Anticancer Activity of Microbial Biosurfactants Amphisin and Viscosinamide Against Melanoma Cells

Abstract

The anticancer activity of two novel microbial lipopeptide biosurfactants, amphisin and viscosinamide, was evaluated against human (A375) and murine (B16 4A5) melanoma cells. Normal human dermal fibroblasts (NHDFs) were used as a control. Cell viability was assessed using the MTT assay, while membrane integrity was analysed by the lactate dehydrogenase (LDH) release test. Early and late stages of apoptosis were investigated using Annexin V-FITC and Hoechst 33342 staining, respectively. In addition, the expression of apoptosis-related genes bax and bcl-2 was quantified by RT-qPCR. Finally, the wound healing (scratch) assay was performed to evaluate the effect of the tested lipopeptides on the migratory ability of melanoma cells. Both lipopeptides inhibited melanoma cell proliferation in a concentration- and time-dependent manner and exhibited significantly lower cytotoxicity toward NHDF cells, indicating selective antitumor activity. Viscosinamide exhibited stronger cytotoxic activity than amphisin. LDH release and fluorescence microscopy confirmed that the main mechanism of cytotoxicity was cell membrane damage and induction of apoptosis, including phosphatidylserine externalization and characteristic changes in the cell nucleus, such as chromatin condensation and cell nucleus fragmentation. Gene expression analysis demonstrated increased levels of bax and decreased levels of bcl-2, indicating activation of the intrinsic mitochondrial pathway of apoptosis. In addition, tested compounds effectively inhibited cell migration. The studies show that amphisin and viscosinamide exhibit selective anticancer potential related to the cell membrane and are promising molecules for further development as melanoma treatments.

1. Introduction

Cancer remains one of the leading causes of mortality worldwide and continues to pose a major therapeutic challenge despite significant advances in oncology. In 2022, approximately 20 million new cancer cases and 9.7 million cancer-related deaths were reported globally [1]. Although multiple treatment strategies are currently available, including surgery, chemotherapy, immunotherapy, and radiotherapy, their effectiveness is often limited by severe side effects, drug resistance, and insufficient selectivity toward cancer cells [2]. Therefore, there is a constant need to identify new natural compounds that combine effective anticancer activity with low cytotoxicity against healthy cells.

Biosurfactants are surface-active compounds produced by microorganisms either at the cell surface or secreted outside the cell [3]. Their molecules contain both a hydrophobic and a hydrophilic part, which allows them to locate at the interface between phases of different polarity [4]. Compared to synthetic surfactants, microbial biosurfactants exhibit higher biodegradability and lower toxicity, which play an important role in reducing environmental impact. Importantly, they are more stable under different pH, temperature, and salinity conditions [3].

One of the most important properties of biosurfactants is their capacity to interact with biological membranes. These compounds can insert into the lipid bilayer, increase its permeability, and disturb electrochemical gradients, which leads to uncontrolled leakage of cellular metabolites and cell lysis [5].

These unique properties make biosurfactants interesting for different industrial and scientific applications, including medical and pharmacological therapies [4,6]. Growing attention has been focused on their anticancer properties and possible therapeutic applications. In recent years, several studies have shown that some biosurfactants, especially lipopeptides, could affect cancer cells [7,8,9,10,11].

Differences in membrane composition between cancer and normal cells may partly explain the selective cytotoxicity of certain lipopeptides toward tumor cells.

Previous studies have reported that lipopeptide biosurfactants possess promising anticancer activity. Surfactin plays a key role in suppressing the proliferation of human colon cancer LoVo cells [12]. It has also been shown to inhibit the growth of MCF-7 breast cancer cells induced by the tumor-promoting agent TPA, through the downregulation of matrix metalloproteinase 9 (MMP-9) expression. Moreover, in MCF-7 cells, surfactin could cause the mitochondrial apoptotic pathway as indicated by an increased Bax/Bcl-2 ratio, loss of mitochondrial membrane potential, release of cytochrome c, and activation of the caspase cascade [13,14]. Despite many reports on the anticancer activity of surfactin, its therapeutic use remains limited. Surfactin has been shown to have cytotoxic effects not only against cancer cells but also against normal cells. This indicates limited selectivity at certain concentrations. Furthermore, in vivo studies have demonstrated that high doses of surfactin C may induce hepatotoxic effects, as reflected by increased levels of liver enzymes. An additional limitation is the hemolytic activity of surfactins, observed at higher concentrations, which limits their potential for systemic application [8].

While the activity of surfactin is well studied, other lipopeptides, such as amphisin and viscosinamide, remain less examined in the context of cancer therapy. They are produced mainly by Pseudomonas species and are known for their strong surface-active [15,16]. Both compounds have been characterized mainly by focusing on their antifungal activity [17,18,19]. However, data regarding their cytotoxicity toward cancer cells, selectivity toward tumor versus normal cells, and mechanisms of action have not been investigated. This represents a significant research gap, especially given the need for new therapeutic agents against melanoma.

Therefore, the anticancer properties of novel lipopeptide biosurfactants, amphisin and viscosinamide, were tested in human (A375) and murine (B16 4A5) melanoma cells. Melanoma develops from melanocytes, the pigment-producing cells found mainly in the skin, as well as in the eye and inner ear. It represents the most aggressive and deadliest type of skin cancer. Over the past 50 years, the global incidence of melanoma has increased significantly. Conventional treatment strategies include surgery, chemotherapy, immunotherapy, and radiation therapy. However, the effectiveness of these therapeutic methods is often limited, and they rarely provide satisfactory answers [20]. We hypothesize that amphisin and viscosinamide represent promising candidates for further investigation as anticancer agents in melanoma, given their potential biological activity.

2. Results and Discussion

2.1. Cell Proliferation (MTT Assay)

The effects of amphisin and viscosinamide on the proliferation rate of melanoma (A375 and B16 4A5) cells and normal human dermal fibroblast (NHDF) cells were investigated, along with their IC₅₀ values (Figure 1, Figure 2, Figure 3 and Figure 4). The cells were grown in the presence of increasing concentrations of the compounds (15–300 µg/mL) for 24 and 48 h, after which cell viability was assessed using MTT ((3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide). The results were presented as a percentage of viable cells relative to the control (0 µg/mL), which was taken as 100%.

The results showed that both biosurfactants exhibit an inhibitory effect on cell growth and that cancer and normal cells respond with different sensitivities. Amphisin and viscosinamide reduced cell viability with a dependence on both concentration and incubation time. After 24 h of incubation, amphisin showed moderate cytotoxicity, whereby the A375 and B16 4A5 cancer cell lines were noticeably more sensitive than normal NHDF cells (Figure 1). A reduction in the viability of cancer cells was already seen at a concentration of 30 µg/mL, while normal cells responded less strongly and retained approximately 50% of their viability even at the highest concentration tested (300 µg/mL). Extending the incubation to 48 h intensified the effect of amphisin. At 240 µg/mL, cell viability reached 26% for A375 and 12% for B16 4A5, whereas NHDF remained above 56%. Across the concentration range, B16 4A5 was the most sensitive line, and NHDF responded more mildly, maintaining significantly higher viability than the cancer cells. Additionally, the MTT assay enabled the determination of IC₅₀ values after 24 h of incubation, as shown in Figure 2.

In the case of viscosinamide, a stronger cytotoxic profile was observed. Importantly, normal cells were still less sensitive than cancer cell lines (Figure 3). After 24 h of incubation with viscosinamide, the viability of A375 and B16 4A5 cells dropped below 50% at concentrations of 247.5 µg/m and 195 µg/mL, respectively. After 48 h, the cytotoxic effect intensified further, resulting in very low viability of the cancer cells already at 120 µg/mL. NHDF cells showed higher resistance at 180 µg/mL, with viability remaining approximately 50% (Figure 3b). Figure 4 presents the IC₅₀ values for the activity of viscosinamide after 24 h incubation.

The differential sensitivity observed between melanoma cells and normal fibroblasts suggests a degree of selectivity in the cytotoxic action of the tested lipopeptides. Such selectivity is often attributed to differences in lipid composition, surface charge, and membrane fluidity between cancer and normal cells [21]. The structural and amphiphilic properties of lipopeptide biosurfactants play a significant role in determining their biological activity, including anticancer activity [8]. The cytotoxic profile observed for amphisin and viscosinamide is consistent with previous reports on other cyclic lipopeptides. For example, surfactin, one of the best-studied lipopeptides, has been shown to inhibit the growth of a wide range of cancer cell lines [3]. Kim et al. (2021) [22] noted that surfactin strongly inhibited the growth of B16-F10 melanoma cells, both in vitro and in vivo. Their study indicated that surfactin triggered a dose-dependent loss of viability in B16-F10 cells, consistent with the decreasing metabolic activity observed in our experiments.

In

Table 1. Comparison of IC₅₀ values for the tested compounds and reference drugs used in melanoma treatment [23,24,25].

Compound	Cell Line	Concentration		References
		μg/mL	μmol/L
Tested compounds
Amphisin	A375	247.5	236	-
	B16 4A5	195	186	-
Viscosinamide	A375	64.7	57.5	-
	B16 4A5	45.1	40	-
Other lipopeptide
Pseudofactin II	A375	114	110	[25]
Standard drug in melanoma treatment
Dacarbazine	A375	1158	6360	[23]
	B16-F10	-	149.7	[24]

, the IC₅₀ values determined for the tested biosurfactants, amphisin and viscosinamide, are presented alongside literature data for dacarbazine, a chemotherapeutic agent commonly used in melanoma treatment, for the A375 and B16 4A5 melanoma cell lines. The concentrations are expressed in both µg/mL and µmol/L to facilitate comparison. It should be noted that the IC₅₀ values reported for dacarbazine were derived from independent studies and may be influenced by differences in experimental conditions, including assay protocols and incubation times. Therefore, these values are provided as a general clinical reference rather than for direct quantitative comparison.

Despite these limitations, the obtained results clearly indicate that both amphisin and viscosinamide exhibit pronounced cytotoxic activity against melanoma cells. For the A375 cell line, the IC₅₀ value reported for dacarbazine is 6360 µmol/L, whereas amphisin inhibits cell proliferation at 236 µmol/L and viscosinamide at 57.5 µmol/L [23]. A similar trend was observed for the B16 4A5 cell line, where the IC₅₀ values of viscosinamide (40 µmol/L) and amphisin (186 µmol/L) were markedly lower than those reported for dacarbazine. It should be noted that the literature IC₅₀ values for dacarbazine were determined using the B16-F10 melanoma cell line, which originates from the same murine melanoma model and represents a closely related subline [24].

To allow for a more reliable comparison under uniform experimental conditions, the activity of the tested biosurfactants was additionally considered in the context of Pseudofactin II, a cyclic lipopeptide previously evaluated against A375 melanoma cells using the same MTT assay and comparable experimental conditions [25]. In a previous study, Pseudofactin II demonstrated a dose-dependent inhibition of cell proliferation in the micromolar concentration range, with cell viability decreasing below 50% at concentrations exceeding approximately 110 µmol/L. In comparison, viscosinamide exhibited a comparable or stronger antiproliferative effect at lower micromolar concentrations, whereas amphisin achieved a similar level of cytotoxicity only at higher concentrations in the present study. In summary, these findings indicate a substantial cytotoxic potential of the investigated biosurfactants toward A375 melanoma cells.

2.2. The Effect of Viscosinamide and Amphisin on the Release of Lactate Dehydrogenase

Another method of assessing cell viability is the measurement of lactate dehydrogenase (LDH) activity. This enzyme is present in the cytoplasm and is released into the extracellular environment when the cell membrane integrity is damaged. Due to the influence of toxic factors, membrane destabilisation occurs, leading to the leakage of LDH from the cells into the culture medium. The level of LDH activity in the culture medium correlates with the cytotoxicity of the tested compound—the higher the LDH activity, the greater the extent of membrane damage [26]. Figure 5 illustrates the release of lactate dehydrogenase by A375, B16 4A5 and NHDF cells after 24 h of incubation in the presence of amphisin and viscosinamide at concentrations ranging from 15 to 300 μg/mL.

As demonstrated in the MTT test, cancer cells exhibited increased sensitivity to the biosurfactant compared to normal cells. Amphisin caused progressive dose-dependent membrane damage in all three cell lines. LDH release was minimal at lower doses (15–60 µg/mL) and increased markedly above 120 µg/mL. The strongest response was observed in the A375 line. At 180 µg/mL, LDH levels reached approximately 35–40%, and at 240 µg/mL exceeded 80%. The highest concentration of amphisin (300 µg/mL) caused very strong cytotoxicity, with LDH release surpassing 250%, reflecting extensive membrane disruption in this line.

At lower concentrations of viscosinamide (up to 120 μg/mL), the level of dehydrogenase in the medium remained moderate (12%) for all the cell lines tested. However, a significant increase in the amount of released LDH was only observed at a concentration of 180 μg/mL, reaching 95% for both A375 and B16 4A5 cells. Importantly, at the same concentration (180 μg/mL), the LDH level for normal cells remained low at 12%. A significant increase in cytotoxicity towards the NHDF line (up to 74%) was observed at a concentration of 240 μg/mL. B16 4A5 cells also showed increased cytotoxicity, but the response was less noticeable than in A375. At 240 µg/mL, LDH release reached about 60–70%, and at 300 µg/mL it approached 120%. On the other hand, NHDF cells showed the lowest sensitivity to amphisin. At concentrations between 15 and 180 µg/mL, LDH levels remained below 10–15%. A clear increase was observed only at the highest concentrations—approximately 75% at 240 µg/mL and 300 µg/mL.

The LDH assay confirmed the cytotoxic activity of both lipopeptide biosurfactants. The observed increase in LDH release indicates loss of cell membrane integrity and reduced cell viability following exposure to the tested compounds. These effects may be related to the amphiphilic nature of lipopeptides and their interaction with cellular membranes. However, the LDH assay alone does not allow definitive conclusions regarding specific cell death mechanisms. Similar increases in LDH release and membrane-associated cytotoxic effects have been reported for other cyclic lipopeptide biosurfactants, including surfactin and pseudofactin II, in various cancer cell models, supporting the relevance of membrane perturbation as a contributing factor to their antitumor activity [5,25].

2.3. Evaluation of Changes in the Cytoplasmic Cell Membrane

Annexin V staining is a commonly used method to detect early stages of cell apoptosis [9,25,27]. The experimental procedure is based on the loss of cell membrane integrity. In viable cells, phosphatidylserine is located on the inner leaflet of the membrane. However, during early apoptosis, it becomes exposed to the cell surface [28]. Annexin V binds to externalized phosphatidylserine, enabling the identification of apoptotic cells. This approach is widely applied in both fluorescence microscopy for imaging-based analysis and in flow cytometry for quantitative assessment [29].

In this study, annexin V conjugated to the fluorochrome FITC (Fluorescein Isothiocyanate) was used to detect cells undergoing apoptosis by fluorescence microscopy. Figure 6 presents the analysis of cytoplasmic membrane alterations in A375 and B16 4A5 cell lines after a 24 h incubation with amphisin and viscosinamide at the IC₅₀ concentration. As can be seen in both the human and murine melanoma lines, a population of apoptotic cells appeared, which was absent in untreated controls. This indicates that cells cultured in the presence of the biosurfactant initiated the apoptotic process, whereas in control cells, the integrity of the plasma membrane was preserved. Staurosporine is a reference compound that induces apoptosis and was used as a positive control. In cells treated with 1 μM staurosporine, annexin V binding to phosphatidylserine was observed in both A375 and B16 4A5 cells. However, the signal was less pronounced than in cells incubated with the biosurfactant. This effect may result from pronounced membrane disruption caused by the reference compound, as most cells were likely in a late apoptotic or necrosis state.

Previous biophysical studies demonstrated that cyclic lipopeptides can insert into lipid bilayers, disturb lipid packing, and induce the formation of ion-permeable defects or pores in the membrane [5,30,31]. Our findings are consistent with growing evidence that biosurfactant interactions with membranes are a key mechanism of the cytotoxic and proapoptotic activity. In the case of surfactin, one of the best-characterised cyclic lipopeptide biosurfactants, apoptotic effects associated with membrane perturbation have been confirmed using annexin V staining in several cancer cell models. Kim et al., (2007) [12] demonstrated a significant increase in the population of human colon cancer cells exposed to surfactin that showed a positive result in the annexin V test, indicating the externalization of phosphatidylserine as an early stage of apoptosis. Similar apoptosis-related responses have been described in subsequent studies, in which annexin V staining was accompanied by growth inhibition and activation of apoptosis signaling pathways, including caspase activation and inhibition of survival-related signaling [32].

The annexin V positive staining observed in melanoma cells treated with amphisin and viscosinamide indicates the externalization of phosphatidylserine. Together with the increased release of intracellular markers such as LDH, these findings suggest that the tested lipopeptide biosurfactants exert cytotoxic effects by disrupting cell membrane integrity.

2.4. Analysis of Nuclei Fragmentation

Morphological changes in the nucleus, such as chromatin condensation and nuclear fragmentation, are recognized as typical hallmarks of apoptosis. Fluorescence microscopy is a technique extensively employed for the detection of these alterations using DNA-specific fluorescent dyes. During apoptosis, nuclei become smaller and exhibit intense fluorescence due to chromatin condensation and aggregation along the nuclear envelope. Hoechst 33258 binds specifically to DNA and enables precise visualisation of cell nuclei. In the present study, fluorescence imaging showed distinct changes in cell nucleus morphology. Human and murine melanoma cell lines treated with amphisin and viscosinamide at the IC₅₀ concentration for 24 h exhibited changes characteristic of apoptosis, such as chromatin condensation and nuclear fragmentation (Figure 7). In contrast, these changes were not detected in untreated cells. In the case of staurosporine, clear apoptotic morphological alterations were visible, like those observed after incubation with lipopeptides. Similar nuclear changes have been observed in previous studies using other lipopeptide biosurfactants like bacillomycin D and iturin produced by Bacillus subtilis, supporting the interpretation of the observed morphological features [27,33].

2.5. Gene Expression (RT-qPCR)

Members of the BCL-2 protein family exhibit pro- or anti-apoptotic activity. They have been the subject of intensive study over the past decade due to their role in regulating apoptosis, tumor formation, and cellular responses to anticancer therapy [34]. The effect of amphisin and viscosinamide on the expression of apoptosis-related genes was examined, focusing on the pro-apoptotic gene bax and the anti-apoptotic gene bcl-2. Gene expression was assessed by RT-qPCR in A375 and B16 4A5 cells after 24 h of incubation with the biosurfactants at the IC₅₀ concentration (Figure 8 and Figure 9). Untreated cells served as the control group, with their expression levels set to 1 and used as the reference for evaluating changes.

The results showed that treatment of melanoma cells with amphisin led to an increase in bax expression with a reduction in bcl-2 expression. In the murine melanoma line, bax expression increased approximately twelve-fold, while bcl-2 expression decreased to 0.45 (Figure 8b). The effect was weaker in A375 cells. The bax expression rose three-fold, and bcl-2 levels decreased to 0.3 (Figure 8a). Viscosinamide exhibited a similar outcome. The murine melanoma line also showed higher sensitivity with enhanced expression of bax and reduced expression of bcl-2 after treatment (Figure 9b). The observed changes in bax and bcl-2 expression suggest the involvement of the intrinsic apoptosis-related responses following treatment with the tested lipopeptides. A similar bax/bcl-2-dependent mechanism has been reported previously for other lipopeptide biosurfactants in different cancer cell models, suggesting that modulation of the mitochondrial pathway represents a possible mode of action for this group of compounds [27,35].

2.6. Evaluation of Cell Migration—Scratch Assay

In addition to assessing cytotoxicity and proapoptotic properties of two lipopeptide biosurfactants, the potential to inhibit cancer cell migration was also tested. For this purpose, a scratch assay was performed, which involves mechanically creating a break in the cell monolayer and then monitoring the process of its healing. In the studies, A375 (Figure 10) and B16 4A5 (Figure 11) cells were incubated for 24 and 48 h at the IC₅₀ concentration of amphisin and viscosinamide. For both examined biosurfactants, significant differences in migratory activity were observed. The scratch was almost filled with untreated cells, indicating their high natural migratory activity. During the experiment, no crucial reduction in scratch size was noted for either the A375 or B16 4A5 lines. The microscopic image was found to be like the starting point (0 h). Quantitative analysis of the migration results, presented in

Table 2. Quantitative analysis of A375 and B16 4A5 cell migration after 24 and 48 h of treatment with amphisin and viscosinamide at their IC₅₀ concentrations. Data represent mean ± SD of three independent experiments. Statistical analysis was performed using Student’s t-test, comparing treated groups with the corresponding control at each time point. * p < 0.05, ** p < 0.01.

	Relative Scratch Width
	0 h	24 h	48 h
A375
Control	1 ± 0.04	0.52 ± 0.02 *	0.29 ± 0.01 **
Amphisin [195 µg/mL, IC50]	1 ± 0.09	0.78 ± 0.02	0.73 ± 0.06
Viscosinamide [45 µg/mL, IC50]	1 ± 0.12	0.88 ± 0.04	0.68 ± 0.04 *
B16 4A5
Control	1 ± 0.13	0.89 ± 0.06	0.33 ± 0.04 **
Amphisin [195 µg/mL, IC50]	1 ± 0.09	0.86 ± 0.07	0.82 ± 0.03
Viscosinamide [45 µg/mL, IC50]	1 ± 0.22	0.94 ± 0.09	0.87 ± 0.11

, demonstrated that both amphisin and viscosinamide markedly reduced the migration of A375 and B16 4A5 cells in a dose-dependent manner, consistent with the trends observed in the scratch assay images.

Cell migration is an important factor in tumour progression and metastasis, making it a key parameter in cancer biology and therapeutic evaluation [36]. In the case of surfactin, effective inhibition of cancer cell migration and invasion has been demonstrated. This process is related to controlling regulatory proteins. The key role here is the suppression of MMP2 and MMP9 gene expression, which are important in the development of cancer metastasis [37]. The present study demonstrated that amphisin and viscosinamide effectively inhibit cell migration, indicating their potential to prevent processes associated with cancer spread. A similar effect was also observed for glycolipid biosurfactants, which have been found to inhibit the migration and invasion of melanoma cells [20,38].

3. Materials and Methods

3.1. Lipopeptides

Amphisin and viscosinamide used in this study were purified and characterized in our previous works [39,40], respectively. The purity of amphisin and viscosinamide was estimated to be greater than 99% by reverse-phase chromatography using a water/acetonitrile gradient on a Hypersil GOLD column (5 µm, 4.6 × 150 mm) with an HPLC system (Shimadzu, Kyoto, Japan), and further confirmed by negative electrospray ionization mass spectrometry (ESI-MS). Amphisin is a cyclic lipoundecapeptide with the amino acid sequence D-Leu–D-Asp–D-aThr–D-Leu–D-Leu–D-Ser–L-Leu–D-Gln–L-Leu–L-Ile–L-Asp, acylated with a β-hydroxydecanoyl fatty acid (3-OH C10:0; MW 1395.7 g/mol). Viscosinamide is a cyclic lipopeptide composed of the sequence L-Leu–D-Gln–D-aThr–D-Val–L-Leu–D-Ser–L-Leu–D-Ser–L-Ile, also acylated with a β-hydroxydecanoyl fatty acid (3-OH C10:0; MW 1124.7 g/mol).

3.2. Cell Culture Conditions

Human melanoma A375 (ATCC CRL-1619; Manassas, VA, USA) and mouse melanoma B16 4A5 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Sigma-Aldrich, St. Louis, MO, USA) enriched with 10% fetal bovine serum (FBS, Gibco Life Technologies, Carlsbad, CA, USA) 1% L-glutamine (Sigma-Aldrich, St. Louis, MO, USA), and 1% antibiotics solution containing penicillin (10 U/mL) and streptomycin (10 µg/mL) (Sigma-Aldrich, St. Louis, MO, USA). Human Normal Dermal Fibroblasts (NHDF; ATCC PCS-201-012) were cultured in α-Minimum Essentials Medium (α-MEM, Sigma-Aldrich, St. Louis, MO, USA), supplemented with the same concentrations of FBS, L-glutamine, and antibiotics. All cell lines were incubated under standard conditions in a humidified atmosphere at 37 °C with 5% CO₂ using an INCO 105 incubator (Memmert GmbH, Schwabach, Germany). Subculturing was performed by enzymatic detachment with trypsin solution (pH 7.2; Thermo Fisher Scientific, Waltham, MA, USA). For experimental procedures, cells were used between the second and sixth passage and harvested at approximately 80% confluence.

3.3. Cell Treatment

A375, B16 4A5, and NHDF cells were exposed to amphisin and viscosinamide at a range of concentrations (0–300 µg/mL) for incubation periods of 24 and 48 h. The compounds were directly administered to the culture medium.

3.4. MTT Assay

A375, B16 4A5, and NHDF cells were seeded into 96-well culture plates at a density of 1 × 10⁴ cells per well and allowed to adhere for 24 h in the appropriate growth media (DMEM or α-MEM). Following this initial incubation period, the culture medium was replaced, and cells were exposed to amphisin or viscosinamide at increasing concentrations for 24 or 48 h. Cell viability and proliferation were subsequently evaluated using the colorimetric MTT assay based on the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma, St. Louis, MO, USA). Absorbance was measured at 570 nm with a microplate reader (Spark, TECAN, Männedorf, Switzerland). All experiments were performed in triplicate. Based on MTT assay results, the half-maximal inhibitory concentration (IC₅₀) values were determined for each tested compound in all cell lines after 24 h of incubation using GraphPad Prism 8 software version 8.0.1 (GraphPad Software Inc, San Diego, CA, USA).

3.5. Lactate Dehydrogenase (LDH) Assay

Cell membrane damage was assessed by measuring lactate dehydrogenase (LDH) release using the Cytotoxicity Detection Kit (Roche Diagnostics GmbH, Mannheim, Germany), which enables quantitative evaluation of membrane integrity in a homogeneous assay format. A375, B16 4A5, and NHDF cells were seeded in 96-well plates at a density of 1 × 10⁴ cells per well and cultured for 24 h in the appropriate media (DMEM or α-MEM). After this incubation period, the growth medium was replaced with fresh medium containing increasing concentrations of amphisin or viscosinamide, followed by an additional 24 h incubation. LDH activity was then determined in accordance with the manufacturer’s instructions provided with the Cytotoxicity Detection Kit. Plasma membrane damage was assessed by quantifying the release of intracellular LDH. Following the manufacturer’s instructions, cells treated with 1% Triton X-100 served as the positive control (representing 100% lysis), whereas cells incubated with culture medium alone were used as the negative control.

3.6. RNA Isolation and Transcript Quantification

A375 and B16 4A5 melanoma cells were seeded into 6-well culture plates at a density of 2 × 10⁶ cells per well and cultured in DMEM at 37 °C for 24 h. Following overnight incubation, the culture medium was replaced with fresh DMEM containing amphisin or viscosinamide at their respective IC₅₀ concentrations, and cells were further incubated for an additional 24 h. Subsequently, cells were detached by gentle scraping with a rubber scraper and collected by centrifugation at 9000× g for 5 min. The resulting cell pellets were washed twice with ice-cold phosphate-buffered saline (PBS). Total RNA was extracted using the Total RNA Mini Plus Kit (A&A Biotechnology, Gdańsk, Poland), followed by DNase I treatment (Thermo Fisher Scientific, Waltham, MA, USA) to eliminate genomic DNA contamination, in accordance with the manufacturers’ protocols. RNA concentration and purity were assessed spectrophotometrically using a Biochrom WPA Biowave II instrument (Biochrom Ltd., Cambridge, UK). Complementary DNA (cDNA) was synthesized with the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time PCR was carried out using the DyNAmo Flash SYBR Green qPCR Kit (Thermo Fisher Scientific, Waltham, MA, USA) on a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The amplification protocol consisted of an initial denaturation step at 95 °C for 2 min, followed by 41 cycles of denaturation at 95 °C for 15 s, primer-specific annealing for 30 s, and extension at 72 °C for 15 s. Each experiment was performed in triplicate and repeated in at least three independent biological replicates. Relative transcript levels were calculated using the 2^−ΔΔCT method, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as the internal reference gene. Primer sequences used for amplification are listed in

Table 3. Primer sequences for RT-PCR.

		A375
GAPDH	Forward	5′CAAGGTCATCCATGACAACTTTG3′
	Reverse	5′GTCCACCACCCTGTTGCTGTAG3′
Bax	Forward	5′CAGAACTGGACAGTAACATGGAG3′
	Reverse	5′CAGTTTGCTGGCAAAGTAGAAAAG3′
Bcl-2	Forward	5′ATGTGTGTGGAGAGCGTCAA3′
	Reverse	5′GAGACAGCCAGGACAAATCAA3′
		B16 4A5
GAPDH	Forward	5′ACCACAGTCCATGCCATCAC3′
	Reverse	5′ TCCACCACCCTGTTGCTGTA3′
Bax	Forward	5′GGCAGCTGACATGTTTGCTGAT3′
	Reverse	5′AGCCCATCTTCTTCCAGATGGT3′
Bcl-2	Forward	5′AGAGCGTCAACAGGGAGA3′
	Reverse	5′ AGCCAGGAGAAATCAAACAG3′

.

3.7. Visualization of Nuclear Morphology

Fluorescence microscopy was applied to qualitatively assess apoptosis-related changes in nuclear morphology, including chromatin condensation and nuclear fragmentation. Melanoma A375 and B16 4A5 were incubated on sterile glass coverslips in the presence of amphisin and viscosinamide at IC₅₀ concentration. The incubation was carried out for 24 h at 37 °C. Then, the culture medium was removed, and the cells were washed with 1 mL of PBS. The cells were incubated for 10 min with Hoechst 33342 dye in PBS at a final concentration of 5 µg/mL. Treatment with 1 µM staurosporine for 2 h was used to confirm apoptotic response and functioned as the positive control. Nuclear morphology was examined using a fluorescence microscope (Zeiss, Oberkochen, Germany). All images were acquired using identical fluorescence microscope settings for all groups to ensure comparability. Image acquisition and basic image processing, including channel selection, were performed using ZEN software version 3.0 (Carl Zeiss, Jena, Germany). The evaluation of nuclear morphology staining was qualitative and based on visual inspection of representative images.

3.8. Detection of Apoptosis with the Annexin V-FITC

Fluorescence microscopy was used to qualitatively evaluate phosphatidylserine externalization as an early apoptotic marker. Human and murine melanoma cell lines were incubated on sterile glass coverslips in the presence of amphisin and viscosinamide at IC₅₀ concentration determined for each cell line. The incubation was performed for 24 h at 37 °C. After treatment, the culture medium was removed, and the cells were gently washed with 1 mL of PBS. Subsequently, 15 µL of annexin V solution prepared in annexin binding buffer (1:4, v/v) was added to each coverslip, followed by incubation for 15 min at room temperature. Treatment with 1 µM staurosporine for 2 h was used to confirm apoptotic response and functioned as the positive control. Fluorescence microscopy (Zeiss, Oberkochen, Germany) was used to evaluate early apoptotic changes in the cells. All images were acquired using identical fluorescence microscope settings for all groups to ensure comparability. Image acquisition and basic image processing, including channel selection, were performed using ZEN software version 3.0 (Carl Zeiss, Jena, Germany). Analysis was qualitative and based on visual inspection of representative images.

3.9. Migration—Scratch Assay

A375 and murine B16 4A5 melanoma cell lines were grown in 6-well plates at a density of 1 × 10⁶ cells per well. The cells were cultured in DMEM at 37 °C for 24 h until a uniform monolayer was formed. The scratch was made across the cell monolayer using a sterile pipette tip. The culture medium was carefully removed and replaced with fresh medium containing amphisin and viscosinamide at the IC₅₀ concentration determined for each cell line. Cell migration was monitored under an inverted light microscope (Leica DMi1, Leica, Wetzlar, Germany) at 0, 24, and 48 h. The distance between two cell edges were analyzed by ImageJ software version 1.53 t. Each experiment was performed in triplicate.

3.10. Statistical Analysis

Results are shown as mean ± SD based on a minimum of three independent experiments. Statistical analysis was performed using Student’s t-test, with significant differences marked by an asterisk: * p < 0.05, ** p < 0.01, *** p < 0.001.

4. Conclusions

This study demonstrates that the microbial lipopeptide biosurfactants amphisin and viscosinamide exhibit selective anticancer activity against human (A375) and murine (B16 4A5) melanoma cells, while showing lower cytotoxicity toward NHDF. Both lipopeptides inhibited melanoma cell proliferation in a concentration- and time-dependent manner, with viscosinamide showing stronger cytotoxic effects. The cytotoxic mechanism was associated with disruption of plasma membrane integrity and induction of apoptosis, as confirmed by LDH release, phosphatidylserine externalization, nuclear fragmentation, and modulation of apoptosis-related genes (bax upregulation and bcl-2 downregulation), indicating activation of the intrinsic mitochondrial pathway. Additionally, amphisin and viscosinamide effectively inhibited melanoma cell migration, suggesting their potential to limit tumor progression. Overall, these results identify both lipopeptides as promising membrane-targeting anticancer agents. However, it should be noted that the present findings are based exclusively on in vitro cell culture models, which do not fully capture the complexity of tumor architecture, microenvironmental interactions, or systemic factors present in vivo. In addition, the concentration ranges applied in cell-based assays reflect experimental exposure conditions and cannot be directly translated into effective or achievable doses in living organisms. Therefore, further studies using appropriate in vivo melanoma models are necessary to confirm their anticancer efficacy and safety. In addition, future work should address the stability, potential immunogenicity, pharmacokinetics, and formulation of these lipopeptides, which will be important for their potential therapeutic application.