Chrysanthemum zawadskii var. latilobum Flower Essential Oil Reduces MRSA Pathogenicity by Inhibiting Virulence Gene Expression
Abstract
1. Introduction
2. Results
2.1. Analysis of the Chemical Composition of CZEO
2.2. Antimicrobial Activity of CZEO Against Planktonic MRSA
2.3. Inhibitory Effect of CZEO on MRSA Biofilms: Quantitative Analysis and Observation of Microstructural Changes
2.4. CZEO Reduced the Survival Rate of MRSA
2.5. CZEO Downregulated All Pathogenic Genes in a Concentration-Dependent Manner
3. Discussion
4. Materials and Methods
4.1. Extraction and Sample Preparation of CZEO
4.2. Analytical Techniques
4.2.1. Gas Chromatography-Based Component Separation
4.2.2. Component Identification with Gas Chromatograph–Mass Spectrometer-Coupled Systems
4.3. In Vitro MRSA Culture and Inoculum Preparation
4.4. Analysis of MRSA Multiplication and Acidity Generation
4.5. Assessment of MRSA Biofilm Formation Utilizing Crystal Violet Staining Methodology and Scanning Electron Microscopy
4.6. Bacterial Nucleic Acid-Binding Fluorescent Staining Assay in MRSA
4.7. Quantitative Assay of Pathogenic Factor Gene Expression in MRSA via Real-Time PCR
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Algammal, A.M.; Hetta, H.F.; Elkelish, A.; Alkhalifah, D.H.H.; Hozzein, W.N.; Batiha, G.E.S.; Mabrok, M.A. Methicillin-resistant Staphylococcus aureus (MRSA): One health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect. Drug Resist. 2020, 13, 3255–3265. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization (WHO). World Leaders Commit to Decisive Action on Antimicrobial Resistance. Available online: https://www.who.int/news/item/26-09-2024-world-leaders-commit-to-decisive-action-on-antimicrobial-resistance (accessed on 30 October 2024).
- Liu, W.-T.; Chen, E.-Z.; Yang, L.; Peng, C.; Wang, Q.; Xu, Z.; Chen, D.-Q. Emerging resistance mechanisms for 4 types of common anti-MRSA antibiotics in Staphylococcus aureus: A comprehensive review. Microb. Pathog. 2021, 156, 104915. [Google Scholar] [CrossRef] [PubMed]
- Shoaib, M.; Aqib, A.I.; Muzammil, I.; Majeed, N.; Bhutta, Z.A.; Kulyar, M.F.-E.; Fatima, M.; Zaheer, C.-N.F.; Muneer, A.; Murtaza, M.; et al. MRSA compendium of epidemiology, transmission, pathophysiology, treatment, and prevention within one health framework. Front. Microbiol. 2023, 13, 1067284. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Bayer, A.; Cosgrove, S.E.; Daum, R.S.; Fridkin, S.K.; Gorwitz, R.J.; Kaplan, S.L.; Karchmer, A.W.; Levine, D.P.; Murray, B.E.; et al. Clinical practice guidelines by the Infectious Diseases Society of America for the treatment of methicillin-resistant Staphylococcus aureus infections in adults and children. Clin. Infect. Dis. 2011, 52, e18–e55. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Howden, B.P. Vancomycin in the treatment of methicillin-resistant Staphylococcus aureus—A clinician’s guide to the science informing current practice. Expert Rev. Anti-Infect. Ther. 2015, 13, 855–869. [Google Scholar] [CrossRef]
- Mahjabeen, F.; Saha, U.; Mostafa, M.N.; Siddique, F.; Ahsan, E.; Fathma, S.; Tasnim, A.; Rahman, T.; Faruq, R.; Sakibuzzaman; et al. An Update on Treatment Options for Methicillin-Resistant Staphylococcus aureus (MRSA) Bacteremia: A Systematic Review. Cureus 2022, 14, e31486. [Google Scholar] [CrossRef]
- European Medicines Agency (EMA). Assessment Report: Vancomycin-Containing Medicinal Products, Referral Under Article 31 of Directive 2001/83/EC; Procedure Number: EMEA/H/A-31/1440. 18 May 2017. Available online: https://www.ema.europa.eu/en/medicines/human/referrals/vancomycin-containing-medicines (accessed on 8 October 2024).
- Spížek, J.; Řezanka, T. Lincosamides: Chemical structure, biosynthesis, mechanism of action, resistance, and applications. Biochem. Pharmacol. 2017, 133, 20–28. [Google Scholar] [CrossRef] [PubMed]
- Helmy, H.A.; AbdElhamed, M.R.; Youssef, M.I.; El Zamek, H.M.F.; Kamal, A.; Abdelfattah, A.; Shabana, H.; Abuamer, A.; Aboufarrag, G.A.; Elshormilisy, A.A.; et al. A Multicenter Experience of Inducible Clindamycin Resistance in Staphylococcus aureus Infection among 800 Egyptian Patients with or without Diabetes Mellitus. Am. J. Trop. Med. Hyg. 2023, 109, 350–355. [Google Scholar] [CrossRef]
- Siberry, G.K.; Tekle, T.; Carroll, K.; Dick, J. Failure of Clindamycin Treatment of Methicillin-Resistant Staphylococcus aureus Expressing Inducible Clindamycin Resistance In Vitro. Clin. Infect. Dis. 2003, 37, 1257–1260. [Google Scholar] [CrossRef] [PubMed]
- Lusk, R.H.; Fekety, F.R.; Silva, J.; Bodendorfer, T.; Devine, B.J.; Kawanishi, H.; Korff, L.; Nakauchi, D.; Rogers, S.; Siskin, S.B. Gastrointestinal Side Effects of Clindamycin and Ampicillin Therapy. J. Infect. Dis. 1977, 135, S111–S119. [Google Scholar] [CrossRef] [PubMed]
- Moole, H.; Ahmed, Z.; Saxena, N.; Puli, S.R.; Dhillon, S. Oral clindamycin causing acute cholestatic hepatitis without ductopenia: A brief review of idiosyncratic drug-induced liver injury and a case report. J. Community Hosp. Intern. Med. Perspect. 2015, 5, 28746. [Google Scholar] [CrossRef]
- Liang, E.H.; Chen, L.H.; Macy, E. Adverse reactions associated with penicillins, carbapenems, monobactams, and clindamycin: A retrospective population-based study. J. Allergy Clin. Immunol. Pract. 2020, 8, 1302–1313. [Google Scholar] [CrossRef]
- Kim, Y.; Han, J.; Sung, J.; Sung, M.; Choi, Y.; Jeong, H.S.; Lee, J. Anti-inflammatory activity of Chrysanthemum zawadskii var. latilobum leaf extract through haem oxygenase-1 induction. J. Funct. Foods 2012, 4, 474–479. [Google Scholar] [CrossRef]
- Han, S.; Sung, K.H.; Yim, D.; Lee, S.; Lee, C.K.; Ha, N.J.; Kim, K. The effect of linarin on LPS-induced cytokine production and nitric oxide inhibition in murine macrophage cell line RAW264.7. Arch. Pharmacal Res. 2002, 25, 170–177. [Google Scholar] [CrossRef] [PubMed]
- Kim, A.R.; Kim, H.S.; Kim, D.K.; Lee, J.H.; Yoo, Y.H.; Kim, J.Y.; Choi, W.S. The extract of Chrysanthemum zawadskii var. latilobum ameliorates collagen-induced arthritis in mice. Evid.-Based Complement. Altern. Med. 2016, 2016, 3915013. [Google Scholar] [CrossRef] [PubMed]
- Hyun, M.R.; Lee, Y.S.; Park, Y.H. Antioxidative activity and flavonoid content of Chrysanthemum zawadskii flowers. Hortic. Sci. Technol. 2011, 29, 68–73. [Google Scholar]
- Shim, S.Y.; Kang, H.S.; Sun, H.J.; Lee, Y.J.; Park, J.R.; Chun, S.S.; Byun, D.S. Isolation and identification of flavonoids from Gujeolcho (Chrysanthemum zawadskii var. latilobum) as inhibitor of histamine release. Food Sci. Biotechnol. 2012, 21, 613–617. [Google Scholar] [CrossRef]
- Wertheim, H.F.; Melles, D.C.; Vos, M.C.; van Leeuwen, W.; van Belkum, A.; Verbrugh, H.A.; Nouwen, J.L. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect. Dis. 2005, 5, 751–762. [Google Scholar] [CrossRef] [PubMed]
- Qiu, K.; Wu, Y.; Fu, S.; Li, X.; Guo, C.; Tu, L.; Shi, Y.; Liu, D. Rapid Detection Technology Using Molecular Beacon Loop-Mediated Isothermal Amplification for Skin Infections Caused by Staphylococcus aureus. J. Biomed. Nanotechnol. 2023, 19, 1017–1026. [Google Scholar] [CrossRef]
- Del Giudice, P. Skin Infections Caused by Staphylococcus aureus. Acta Derm. Venereol. 2020, 100, adv00110. [Google Scholar] [CrossRef]
- Bitschar, K.; Staudenmaier, L.; Klink, L.; Focken, J.; Sauer, B.; Fehrenbacher, B.; Herster, F.; Bittner, Z.; Bleul, L.; Schaller, M.; et al. Staphylococcus aureus Skin Colonization Is Enhanced by the Interaction of Neutrophil Extracellular Traps with Keratinocytes. J. Investig. Dermatol. 2019, 140, 1054–1065.e4. [Google Scholar] [CrossRef]
- Kwiecinski, J.M.; Horswill, A.R. Staphylococcus aureus bloodstream infections: Pathogenesis and regulatory mechanisms. Curr. Opin. Microbiol. 2020, 53, 51–60. [Google Scholar] [CrossRef]
- Otto, M. MRSA virulence and spread. Cell. Microbiol. 2012, 14, 1513–1521. [Google Scholar] [CrossRef] [PubMed]
- Hulankova, R. Methods for Determination of Antimicrobial Activity of Essential Oils In Vitro—A Review. Plants 2024, 13, 2784. [Google Scholar] [CrossRef] [PubMed]
- Sharifi-Rad, J.; Sureda, A.; Tenore, G.C.; Daglia, M.; Sharifi-Rad, M.; Valussi, M.; Tundis, R.; Sharifi-Rad, M.; Loizzo, M.R.; Ademiluyi, A.O.; et al. Biological Activities of Essential Oils: From Plant Chemoecology to Traditional Healing Systems. Molecules 2017, 22, 70. [Google Scholar] [CrossRef] [PubMed]
- Paulino, B.N.; Silva, G.N.; Araújo, F.F.; Néri-Numa, I.A.; Pastore, G.M.; Bicas, J.L.; Molina, G. Beyond natural aromas: The bioactive and technological potential of monoterpenes. Trends Food Sci. Technol. 2022, 128, 188–201. [Google Scholar] [CrossRef]
- Badawy, M.E.; Marei, G.I.; Rabea, E.I.; Taktak, N.E. Antimicrobial and antioxidant activities of hydrocarbon and oxygenated monoterpenes against some foodborne pathogens through in vitro and in silico studies. Pestic. Biochem. Physiol. 2019, 158, 185–200. [Google Scholar] [CrossRef]
- Di Sotto, A.; De Paolis, F.; Gullì, M.; Vitalone, A.; Di Giacomo, S. Sesquiterpenes: A Terpene Subclass with Multifaceted Bioactivities. In Terpenes; Di Giacomo, S., Di Sotto, A., Briz, O., Vitalone, A., Eds.; Bentham Science Publisher: Singapore, 2023; pp. 9–10. [Google Scholar] [CrossRef]
- Moo, C.L.; Yang, S.K.; Osman, M.A.; Yuswan, M.H.; Loh, J.Y.; Lim, W.M.; Lai, K.S. Antibacterial activity and mode of action of β-caryophyllene. Pol. J. Microbiol. 2020, 69, 49–54. [Google Scholar] [CrossRef] [PubMed]
- Yoo, H.-J.; Jwa, S.-K. Inhibitory effects of β-caryophyllene on Streptococcus mutans biofilm. Arch. Oral Biol. 2018, 88, 42–46. [Google Scholar] [CrossRef]
- Hilgers, F.; Habash, S.S.; Loeschcke, A.; Ackermann, Y.S.; Neumann, S.; Heck, A.; Klaus, O.; Hage-Hülsmann, J.; Grundler, F.M.W.; Jaeger, K.-E.; et al. Heterologous Production of β-Caryophyllene and Evaluation of Its Activity against Plant Pathogenic Fungi. Microorganisms 2021, 9, 168. [Google Scholar] [CrossRef]
- Kirker, K.R.; James, G.A.; Fleckman, P.; Olerud, J.E.; Stewart, P.S. Differential effects of planktonic and biofilm MRSA on human fibroblasts. Wound Repair Regen. 2012, 20, 253–261. [Google Scholar] [CrossRef] [PubMed]
- Perfetto, B.; Donnarumma, G.; Criscuolo, D.; Paoletti, I.; Grimaldi, E.; Tufano, M.A.; Baroni, A. Bacterial components induce cytokine and intercellular adhesion molecules-1 and activate transcription factors in dermal fibroblasts. Res. Microbiol. 2003, 154, 337–344. [Google Scholar] [CrossRef]
- Somerville, G.A.; Saïd-Salim, B.; Wickman, J.M.; Raffel, S.J.; Kreiswirth, B.N.; Musser, J.M. Correlation of Acetate Catabolism and Growth Yield in Staphylococcus aureus: Implications for Host-Pathogen Interactions. Infect. Immun. 2003, 71, 4724–4732. [Google Scholar] [CrossRef] [PubMed]
- Suthi, S.; Mounika, A.; Potukuchi, V.G.K.S. Elevated acetate kinase (ackA) gene expression, activity, and biofilm formation observed in methicillin-resistant strains of Staphylococcus aureus (MRSA). J. Genet. Eng. Biotechnol. 2023, 21, 100. [Google Scholar] [CrossRef]
- Silva, V.; Almeida, L.; Gaio, V.; Cerca, N.; Manageiro, V.; Caniça, M.; Capelo, J.L.; Igrejas, G.; Poeta, P. Biofilm Formation of Multidrug-Resistant MRSA Strains Isolated from Different Types of Human Infections. Pathogens 2021, 10, 970. [Google Scholar] [CrossRef] [PubMed]
- Karygianni, L.; Ren, Z.; Koo, H.; Thurnheer, T. Biofilm Matrixome: Extracellular Components in Structured Microbial Communities. Trends Microbiol. 2020, 28, 668–681. [Google Scholar] [CrossRef]
- Clarridge, J.E.; Harrington, A.T.; Roberts, M.C.; Soge, O.O.; Maquelin, K. Impact of Strain Typing Methods on Assessment of Relationship between Paired Nares and Wound Isolates of Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol. 2013, 51, 224–231. [Google Scholar] [CrossRef] [PubMed]
- Cascioferro, S.; Carbone, D.; Parrino, B.; Pecoraro, C.; Giovannetti, E.; Cirrincione, G.; Diana, P. Therapeutic Strategies To Counteract Antibiotic Resistance in MRSA Biofilm-Associated Infections. ChemMedChem 2021, 16, 65–80. [Google Scholar] [CrossRef] [PubMed]
- Craft, K.M.; Nguyen, J.M.; Berg, L.J.; Townsend, S.D. Methicillin-resistant Staphylococcus aureus (MRSA): Antibiotic-resistance and the biofilm phenotype. MedChemComm 2019, 10, 1231–1241. [Google Scholar] [CrossRef]
- Ou, F.; McGoverin, C.; Swift, S.; Vanholsbeeck, F. Rapid and cost-effective evaluation of bacterial viability using fluorescence spectroscopy. Anal. Bioanal. Chem. 2019, 411, 3653–3663. [Google Scholar] [CrossRef] [PubMed]
- Stiefel, P.; Schmidt-Emrich, S.; Maniura-Weber, K.; Ren, Q. Critical aspects of using bacterial cell viability assays with the fluorophores SYTO9 and propidium iodide. BMC Microbiol. 2015, 15, 36. [Google Scholar] [CrossRef] [PubMed]
- McGoverin, C.; Robertson, J.; Jonmohamadi, Y.; Swift, S.; Vanholsbeeck, F. Species Dependence of SYTO 9 Staining of Bacteria. Front. Microbiol. 2020, 11, 545419. [Google Scholar] [CrossRef] [PubMed]
- Lade, H.; Kim, J.-S. Molecular Determinants of β-Lactam Resistance in Methicillin-Resistant Staphylococcus aureus (MRSA): An Updated Review. Antibiotics 2023, 12, 1362. [Google Scholar] [CrossRef]
- Peacock, S.J.; Paterson, G.R. Mechanisms of Methicillin Resistance in Staphylococcus aureus. Annu. Rev. Biochem. 2015, 84, 577–601. [Google Scholar] [CrossRef] [PubMed]
- Jenul, C.; Horswill, A.R. Regulation of Staphylococcus aureus Virulence. Microbiol. Spectr. 2019, 7, 10-1128. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Ray, P. Quorum Sensing-Mediated Regulation of Staphylococcal Virulence and Antibiotic Resistance. Future Microbiol. 2014, 9, 669–681. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.; Lee, H.-J.; Jo, S.-H.; Kim, M.-G.; Lee, Y.; Lee, W.; Kim, W.; Joo, H.-S.; Kim, Y.-G.; Kim, J.-S.; et al. Study of SarA by DNA Affinity Capture Assay (DACA) Employing Three Promoters of Key Virulence and Resistance Genes in Methicillin-Resistant Staphylococcus aureus. Antibiotics 2022, 11, 1714. [Google Scholar] [CrossRef]
- Abdelhady, W.; Bayer, A.S.; Seidl, K.; Moormeier, D.E.; Bayles, K.W.; Cheung, A.; Yeaman, M.R.; Xiong, Y.Q. Impact of Vancomycin on sarA-Mediated Biofilm Formation: Role in Persistent Endovascular Infections Due to Methicillin-Resistant Staphylococcus aureus. J. Infect. Dis. 2014, 209, 1231–1240. [Google Scholar] [CrossRef]
- Argudín, M.Á.; Mendoza, M.C.; Rodicio, M.R. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef]
- Fisher, E.L.; Otto, M.; Cheung, G.Y.C. Basis of Virulence in Enterotoxin-Mediated Staphylococcal Food Poisoning. Front. Microbiol. 2018, 9, 436. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Hu, Z.; Li, S.; Fang, R.; Ono, H.K.; Hu, D.-L. Molecular Characteristics and Pathogenicity of Staphylococcus aureus Exotoxins. Int. J. Mol. Sci. 2024, 25, 395. [Google Scholar] [CrossRef] [PubMed]
- NIST Standard Reference Database. Number 69 Gas Chromatography—Retention Indices. Available online: https://webbook.nist.gov/cgi/cbook.cgi?ID=64-19-7 (accessed on 6 May 2024).
- Babushok, V.I.; Linstrom, P.J.; Zenkevichb, I.G. Retention indices for frequently reported compounds of plant essential oils. J. Phys. Chem. Ref. Data 2011, 40, 043101. [Google Scholar] [CrossRef]
- Van Den Dool, H.; Kratz, P.D. Generalization of the retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. 1963, 11, 463–471. [Google Scholar] [CrossRef] [PubMed]
- Vitko, N.P.; Richardson, A.R. Laboratory Maintenance of Methicillin-Resistant Staphylococcus aureus (MRSA). Curr. Protoc. Microbiol. 2013, 28, 9C.2.1–9C.2.14. [Google Scholar] [CrossRef] [PubMed]
- Kluytmans-Van Den Bergh, M.F.Q.; Vos, M.C.; Diederen, B.M.W.; Vandenbroucke-Grauls, C.M.J.E.; Voss, A.; Kluytmans, J.A.J.W.; Dutch Working Group on the Laboratory Detection of Highly Resistant Microorganisms. Dutch guideline on the laboratory detection of methicillin-resistant Staphylococcus aureus. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 89–101. [Google Scholar] [CrossRef] [PubMed]
- Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically, 7th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2006. [Google Scholar]
- Ball, A.L.; Augenstein, E.D.; Wienclaw, T.M.; Richmond, B.C.; Freestone, C.A.; Lewis, J.M.; Berges, B.K. Characterization of Staphylococcus aureus biofilms via crystal violet binding and biochemical composition assays of isolates from hospitals, raw meat, and biofilm-associated gene mutants. Microb. Pathog. 2022, 167, 105554. [Google Scholar] [CrossRef] [PubMed]
- de Souza, M.R.; Teixeira, R.C.; Daúde, M.M.; Augusto, A.N.L.; Ságio, S.A.; de Almeida, A.F.; Barreto, H.G. Comparative assessment of three RNA extraction methods for obtaining high-quality RNA from Candida viswanathii biomass. J. Microbiol. Methods 2021, 184, 106200. [Google Scholar] [CrossRef] [PubMed]
Retention Indices | Compounds | Peak Area (%) c | |
---|---|---|---|
Apolar a | Polar b | ||
788 | 1087 | n-Hexanal | 0.11 |
849 | 1380 | cis-Hexen-1-ol | 0.14 |
862 | 1356 | n-Hexanol | 0.09 |
887 | - | Santene | 0.10 |
920 | 1009 | Tricyclene | 0.28 |
928 | 1029 | α-Thujene | 0.14 |
931 | 1027 | α-Pinene | 1.15 |
948 | 1070 | Camphene | 6.33 |
964 | 1123 | Sabinene | 0.54 |
973 | 1110 | β-Pinene | 0.44 |
979 | - | 1,2,4-Trimethylbenzene | 0.06 |
985 | 1167 | Myrcene | 0.08 |
1008 | 1181 | α-Terpinene | 0.43 |
1016 | 1276 | ρ-Cymene | 0.47 |
1019 | 1196 | Limonene | 0.19 |
1021 | 1122 | β-Phellandrene | 0.19 |
1023 | 1213 | 1,8-Cineole | 2.66 |
1073 | 1430 | ρ-Cymenene | 0.44 |
1086 | 1283 | α-Terpinolene | 0.18 |
1091 | 1427 | α-Thujone | 1.94 |
1095 | 1441 | β-Thujone | 0.40 |
1101 | 1537 | Linalool | 0.33 |
1123 | 1518 | Camphor | 39.69 |
1129 | 1721 | trans-Sabinol | 0.08 |
1130 | - | trans-Verbenol | 0.04 |
1136 | 1564 | Pinocarvone | 0.10 |
1149 | 1701 | Borneol | 2.23 |
1157 | 1763 | cis-Chrysanthenol | 2.79 |
1164 | 1662 | ρ-Mentha-1,5-dien-8-ol | 0.22 |
1168 | 1599 | Terpinen-4-ol | 0.07 |
1173 | 1697 | α-Terpineol | 0.18 |
1179 | 1798 | Myrtenol | 0.15 |
1191 | 1845 | cis-Carveol | 0.10 |
1200 | 1200 | Dodecane | 0.13 |
1207 | 1796 | Cuminaldehyde | 0.13 |
1211 | 1732 | Carvone | 0.14 |
1218 | - | cis-3-Hexeny lisovalerate | 0.24 |
1221 | 1725 | Piperitone | 0.29 |
1246 | 1569 | cis-Chrysanthenyl acetate | 0.50 |
1267 | 1575 | Bornyl acetate | 5.42 |
1274 | - | trans, cis-2,4-Decadienal | 0.12 |
1280 | 2212 | Thymol | 0.07 |
1288 | - | Myrtenyl acetate | 0.07 |
1301 | - | trans-Carvyl acetate | 0.15 |
1326 | 1679 | α-Terpinyl acetate | 0.11 |
1354 | 2164 | Eugenol | 0.09 |
1368 | 1493 | α-Copaene | 0.65 |
1373 | 1526 | Berkheyaradulen | 0.04 |
1383 | 1582- | β-Elemene | 0.33 |
1392 | - | α-Gurjunene | 0.07 |
1400 | 1400 | Tetradecane | 0.04 |
1410 | 1590 | trans-β-Caryophyllene | 0.85 |
1449 | 1646 | cis-β-Farnesene | 0.27 |
1469 | 1737 | Germacrene D | 0.42 |
1479 | 1783 | ar-Curcumene | 0.25 |
1483 | 1720 | β-Selinene | 0.31 |
1492 | 1714 | Zingiberene | 0.09 |
1667 | 1456 | trans-β-Farnesene | 0.16 |
1500 | 1500 | Pentadcecane | 0.11 |
1510 | 1752 | δ-Cadinene | 0.15 |
1516 | 1775 | β-Sesquiphellandrene | 0.33 |
1563 | 2020 | trans-Caryophyllene oxide | 0.26 |
1566 | 1943 | 1,5-Epoxysalvial-4(14)-ene | 1.22 |
1569 | - | Globulol | 0.38 |
1571 | 2118 | Spathulenol | 1.30 |
1577 | - | Salvial-4(14)-en-1-one | 0.12 |
1586 | 2043 | Viridiflorol | 0.22 |
1589 | - | Guaiol | 0.29 |
1600 | 1600 | Hexadecane | 0.59 |
1605 | 2088 | Cubenol | 0.59 |
1609 | 2167 | Torreyol | 1.44 |
1614 | 2218 | β-Eudesmol | 0.93 |
1620 | 2180 | τ-Muurolol | 0.45 |
1630 | 2223 | α-Cadinol | 5.77 |
1645 | 2210 | α-Bisabolol | 0.28 |
1657 | 2244 | cis,cis-Farnesol | 0.24 |
1700 | 1700 | Heptadecane | 0.13 |
1712 | 2368 | Chamazulene | 0.10 |
1714 | 2330 | α-Cyperone | 0.41 |
1800 | 1800 | Octadecane | 0.38 |
1830 | 2128 | 6,10,14-Trimethyl-2-pentadecanone | 0.47 |
1900 | 1900 | Nonadecane | 0.52 |
2000 | 2000 | Eicosane | 0.08 |
2100 | 2100 | Heneicosane | 0.32 |
2000 | - | Docosane | 0.04 |
2300 | 2300 | Tricosane | 0.66 |
2400 | - | Tetracosane | 0.05 |
2500 | 2500 | Pentacosane | 0.54 |
Total | 91.65 |
Category | Sub-Class | Compound | Total (%) |
---|---|---|---|
Monoterpenes | Hydrocarbons | Santene, Tricyclene, α-Thujene, α-Pinene, Camphene, Sabinene, β-Pinene, Myrcene, α-Terpinene, ρ-Cymene, Limonene, β-Phellandrene, ρ-Cymenene, α-Terpinolene | 10.96 |
Alcohols | Linalool, trans-Sabinol, trans-Verbenol, Borneol, cis-Chrysanthenol, ρ-Mentha-1,5-dien-8-ol, Terpinen-4-ol, α-Terpineol, Myrtenol, cis-Carveol, 1,8-Cineole, Thymol | 8.92 | |
Aldehydes | Cuminaldehyde | 0.13 | |
Esters | cis-Chrysanthenyl acetate, Bornyl acetate, Myrtenyl acetate, trans-Carvyl acetate, α-Terpinyl acetate | 6.25 | |
Ketones | α-Thujone, β-Thujone, Camphor, Pinocarvone, Carvone, Piperitone | 42.56 | |
Sesquiterpenes | Hydrocarbons | β-Elemene, α-Gurjunene, trans-β-Caryophyllene, cis-β-Farnesene, Germacrene D, ar-Curcumene, β-Selinene, Zingiberene, trans-β-Farnesene, β-Sesquiphellandrene, α-Copaene, Berkheyaradulen, δ-Cadinene | 3.92 |
Alcohols | Globulol, Spathulenol, Viridiflorol, Guaiol, Cubenol, Torreyol, β-Eudesmol, τ-Muurolol, α-Cadinol, α-Bisabolol, cis, cis-Farnesol | 11.89 | |
Ketones & epoxides | Salvial-4(14)-en-1-one, α-Cyperone, trans-Caryophyllene oxide, 1,5-Epoxysalvial-4(14)-ene | 2.01 | |
Others | Alkanes | Dodecane, Tetradecane, Pentadcecane, Hexadecane, Heptadecane, Octadecane, Nonadecane, Eicosane, Heneicosane, Docosane, Tricosane, Tetracosane, Pentacosane | 3.59 |
Alcohols and aldehyde | n-Hexanal, cis-Hexen-1-ol, n-Hexanol, trans, cis-2,4-Decadienal | 0.46 | |
Esters | cis-3-Hexenyl isovalerate, | 0.24 | |
Miscellaneous | 1,2,4-Trimethylbenzene, Chamazulene, 6,10,14-Trimethyl-2-pentadecanone, Eugenol | 0.72 |
Concentration (g/L) | a Pre-Incubation pH (Mean ± SD) | Post-Incubation pH (Mean ± SD) | b ΔpH (Acid Production) | c Inhibition Rate (%) |
---|---|---|---|---|
Control | 7.46 ± 0.00 | 5.96 ± 0.01 | 1.50 | 0% |
0.3 | 7.45 ± 0.00 | 6.53 ± 0.02 * | 0.92 | 38.58% |
0.4 | 7.46 ± 0.01 | 6.80 ± 0.04 * | 0.65 | 56.54% |
0.5 | 7.44 ± 0.01 | 7.13 ± 0.03 * | 0.31 | 79.38% |
0.6 | 7.44 ± 0.01 | 7.40 ± 0.01 * | 0.05 | 96.90% |
Vancomycin (2 mg/L) | 7.46 ± 0.00 | 7.41 ± 0.02 * | 0.05 | 96.45% |
Parameter | GC Analysis Conditions | GC–MS Analysis Conditions | |||||||
---|---|---|---|---|---|---|---|---|---|
Instrument | Hewlett-Packard 6890 Series GC | Agilent Technologies 7890A GC, 5975C Mass Selective Detector | |||||||
Detector | Flame Ionization Detector (FID) | Mass Selective Detector (EI mode, 70 eV) | |||||||
Column (Dimensions) | DB-1, DB-wax (30 m × 0.25 mm i.d., 0.25 μm film thickness) | DB-1, DB-wax (30 m × 0.25 mm i.d., 0.25 μm film thickness) | |||||||
Column Temperature | Unit | °C/min | Temp. (°C) | Hold (min) | Unit | °C/min | Temp. (°C) | Hold (min) | |
Initial | - | 40 | - | Initial | - | 40 | - | ||
Ramp 1 | 2 | 230 | 20 | Ramp 1 | 2 | 230 | 20 | ||
Injector Temperature | 250 °C | 250 °C | |||||||
Detector Temperature | 250 °C | Not applicable | |||||||
Ion Source Temperature | Not applicable | 250 °C | |||||||
Carrier Gas | Nitrogen, 1 mL/min | Helium, 1 mL/min | |||||||
Component Identification | Comparison with the retention time (RT) position and literature | Comparison with NIST/NBS mass spectral database and literature |
Gene | Sequences (5′→3′) | Tm (°C) | Base Count (nt) | GC Ratio (%) | |
---|---|---|---|---|---|
agrA | Forward Primer | TGATAATCCTTATGAGGTGCTT | 53.7 | 22 | 36.36 |
Reverse Primer | TGATAATCCTTATGAGGTGCTT | 55.6 | 21 | 42.86 | |
mecA | Forward Primer | GTTAGATTGGGATCATAGCGTCATT | 58.1 | 25 | 40 |
Reverse Primer | TGCCTACTCATGTGTTCCTGTAT | 59 | 27 | 37.04 | |
sarA | Forward Primer | TGTTATCAATGGTCACTTATGCTG | 56.3 | 24 | 37.5 |
Reverse Primer | TCTTTGTTTTCGCTGATGTATGTC | 57.1 | 24 | 37.5 | |
sea | Forward Primer | ATGGTGCTTATTAGGTGTATC | 50.1 | 21 | 33.33 |
Reverse Primer | CGTTTCCAAAGGTAGTGTTATT | 52.9 | 21 | 38.1 | |
16s rRNA | Forward Primer | ACTGGGATAACTTCGGGAAA | 55.2 | 20 | 45 |
Reverse Primer | CGTTGCCTTGGTAAGCC | 54.9 | 17 | 58.82 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-H.; Park, B.-I.; Kim, Y.-H.; Yoon, J.-S.; Choi, N.-Y.; Kim, K.-J. Chrysanthemum zawadskii var. latilobum Flower Essential Oil Reduces MRSA Pathogenicity by Inhibiting Virulence Gene Expression. Molecules 2025, 30, 553. https://doi.org/10.3390/molecules30030553
Kim J-H, Park B-I, Kim Y-H, Yoon J-S, Choi N-Y, Kim K-J. Chrysanthemum zawadskii var. latilobum Flower Essential Oil Reduces MRSA Pathogenicity by Inhibiting Virulence Gene Expression. Molecules. 2025; 30(3):553. https://doi.org/10.3390/molecules30030553
Chicago/Turabian StyleKim, Ji-Hee, Bog-Im Park, Young-Hoi Kim, Ji-Su Yoon, Na-Young Choi, and Kang-Ju Kim. 2025. "Chrysanthemum zawadskii var. latilobum Flower Essential Oil Reduces MRSA Pathogenicity by Inhibiting Virulence Gene Expression" Molecules 30, no. 3: 553. https://doi.org/10.3390/molecules30030553
APA StyleKim, J.-H., Park, B.-I., Kim, Y.-H., Yoon, J.-S., Choi, N.-Y., & Kim, K.-J. (2025). Chrysanthemum zawadskii var. latilobum Flower Essential Oil Reduces MRSA Pathogenicity by Inhibiting Virulence Gene Expression. Molecules, 30(3), 553. https://doi.org/10.3390/molecules30030553