profile of free juglone and its sterically stabilized liposomes. J. Pharm. Sci 2011, 100, 3517–3528. [Google Scholar]
- Ji, Y.B.; Qu, Z.Y.; Zou, X. Juglone-induced apoptosis in human gastric cancer SGC-7901 cells via the mitochondrial pathway. Exp. Toxicol. Pathol 2011, 63, 69–78. [Google Scholar]
- Mathur, R.; Chandna, S.; Kapoor, N.P.; Dwarakanath, S.B. Peptidyl prolyl psomerase, Pin1 is a potential target for enhancing the therapeutic efficacy of etoposide. Curr. Cancer Drug Targets 2011, 11, 380–392. [Google Scholar]
- Dalton, D.A.; Boniface, C.; Turner, Z.; Lindahl, A.; Kim, H.J.; Jelinek, L.; Govindarajulu, M.; Finger, R.E.; Taylor, C.G. Physiological roles of glutathione S-transferases in soybean root nodules. Plant Physiol 2009, 150, 521–530. [Google Scholar]
- Halliwell, B. Reactive species and antioxidants. Redox biology is a fundamental theme of aerobic life. Plant Physiol 2006, 141, 312–322. [Google Scholar]
- Mylona, P.V.; Polidoros, A.N.; Scandalios, J.G. Antioxidant gene responses to ROS-generating xenobiotics in developing and germinated scutella of maize. J. Exp. Bot 2007, 58, 1301–1312. [Google Scholar]
- Akbulut, M.; Cakir, S. The effects of Se phytotoxicity on the antioxidant systems of leaf tissues in barley (Hordeum vulgare L.) seedlings. Plant Physiol. Biochem 2010, 48, 160–166. [Google Scholar]
- Axarli, I.; Dhavala, P.; Papageorgiou, A.C.; Labrou, N.E. Crystal structure of Glycine max glutathione transferase in complex with glutathione: investigation of the mechanism operating by the Tau class glutathione transferases. Biochem. J 2009, 422, 247–256. [Google Scholar]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem 2010, 48, 909–930. [Google Scholar]
- Chronopoulou, E.G.; Labrou, N.E. Glutathione transferases: Emerging multidisciplinary tools in red and green biotechnology. Recent Pat. Biotechnol 2009, 3, 211–223. [Google Scholar]
- Hu, T.; Qv, X.; Xiao, G.; Huang, X. Enhanced tolerance to herbicide of rice plants by over-expression of a glutathione S-transferase. Mol. Breed 2009, 24, 409–418. [Google Scholar]
- Yu, T.; Li, Y.S.; Chen, X.F.; Hu, J.; Chang, X.; Zhu, Y.G. Transgenic tobacco plants overexpressing cotton glutathione S-transferase (GST) show enhanced resistance to methyl viologen. J. Plant Physiol 2003, 160, 1305–1311. [Google Scholar]
- Bogatek, R.; Gniazdowska, A. ROS and phytohormones in plant-plant allelopathic interaction. Plant Signal Behav 2007, 2, 317–318. [Google Scholar]
- Cruz-Ortega, R.; Lara-Núñez, A.; Anaya, A.L. Allelochemical stress can trigger oxidative damage in receptor plants. Plant Signal Behav 2007, 2, 269–270. [Google Scholar]
- Ding, J.; Sun, Y.; Xiao, C.L.; Shi, K.; Zhou, Y.H.; Yu, J.Q. Physiological basis of different allelopathic reactions of cucumber and figleaf gourd plants to cinnamic acid. J. Exp. Bot 2007, 58, 3765–3773. [Google Scholar]
- Oracz, K.; Bailly, C.; Gniazdowska, A.; Come, D.; Corbineau, F.; Bogatek, R. Induction of oxidative stress by sunflower phytotoxins in germinating mustard seeds. J. Chem. Ecol 2007, 33, 251–264. [Google Scholar]
- Ercisli, S.; Esitken, A.; Turkkal, C.; Orhan, E. The allelopathic effects of juglone and walnut leaf extracts on yeld, growth, chemical and PNE compositions of strawberry cv. Fern. Plant Soil Environ 2005, 51, 283–287. [Google Scholar]
- Matok, H. Effect of Selected Metabolites of Walnut (Juglans regia L.) on Plant Germination. Ph.D. Thesis (in Polish), University of Podlasie, Siedlce, Poland, 2010. [Google Scholar]
- Banerjee, S.; Goswami, R. GST profile expression study in some selected plants: In silico approach. Mol. Cell. Biochem 2010, 336, 109–126. [Google Scholar]
- Gajewska, E.; Skłodowska, M. Differential effect of equal copper, cadmium and nickel concentration on biochemical reactions in wheat seedlings. Ecotoxicol. Environ. Saf 2010, 73, 996–1003. [Google Scholar]
- Karavangeli, M.; Labrou, N.E.; Clonis, Y.D.; Tsaftaris, A. Development of transgenic tobacco plants overexpressing maize glutathione S-transferase I for chloroacetanilide herbicides phytoremediation. Biomol. Eng 2005, 22, 121–128. [Google Scholar]
- Sappl, P.G.; Carroll, A.J.; Clifton, R.; Lister, R.; Whelan, J.; Harvey Millar, A.; Singh, K.B. The Arabidopsis glutathione transferase gene family displays complex stress regulation and co-silencing multiple genes results in altered metabolic sensitivity to oxidative stress. Plant J 2009, 58, 53–68. [Google Scholar]
- McGonigle, B.; Keeler, S.J.; Lau, S.M.C.; Koeppe, M.K.; O’Keefe, D.P. A genomics approach to the comprehensive analysis of the glutathione S-transferase gene family in soybean and maize. Plant Physiol 2000, 124, 1105–1120. [Google Scholar]
- Edwards, R.; Dixon, D.P.; Walbot, V. Plant glutathione S-transferases: Enzymes with multiple functions in sickness and in health. Trends Plant Sci 2000, 5, 193–198. [Google Scholar]
- Jiang, L.; Yang, H. Promertyne-induced oxidative stress and impact on antioxidant enzymes in wheat. Ecotoxicol. Environ. Saf 2009, 72, 1687–1693. [Google Scholar]
- Pašková, V.; Hilscherová, K.; Feldmannová, M.; Bláha, L. Toxic effects and oxidative stress in higher plants exposed to policyclic aromatic hydrocarbons and their N-heterocyclic derivatives. Environ. Toxicol. Chem 2006, 25, 3238–3245. [Google Scholar]
- Jain, M.; Ghanashyam, C.; Bhattacharjee, A. Comprehensive expression analysis suggests overlapping and specific roles of rice glutathione S-transferase genes during development and stress responses. BMC Genomics 2010, 11, 1471–2164. [Google Scholar]
- Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. Antioxidants, oxidative damage and oxygen deprivation stress: a review. Ann. Bot 2003, 91, 179–194. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar]
Seed germination (% of the control) | Elongation of primary roots | Elongation of coleoptiles | Seedling weight |
---|---|---|---|
−0.925 ** | −0.960 ** | −0.905 ** | −0.965 ** |
Amplified gene | Type of Primer | Primer Sequence |
---|---|---|
GstI | F | CGGTGACTTGTACCTCTTCGAATC |
R | ATCCACCATTGCTGCCTCC | |
GAPDH | F | AAGCCGGTCACCGTCTTT |
R | CATCTTTGCTTGGGGCAGA |
Amplified gene | TaqMan® Probe Sequence |
---|---|
GstI | 6FAM-TCCCTCAACAGCTCTGGCTTGTTTTT-BBQ |
GAPDH | 6FAM-CTTCACTGACAAGGACAAGGCTGCT-BBQ |
© 2011 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Sytykiewicz, H. Expression Patterns of Glutathione Transferase Gene (GstI) in Maize Seedlings Under Juglone-Induced Oxidative Stress. Int. J. Mol. Sci. 2011, 12, 7982-7995. https://doi.org/10.3390/ijms12117982
Sytykiewicz H. Expression Patterns of Glutathione Transferase Gene (GstI) in Maize Seedlings Under Juglone-Induced Oxidative Stress. International Journal of Molecular Sciences. 2011; 12(11):7982-7995. https://doi.org/10.3390/ijms12117982
Chicago/Turabian StyleSytykiewicz, Hubert. 2011. "Expression Patterns of Glutathione Transferase Gene (GstI) in Maize Seedlings Under Juglone-Induced Oxidative Stress" International Journal of Molecular Sciences 12, no. 11: 7982-7995. https://doi.org/10.3390/ijms12117982
APA StyleSytykiewicz, H. (2011). Expression Patterns of Glutathione Transferase Gene (GstI) in Maize Seedlings Under Juglone-Induced Oxidative Stress. International Journal of Molecular Sciences, 12(11), 7982-7995. https://doi.org/10.3390/ijms12117982