Sechium edule var. nigrum spinosum (Chayote) Increases the mRNA Expression of Genes Encoding Sirtuins in Older Adults with Type 2 Diabetes Mellitus
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Intervention
4.3. Anthropometric and Blood Pressure Measurements
4.4. Biochemical Analysis
4.5. Total Oxidation Status (TOS)
4.6. Total Antioxidant Status (TAS)
4.7. Oxidative Stress Index (OSI)
4.8. Lymphocyte Isolation and RNA Extraction
4.9. Gene Expression Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mendoza-Núñez, V.M.; Martínez-Maldonado, M.L.; Vivaldo-Martínez, M. What is the onset age of human aging and old age? Int. J. Gerontol. 2016, 10, 56. [Google Scholar] [CrossRef]
- WHO. Ageing and Health. Available online: https://www.who.int/news-room/fact-sheets/detail/ageing-and-health (accessed on 15 November 2025).
- López-Otín, C.; Blasco, M.A.; Partridge, L.; Serrano, M.; Kroemer, G. Hallmarks of aging: An expanding universe. Cell 2023, 186, 243–278. [Google Scholar] [CrossRef] [PubMed]
- López-Otín, C.; Kroemer, G. Hallmarks of aging: Integrating molecular and social determinants. Geromedicine 2025, 1, 202507. [Google Scholar] [CrossRef]
- WHO. Diabetes. Available online: https://www.who.int/news-room/fact-sheets/detail/diabetes (accessed on 15 August 2025).
- Yaribeygi, H.; Sathyapalan, T.; Atkin, S.L.; Sahebkar, A. Molecular mechanisms linking oxidative stress and Diabetes Mellitus. Oxid. Med. Cell. Longev. 2020, 2020, 8609213. [Google Scholar] [CrossRef]
- Caturano, A.; D’Angelo, M.; Mormone, A.; Russo, V.; Mollica, M.P.; Salvatore, T.; Galiero, R.; Rinaldi, L.; Vetrano, E.; Marfella, R.; et al. Oxidative stress in Type 2 Diabetes: Impacts from pathogenesis to lifestyle modifications. Curr. Issues Mol. Biol. 2023, 45, 6651–6666. [Google Scholar] [CrossRef] [PubMed]
- Yaribeygi, H.; Mohammadi, M.T.; Sahebkar, A. Crocin potentiates antioxidant defense system and improves oxidative damage in liver tissue in diabetic rats. Biomed. Pharmacother. 2018, 98, 333–337. [Google Scholar] [CrossRef]
- Bellary, S.; Kyrou, I.; Brown, J.E. Type 2 diabetes mellitus in older adults: Clinical considerations and management. Nat. Rev. Endocrinol. 2021, 17, 534–548. [Google Scholar] [CrossRef]
- Kitada, M.; Ogura, Y.; Monno, I.; Koya, D. Sirtuins and Type 2 Diabetes: Role in inflammation, oxidative stress, and mitochondrial function. Front. Endocrinol. 2019, 10, 187. [Google Scholar] [CrossRef]
- Lingappa, N.; Mayrovitz, H.N. Role of sirtuins in Diabetes and age-related processes. Cureus 2022, 14, e28774. [Google Scholar] [CrossRef]
- NLM. Sirtuins. Available online: https://www.ncbi.nlm.nih.gov/mesh/68037761 (accessed on 15 November 2025).
- Abdelhaleem, I.A.; Brakat, A.M.; Adayel, H.M.; Asla, M.M.; Rizk, M.A.; Aboalfetoh, A.Y. The effects of resveratrol on glycemic control and cardiometabolic parameters in patients with T2DM: A systematic review and meta-analysis. Med. Clin. 2022, 158, 576–585. [Google Scholar] [CrossRef]
- Cao, M.M.; Lu, X.; Liu, G.D.; Su, Y.; Li, Y.B.; Zhou, J. Resveratrol attenuates type 2 diabetes mellitus by mediating mitochondrial biogenesis and lipid metabolism via Sirtuin type 1. Exp. Ther. Med. 2018, 15, 576–584. [Google Scholar] [CrossRef] [PubMed]
- Vieira, E.F.; Souza, S.; Moreira, M.M.; Cruz, R.; Silva, A.B.D.; Casal, S.; Delerue-Matos, C. Valorization of phenolic and carotenoid compounds of Sechium edule (Jacq. Swartz) leaves: Comparison between conventional, ultrasound- and microwave-assisted extraction approaches. Molecules 2022, 27, 7193. [Google Scholar] [CrossRef] [PubMed]
- Avendaño, A.C.H.; Cadena, I.J.; Arévalo, G.M.L.; Campos, R.E.; Cisneros, S.V.M.; Aguirre, M.J.F. Las Variedades del Chayote Mexicano, Recurso Ancestral con Potencial de Comercialización; Grupo Interdisciplinario de Investigación en Sechium edule en México, A.C. (GISeM): Mexico City, Mexico, 2010. [Google Scholar]
- Arista-Ugalde, T.L.; Santiago-Osorio, E.; Monroy-García, A.; Rosado-Pérez, J.; Aguiñiga-Sánchez, I.; Cadena-Iñiguez, J.; Gavia-García, G.; Mendoza-Núñez, V.M. Antioxidant and anti-inflammatory effect of the consumption of powdered concentrate of Sechium edule var. nigrum spinosum in Mexican older adults with metabolic syndrome. Antioxidants 2022, 11, 1076. [Google Scholar] [CrossRef] [PubMed]
- Gavia-García, G.; Hernández-Álvarez, D.; Arista-Ugalde, T.L.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Mendoza-Núñez, V.M.; Rosado-Pérez, J. The supplementation of Sechium edule var. nigrum spinosum (chayote) promotes Nrf2-mediated antioxidant protection in older adults with metabolic syndrome. Nutrients 2023, 15, 4106. [Google Scholar] [CrossRef] [PubMed]
- Patel, S.; Khan, H.; Majumdar, A. Crosstalk between Sirtuins and Nrf2: SIRT1 activators as emerging treatment for diabetic neuropathy. Metab. Brain Dis. 2022, 37, 2181–2195. [Google Scholar] [CrossRef]
- WHO. Classification of Diabetes Mellitus. Available online: https://www.who.int/publications/i/item/classification-of-diabetes-mellitus (accessed on 16 August 2025).
- Galicia-Garcia, U.; Benito-Vicente, A.; Jebari, S.; Larrea-Sebal, A.; Siddiqi, H.; Uribe, K.B.; Ostolaza, H.; Martín, C. Pathophysiology of Type 2 Diabetes Mellitus. Int. J. Mol. Sci. 2020, 21, 6275. [Google Scholar] [CrossRef]
- GBD 2021 Diabetes Collaborators. Global, regional, and national burden of diabetes from 1990 to 2021, with projections of prevalence to 2050: A systematic analysis for the Global Burden of Disease Study 2021. Lancet 2023, 402, 203–234. [Google Scholar] [CrossRef]
- Lombardo-Earl, G.; Roman-Ramos, R.; Zamilpa, A.; Herrera-Ruiz, M.; Rosas-Salgado, G.; Tortoriello, J.; Jiménez-Ferre, E. Extracts and fractions from edible roots of Sechium edule (Jacq.) Sw. with antihypertensive activity. Evid. Based Complement. Alternat. Med. 2014, 2014, 594326. [Google Scholar] [CrossRef]
- Gordon, E.A.; Guppy, L.J.; Nelson, M. The antihypertensive effects of the Jamaican Cho-Cho (Sechium edule). West Indian Med. J. 2000, 49, 27–31. [Google Scholar]
- Rosado-Pérez, J.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Mendoza-Núñez, V.M. Effect of Sechium edule var. nigrum spinosum (Chayote) on oxidative stress and pro-inflammatory markers in older adults with metabolic syndrome: An exploratory study. Antioxidants 2019, 8, 146. [Google Scholar] [CrossRef]
- Agbabiaka, T.; Wider, B.; Watson, L.K.; Goodman, C. Concurrent use of prescription drugs and herbal medicinal products in older adults: A systematic review. Drugs Aging 2017, 34, s40017–s40266. [Google Scholar] [CrossRef] [PubMed]
- Gavia-García, G.; Rosado-Pérez, J.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Mendoza-Núñez, V.M. Effect of Sechium edule var. nigrum spinosum (Chayote) on telomerase levels and antioxidant capacity in older adults with metabolic syndrome. Antioxidants 2020, 9, 634. [Google Scholar] [CrossRef] [PubMed]
- Arista-Ugalde, T.L.; Delgado-Arroyo, S.; Gavia-García, G.; Hernández-Álvarez, D.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Rosado-Pérez, J.; Mendoza-Núñez, V.M. Hypoglycemic effects of Sechium edule (Chayote) in older adults: A systematic review and meta-analysis of clinical and preclinical trials. Foods 2025, 14, 2937. [Google Scholar] [CrossRef] [PubMed]
- Stratton, I.M.; Adler, A.I.; Neil, H.A.W.; Matthews, D.R.; Manley, S.E.; Cull, C.A.; Hadden, D.; Turner, R.C.; Holman, R.R. Association of glycaemia with macrovascular and microvascular complications of type 2 diabetes (UKPDS 35): Prospective observational study. BMJ 2000, 321, 405. [Google Scholar] [CrossRef]
- García-Martínez, B.I.; Ruiz-Ramos, M.; Pedraza-Chaverri, J.; Santiago-Osorio, E.; Mendoza-Núñez, V.M. Effect of resveratrol on markers of oxidative stress and sirtuin 1 in elderly adults with type 2 diabetes. Int. J. Mol. Sci. 2023, 24, 7422. [Google Scholar] [CrossRef]
- Grabowska, W.; Sikora, E.; Bielak-Zmijewska, A. Sirtuins, a promising target in slowing down the ageing process. Biogerontology 2017, 18, 447–476. [Google Scholar] [CrossRef]
- Morris, B.J. Seven sirtuins for seven deadly diseases of ageing. Free Radic. Biol. Med. 2013, 56, 133–171. [Google Scholar] [CrossRef]
- Grabowska, W.; Suszek, M.; Wnuk, M.; Lewinska, A.; Wasiak, E.; Sikora, E.; Bielak-Zmijewska, A. Curcumin elevates sirtuin level but does not postpone in vitro senescence of human cells building the vasculature. Oncotarget 2016, 7, 19201–19213. [Google Scholar] [CrossRef]
- Gillum, M.P.; Kotas, M.E.; Erion, D.M.; Kursawe, R.; Chatterjee, P.; Nead, K.T.; Muise, E.S.; Hsiao, J.J.; Frederick, D.W.; Yonemitsu, S.; et al. Sirt1 regulates adipose tissue inflammation. Diabetes 2011, 60, 3235–3245. [Google Scholar] [CrossRef]
- de Kreutzenberg, S.V.; Ceolotto, G.; Papparella, I.; Bortoluzzi, A.; Semplicini, A.; Dalla, M.C.; Cobelli, C.; Fadini, G.P.; Avogaro, A. Downregulation of the longevity-associated protein sirtuin 1 in insulin resistance and metabolic syndrome: Potential biochemical mechanisms. Diabetes 2010, 59, 1006–1015. [Google Scholar] [CrossRef]
- Li, Y.; Miao, Y.; Feng, Q.; Zhu, W.; Chen, Y.; Kang, Q.; Wang, Z.; Lu, F.; Zhang, Q. Mitochondrial dysfunction and onset of type 2 diabetes along with its complications: A multi-omics Mendelian randomization and colocalization study. Front. Endocrinol. 2024, 15, 1401531. [Google Scholar] [CrossRef]
- Kitada, M.; Takeda, A.; Nagai, T.; Ito, H.; Kanasaki, K.; Koya, D. Dietary restriction ameliorates diabetic nephropathy through anti-inflammatory effects and regulation of the autophagy via restoration of Sirt1 in diabetic Wistar fatty (fa/fa) rats: A model of type 2 diabetes. Exp. Diabetes Res. 2011, 2011, 908185. [Google Scholar] [CrossRef] [PubMed]
- Jung, H.Y.; Lee, D.; Ryu, H.G.; Choi, B.H.; Go, Y.; Lee, N.; Lee, D.; Son, H.G. Myricetin improves endurance capacity and mitochondrial density by activating SIRT1 and PGC-1α. Sci. Rep. 2017, 7, 6237. [Google Scholar] [CrossRef] [PubMed]
- Yuan, B.; Mao, J.; Wang, J.; Luo, S.; Luo, B. Naringenin mitigates cadmium-induced cell death, oxidative stress, mitochondrial dysfunction, and inflammation in KGN cells by regulating the expression of sirtuin-1. Drug Chem. Toxicol. 2024, 47, 445–456. [Google Scholar] [CrossRef] [PubMed]
- Rodgers, J.T.; Lerin, C.; Haas, W.; Gygi, S.P.; Spiegelman, B.M.; Puigserver, P. Nutrient control of glucose homeostasis through a complex of PGC-1 alpha and SIRT1. Nature 2005, 434, 113–118. [Google Scholar] [CrossRef]
- Gureev, A.P.; Krutskikh, E.P. Regulation of the NRF2 transcription factor activity by SIRT1-induced deacetylation: A possible SIRT1–NRF2 feedback loop. Russ. J. Genet. 2025, 61, 133–139. [Google Scholar] [CrossRef]
- Katz, L.S.; Scott, D.K.; Stewart, A.F. SIRT2 puts the brakes on human β cell proliferation: Therapeutic opportunities and next challenges. J. Clin. Investig. 2025, 135, e197142. [Google Scholar] [CrossRef]
- Choubey, S.K.; Prabhu, D.; Nachiappan, M.; Biswal, J.; Jeyakanthan, J. Molecular modeling, dynamics studies and density functional theory approaches to identify potential inhibitors of SIRT4 protein from Homo sapiens: A novel target for the treatment of type 2 diabetes. J. Biomol. Struct. Dyn. 2017, 35, 3316–3329. [Google Scholar] [CrossRef]
- Huynh, F.K.; Hu, X.; Lin, Z.; Johnson, J.D.; Hirschey, M.D. Loss of sirtuin 4 leads to elevated glucose- and leucine-stimulated insulin levels and accelerated age-induced insulin resistance in multiple murine genetic backgrounds. J. Inherit. Metab. Dis. 2018, 41, 59–72. [Google Scholar] [CrossRef]
- Zhang, J.; Xiang, H.; Liu, J.; Chen, Y.; He, R.R.; Liu, B. Mitochondrial Sirtuin 3: New emerging biological function and therapeutic target. Theranostics 2020, 10, 8315–8342. [Google Scholar] [CrossRef]
- Bellizzi, D.; Rose, G.; Cavalcante, P.; Covello, G.; Dato, S.; De Rango, F.; Greco, V.; Maggiolini, M.; Feraco, E.; Mari, V.; et al. A novel VNTR enhancer within the SIRT3 gene, a human homologue of SIR2, is associated with survival at oldest ages. Genomics 2005, 85, 258–263. [Google Scholar] [CrossRef]
- Yu, L.M.; Dong, X.; Xue, X.D.; Zhang, J.; Li, Z.; Wu, H.J.; Yang, Z.L.; Yang, Y.; Wang, H.S. Naringenin improves mitochondrial function and reduces cardiac damage following ischemia-reperfusion injury: The role of the AMPK-SIRT3 signaling pathway. Food Funct. 2019, 10, 2752–2765. [Google Scholar] [CrossRef]
- Li, L.; Zeng, H.; He, X.; Chen, J.X. Sirtuin 3 alleviates diabetic cardiomyopathy by regulating TIGAR and cardiomyocyte metabolism. J. Am. Heart Assoc. 2021, 10, e018913. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Wang, F.; Sun, R.; Chen, X.; Zhang, M.; Xu, Q.; Wang, Y.; Wang, S.; Xiong, Y.; Guan, K.L.; et al. SIRT5 promotes IDH2 desuccinylation and G6PD deglutarylation to enhance cellular antioxidant defense. EMBO Rep. 2016, 17, 811–822. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Yang, Y.; Pang, X.; Shi, J.; Jiang, T.; Zheng, X. Quercetin inhibits DNA damage responses to induce apoptosis via SIRT5/PI3K/AKT pathway in non-small cell lung cancer. Biomed. Pharmacother. 2023, 165, 115071. [Google Scholar] [CrossRef] [PubMed]
- Chang, X.; Zhang, T.; Wang, J.; Liu, Y.; Yan, P.; Meng, Q.; Yin, Y.; Wang, S. SIRT5-related desuccinylation modification contributes to quercetin-induced protection against heart failure and high-glucose-prompted cardiomyocytes injured through regulation of mitochondrial quality surveillance. Oxid. Med. Cell. Longev. 2021, 2021, 5876841. [Google Scholar] [CrossRef]
- You, W.; Zheng, W.; Weiss, S.; Chua, K.; Steegborn, C. Structural basis for the activation and inhibition of Sirtuin 6 by quercetin and its derivatives. Sci. Rep. 2019, 9, 19176. [Google Scholar] [CrossRef]
- Zhang, H.; Zhang, J.; Zhang, H.X. Effect of quercetin on the protein-substrate interactions in SIRT6: Insight from MD simulations. J. Mol. Graph. Model. 2024, 130, 108778. [Google Scholar] [CrossRef]
- Michishita, E.; McCord, R.A.; Berber, E.; Kioi, M.; Padilla-Nash, H.; Damian, M.; Cheung, P.; Kusumoto, R.; Kawahara, T.L.; Barrett, J.C.; et al. SIRT6 is a histone H3 lysine 9 deacetylase that modulates telomeric chromatin. Nature 2008, 452, 492–496. [Google Scholar] [CrossRef]
- Gavia-García, G.; Rosado-Pérez, J.; Arista-Ugalde, T.L.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Mendoza-Núñez, V.M. The consumption of Sechium edule (chayote) has antioxidant effect and prevents telomere attrition in older adults with metabolic syndrome. Redox Rep. 2023, 28, 2207323. [Google Scholar] [CrossRef]
- Rezazadeh, S.; Yang, D.; Tombline, G.; Simon, M.; Regan, S.P.; Seluanov, A.; Gorbunova, V. SIRT6 promotes transcription of a subset of NRF2 targets by mono-ADP-ribosylating BAF170. Nucleic Acids Res. 2019, 47, 7914–7928. [Google Scholar] [CrossRef] [PubMed]
- Kuang, J.; Zhang, Y.; Liu, Q.; Shen, J.; Pu, S.; Cheng, S.; Chen, L.; Li, H.; Wu, T.; Li, R.; et al. Fat-specific Sirt6 ablation sensitizes mice to high-fat diet–induced obesity and insulin resistance by inhibiting lipolysis. Diabetes 2017, 66, 1159–1171. [Google Scholar] [CrossRef] [PubMed]
- Kuang, J.; Chen, L.; Tang, Q.; Zhang, J.; Li, Y.; He, J. The role of Sirt6 in obesity and diabetes. Front. Physiol. 2018, 9, 135. [Google Scholar] [CrossRef] [PubMed]
- Imai, S.; Guarente, L. NAD+ and sirtuins in aging and disease. Trends Cell Biol. 2014, 24, 464–471. [Google Scholar] [CrossRef]
- Vedantham, S.; Thiagarajan, D.; Ananthakrishnan, R.; Wang, L.; Rosario, R.; Zou, Y.S.; Goldberg, I.; Yan, S.F.; Schmidt, A.M.; Ramasamy, R. Aldose reductase drives hyperacetylation of Egr-1 in hyperglycemia and consequent upregulation of proinflammatory and prothrombotic signals. Diabetes 2014, 63, 761–774. [Google Scholar] [CrossRef]
- Kosanam, H.; Thai, K.; Zhang, Y.; Advani, A.; Connelly, K.A.; Diamandis, E.P.; Gilbert, R.E. Diabetes induces lysine acetylation of intermediary metabolism enzymes in the kidney. Diabetes 2014, 63, 2432–2439. [Google Scholar] [CrossRef]
- Perez-Lao, E.J.; Fagerli, E.; Ferrier, F.; Young, J.I.; Perez-Pinzon, M.A. Regulatory dynamics of Nrf2 with sirtuins in the brain: Exploring cellular metabolism, synaptic plasticity, and defense mechanisms. J. Neurochem. 2025, 169, e70193. [Google Scholar] [CrossRef]
- Murillo-Cancho, A.F.; Nievas-Soriano, B.J.; Lozano-Paniagua, D. Miméticos de la restricción energética: Un análisis comparativo de agentes naturales y sintéticos en la modulación de la autofagia. Ars. Pharm. 2025, 66, 385–398. [Google Scholar]
- Cadena-Iñiguez, J.; Ruiz-Posadas, L.M.; Soto-Hernández, M.; Aguirre-Medina, J.F.; Avendaño-Arrazate, C.H.; Arévalo-Galarza, L. Infraspecific variation of Sechium edule (Jacq.) Sw. in the state of Veracruz, Mexico. Genet. Resour. Crop. Evol. 2008, 55, 835–847. [Google Scholar] [CrossRef]
- Nair, A.B.; Jacob, S. A simple practice guide for dose conversion between animals and human. J. Basic Clin. Pharm. 2016, 7, 27–31. [Google Scholar] [CrossRef]
- Aguiñiga-Sánchez, I.; Cadena-Íñiguez, J.; Santiago-Osorio, E.; Gómez-García, G.; Mendoza-Núñez, V.M.; Rosado-Pérez, J.; Ruíz-Ramos, M.; Cisneros-Solano, V.M.; Ledesma-Martínez, E.; Delgado-Bordonave, A.J.; et al. Chemical analyses and in vitro and in vivo toxicity of fruit methanol extract of Sechium edule var. nigrum spinosum. Pharm. Biol. 2017, 55, 1638–1645. [Google Scholar] [CrossRef]
- Al Shoyaib, A.; Archie, S.R.; Karamyan, V.T. Intraperitoneal route of drug administration: Should it be used in experimental animal studies? Pharm. Res. 2019, 37, 12. [Google Scholar] [CrossRef]
- Secretaría de Salud. Toma de Medidas Clínicas y Antropométricas en el Adulto Mayor; Subsecretaría de Prevención y Protección de La Salud: Mexico City, Mexico, 2002. [Google Scholar]
- Secretaría de Salud. Norma Oficial Mexicana NOM-030-SSA-1999. In Para la Prevención, Tratamiento y Control de la Hipertensión Arterial; Secretaría de Salud: Mexico City, Mexico, 1999. [Google Scholar]
- Sánchez-Rodríguez, M.A.; Mendoza-Núñez, V.M. Oxidative stress indexes for diagnosis of health or disease in humans. Oxid. Med. Cell. Longev. 2019, 2019, 4128152. [Google Scholar] [CrossRef]
- Primer-BLAST-NCBI-NIH (Primer-BLAST). Available online: https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 1 October 2024).
- Hazarika, A.; Nongkhlaw, B.; Mukhopadhyay, A. Identification of stable reference genes in peripheral blood mononuclear cells from type 2 diabetes mellitus patients. Sci. Rep. 2023, 13, 486. [Google Scholar] [CrossRef]
- Arista-Ugalde, T.L. Efecto del Consumo de Frutos de Sechium edule Sobre Marcadores de Estrés Oxidativo, Inflamación Crónica y Daño Oxidativo al ADN en Adultos Mayores Con Síndrome Metabólico. Ph.D. Thesis, Universidad Nacional Autónoma de México, México city, Mexico, 2023. [Google Scholar]



| Parameter | PG n = 14 | EG n = 12 | p-Value |
|---|---|---|---|
| Age (years) | 67.1 ± 2.0 | 65.7 ± 4.8 | |
| Weight (kg) | |||
| Baseline | 63.4 ± 2.5 | 69.1 ± 2.6 | |
| Three months | 63.7 ± 2.6 | 69.3 ± 2.7 | 0.16 |
| Six months | 64.4 ± 2.8 | 69.2 ± 2.9 | 0.25 |
| BMI (kg/m2) | |||
| Baseline | 26.0 ± 3.8 | 30.0 ± 1.6 | |
| Three months | 26.3 ± 3.6 | 30.1 ± 2.2 | 0.06 |
| Six months | 26.2 ± 3.6 | 30.1 ± 2.7 | 0.06 |
| Waist circumference (cm) | |||
| Baseline | 95.7 ± 2.1 | 103.4 ± 2.1 | |
| Three months | 95.6 ± 2.3 | 102.6 ± 2.3 | 0.06 |
| Six months | 95.8 ± 2.2 | 101.8 ± 2.2 | 0.07 |
| SBP (mmHg) | |||
| Baseline | 127.7 ± 4.3 | 132.2 ± 4.3 | |
| Three months | 126.7 ± 6.3 | 126.5 ± 6.3 | 0.76 |
| Six months | 127.2 ± 6.3 | 129.4 ± 6.3 | 0.80 |
| DBP (mmHg) | |||
| Baseline | 77.7 ± 2.5 | 82.7 ± 2.5 | |
| Three months | 79.7 ± 3.0 | 73.3 ± 3.0 | 0.15 |
| Six months | 80.0 ± 3.6 | 77.2 ± 3.6 | 0.59 |
| Parameter | PG n = 14 | EG n = 12 | p-Value |
|---|---|---|---|
| Glucose (mg/dL) | |||
| Baseline | 182 ± 48 | 170 ± 42 | |
| Three months | 192 ± 75 | 164 ± 77 | 0.82 |
| Six months | 181 ± 38 | 170 ± 46 | 0.72 |
| Cholesterol (mg/dL) | |||
| Baseline | 196 ± 49 | 183 ± 27 | |
| Three months | 200 ± 53 | 196 ± 18 | 0.86 |
| Six months | 161 ± 47 | 160 ± 45 | 0.99 |
| Triglycerides (mg/dL) | |||
| Baseline | 164 ± 93 | 153 ± 86 | |
| Three months | 163 ± 54 | 151 ± 42 | 0.30 |
| Six months | 169 ± 67 | 139 ± 60 | 0.69 |
| HDL-c (mg/dL) | |||
| Baseline | 47 ± 10 | 43 ± 10 | |
| Three months | 41 ± 8 | 41 ± 9 | 0.63 |
| Six months | 45 ± 10 | 44 ± 10 | 0.57 |
| Uric acid (mg/dL) | |||
| Baseline | 4.84 ± 0.6 | 4.37 ± 0.6 | |
| Three months | 4.03 ± 1.2 | 4.63 ± 0.7 | 0.63 |
| Six months | 4.60 ± 1.5 | 4.87 ± 1.1 | 0.87 |
| Urea (mg/dL) | |||
| Baseline | 32 ± 9.5 | 30 ± 7.8 | |
| Three months | 34 ± 9.0 | 30 ± 4.2 | 0.17 |
| Six months | 31 ± 9.0 | 27 ± 4.3 | 0.28 |
| Albumin (g/dL) | |||
| Baseline | 3.9 ± 0.19 | 3.67 ± 0.14 | |
| Three months | 4.0 ± 0.28 | 3.94 ± 0.15 | 0.21 |
| Six months | 4.1 ± 0.09 | 4.06 ± 0.21 | 0.91 |
| HbA1c (%) | |||
| Baseline | 6.98 ± 0.80 | 8.72 ± 1.47 | |
| Three months | 7.02 ± 0.83 | 9.25 ± 1.30 | 0.45 |
| Six months | 6.86 ± 0.76 | 7.46 ± 1.93 | 0.97 |
| Parameter | PG n = 14 | EG n = 12 | p-Value |
|---|---|---|---|
| TOS (µmol H2O2 Equiv./L) | |||
| Baseline | 5.3 ± 2.3 | 6.4 ± 2.9 | |
| Three months | 4.9 ± 2.9 | 5.9 ± 3.0 | 0.63 |
| Six months | 4.7 ± 3.8 | 3.2 ± 2.1 * | 0.03 |
| TAS (mmol/L) | |||
| Baseline | 1.0 ± 0.3 | 0.9 ± 0.3 | |
| Three months | 1.1 ± 0.1 | 1.0 ± 0.2 | 0.86 |
| Six months | 1.0 ± 0.11 | 1.3 ± 0.2 * | 0.04 |
| OSI | |||
| Baseline | 6.0 ± 3.4 | 6.6 ± 3.3 | |
| Three months | 5.4 ± 3.6 | 4.9 ± 2.1 | 0.07 |
| Six months | 5.1 ± 4.4 | 2.0 ± 1.4 * | 0.01 |
| Gene | Primer Name | Sequence |
|---|---|---|
| SIRT1 | SIRT1-F SIRT1-R | GGGCTGCGGTTCCTACTG TTATCTGGCTGCTGCGGAAA |
| SIRT2 | SIRT2-F SIRT2-R | CTCTCACCCTCTGGAGACCC ATGTCTGCTTCTCCACCAGC |
| SIRT3 | SIRT3-F SIRT3-R | GGTAGTTGAACGGGTCGAGG TAATAATCGTCCCTGCCGCC |
| SIRT4 | SIRT4-F SIRT4-R | CAATCAGACGGTCCCACTGT ATCCAACGGCCTTTTGCTGA |
| SIRT5 | SIRT5-F SIRT5-R | ACGTCGTGTGGTTTGGAGAA GGAAGTGCCCACCACTAGAC |
| SIRT6 | SIRT6-F SIRT6-R | GCAGTCTTCCAGTGTGGTGT TCCTCCATGGTCCAGACTCC |
| β-ACTIN | ACTIN-F ACTIN-R | GAGCACAGAGCCTCGCC CGCGGCGATATCATCATCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Gavia-García, G.; Hernández-Álvarez, D.; Arista-Ugalde, T.L.; Aguiñiga-Sánchez, I.; Santiago-Osorio, E.; Cadena-Iñiguez, J.; Rosado-Pérez, J.; Mendoza-Núñez, V.M. Sechium edule var. nigrum spinosum (Chayote) Increases the mRNA Expression of Genes Encoding Sirtuins in Older Adults with Type 2 Diabetes Mellitus. Molecules 2026, 31, 1182. https://doi.org/10.3390/molecules31071182
Gavia-García G, Hernández-Álvarez D, Arista-Ugalde TL, Aguiñiga-Sánchez I, Santiago-Osorio E, Cadena-Iñiguez J, Rosado-Pérez J, Mendoza-Núñez VM. Sechium edule var. nigrum spinosum (Chayote) Increases the mRNA Expression of Genes Encoding Sirtuins in Older Adults with Type 2 Diabetes Mellitus. Molecules. 2026; 31(7):1182. https://doi.org/10.3390/molecules31071182
Chicago/Turabian StyleGavia-García, Graciela, David Hernández-Álvarez, Taide Laurita Arista-Ugalde, Itzen Aguiñiga-Sánchez, Edelmiro Santiago-Osorio, Jorge Cadena-Iñiguez, Juana Rosado-Pérez, and Víctor Manuel Mendoza-Núñez. 2026. "Sechium edule var. nigrum spinosum (Chayote) Increases the mRNA Expression of Genes Encoding Sirtuins in Older Adults with Type 2 Diabetes Mellitus" Molecules 31, no. 7: 1182. https://doi.org/10.3390/molecules31071182
APA StyleGavia-García, G., Hernández-Álvarez, D., Arista-Ugalde, T. L., Aguiñiga-Sánchez, I., Santiago-Osorio, E., Cadena-Iñiguez, J., Rosado-Pérez, J., & Mendoza-Núñez, V. M. (2026). Sechium edule var. nigrum spinosum (Chayote) Increases the mRNA Expression of Genes Encoding Sirtuins in Older Adults with Type 2 Diabetes Mellitus. Molecules, 31(7), 1182. https://doi.org/10.3390/molecules31071182

