Efficacy of Trametinib in Alleviating Cisplatin-Induced Acute Kidney Injury: Inhibition of Inflammation, Oxidative Stress, and Tubular Cell Death in a Mouse Model
Abstract
:1. Introduction
2. Results
2.1. Effects of Trametinib on Cisplatin-Induced Renal Dysfunction and Structural Damage
2.2. Effects of Trametinib on Cisplatin-Induced Inflammation
2.3. Effects of Trametinib on Cisplatin-Induced Oxidative Stress
2.4. Effects of Trametinib on Cisplatin-Induced Cell Death
3. Discussion
4. Materials and Methods
4.1. Animals and Treatment
4.2. Biochemical Measurements
4.3. Histopathological and Immunostaining Procedures
4.4. Western Blot Analysis
4.5. Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
4.6. TUNEL Staining
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef]
- McSweeney, K.R.; Gadanec, L.K.; Qaradakhi, T.; Ali, B.A.; Zulli, A.; Apostolopoulos, V. Mechanisms of Cisplatin-Induced Acute Kidney Injury: Pathological Mechanisms, Pharmacological Interventions, and Genetic Mitigations. Cancers 2021, 13, 1572. [Google Scholar] [CrossRef]
- Tang, C.; Livingston, M.J.; Safirstein, R.; Dong, Z. Cisplatin nephrotoxicity: New insights and therapeutic implications. Nat. Rev. Nephrol. 2023, 19, 53–72. [Google Scholar] [CrossRef]
- Miller, R.P.; Tadagavadi, R.K.; Ramesh, G.; Reeves, W.B. Mechanisms of Cisplatin Nephrotoxicity. Toxins 2010, 2, 2490–2518. [Google Scholar] [CrossRef]
- Gómez-Sierra, T.; Eugenio-Pérez, D.; Sánchez-Chinchillas, A.; Pedraza-Chaverri, J. Role of food-derived antioxidants against cisplatin induced-nephrotoxicity. Food Chem. Toxicol. 2018, 120, 230–242. [Google Scholar] [CrossRef]
- Zhang, J.; Ye, Z.W.; Tew, K.D.; Townsend, D.M. Cisplatin chemotherapy and renal function. Adv. Cancer Res. 2021, 152, 305–327. [Google Scholar]
- Yang, Y.; Liu, H.; Liu, F.; Dong, Z. Mitochondrial dysregulation and protection in cisplatin nephrotoxicity. Arch. Toxicol. 2014, 88, 1249–1256. [Google Scholar] [CrossRef]
- Alassaf, N.; Attia, H. Autophagy and necroptosis in cisplatin-induced acute kidney injury: Recent advances regarding their role and therapeutic potential. Front. Pharmacol. 2023, 14, 1103062. [Google Scholar] [CrossRef]
- Li, J.; Zheng, S.; Fan, Y.; Tan, K. Emerging significance and therapeutic targets of ferroptosis: A potential avenue for human kidney diseases. Cell Death Dis. 2023, 14, 628. [Google Scholar] [CrossRef]
- Liu, Y.; Lei, H.; Zhang, W.; Xing, Q.; Liu, R.; Wu, S.; Liu, Z.; Yan, Q.; Li, W.; Liu, X.; et al. Pyroptosis in renal inflammation and fibrosis: Current knowledge and clinical significance. Cell Death Dis. 2023, 14, 472. [Google Scholar] [CrossRef]
- Lucas, R.M.; Luo, L.; Stow, J.L. ERK1/2 in immune signalling. Biochem. Soc. Trans. 2022, 50, 1341–1352. [Google Scholar] [CrossRef]
- Zhang, H.J.; Liao, H.Y.; Bai, D.Y.; Wang, Z.Q.; Xie, X.W. MAPK/ERK signaling pathway: A potential target for the treatment of intervertebral disc degeneration. Biomed. Pharmacother. 2021, 143, 112170. [Google Scholar] [CrossRef]
- Guo, Y.J.; Pan, W.W.; Liu, S.B.; Shen, Z.F.; Xu, Y.; Hu, L.L. ERK/MAPK signalling pathway and tumorigenesis. Exp. Ther. Med. 2020, 19, 1997–2007. [Google Scholar] [CrossRef]
- Jo, S.K.; Cho, W.Y.; Sung, S.A.; Kim, H.K.; Won, N.H. MEK inhibitor, U0126, attenuates cisplatin-induced renal injury by decreasing inflammation and apoptosis. Kidney Int. 2005, 67, 458–466. [Google Scholar] [CrossRef]
- Kim, H.J.; Ravichandran, K.; Ozkok, A.; Wang, Q.; He, Z.; Jani, A.; Ljubanovic, D.; Douglas, I.S.; Edelstein, C.L. The water-soluble triptolide derivative PG490-88 protects against cisplatin-induced acute kidney injury. J. Pharmacol. Exp. Ther. 2014, 349, 518–525. [Google Scholar] [CrossRef]
- Wang, S.; Wei, Q.; Dong, G.; Dong, Z. ERK-mediated suppression of cilia in cisplatin-induced tubular cell apoptosis and acute kidney injury. Biochim. Biophys. Acta 2013, 1832, 1582–1590. [Google Scholar] [CrossRef]
- Xue, H.; Li, J.; Xie, H.; Wang, Y. Review of Drug Repositioning Approaches and Resources. Int. J. Biol. Sci. 2018, 14, 1232–1244. [Google Scholar] [CrossRef]
- Flaherty, K.T.; Robert, C.; Hersey, P.; Nathan, P.; Garbe, C.; Milhem, M.; Demidov, L.V.; Hassel, J.C.; Rutkowski, P.; Mohr, P.; et al. Improved survival with MEK inhibition in BRAF-mutated melanoma. N. Engl. J. Med. 2012, 367, 107–114. [Google Scholar] [CrossRef]
- Chung, C.; Reilly, S. Trametinib: A novel signal transduction inhibitor for the treatment of metastatic cutaneous melanoma. Am. J. Health Syst. Pharm. 2015, 72, 101–110. [Google Scholar] [CrossRef]
- Brown, C.N.; Atwood, D.J.; Pokhrel, D.; Ravichandran, K.; Holditch, S.J.; Saxena, S.; Miyazaki, M.; Nemenoff, R.; Weiser-Evans, M.C.M.; Ljubanovic, D.G.; et al. The effect of MEK1/2 inhibitors on cisplatin-induced acute kidney injury (AKI) and cancer growth in mice. Cell. Signal. 2020, 71, 109605. [Google Scholar] [CrossRef]
- Jo, J.; Kim, J.-Y.; Leem, J. Protective Effects of Orexin A in a Murine Model of Cisplatin-Induced Acute Kidney Injury. J. Clin. Med. 2022, 11, 7196. [Google Scholar] [CrossRef]
- Marable, S.S.; Chung, E.; Adam, M.; Potter, S.S.; Park, J.S. Hnf4a deletion in the mouse kidney phenocopies Fanconi renotubular syndrome. JCI Insight 2018, 3, e97497. [Google Scholar] [CrossRef]
- Sanagawa, A.; Hotta, Y.; Mori, N.; Tomita, N.; Kataoka, T.; Tohkin, M.; Kimura, K. BRAF/MEK inhibitor-associated nephrotoxicity in a real-world setting and human kidney cells. Anticancer Drugs 2021, 32, 1076–1083. [Google Scholar] [CrossRef]
- Das, R.; Kim, S.J.; Nguyen, N.T.; Kwon, H.J.; Cha, S.K.; Park, K.S. Inhibition of the ERK1/2-mTORC1 axis ameliorates proteinuria and the fibrogenic action of transforming growth factor-β in Adriamycin-induced glomerulosclerosis. Kidney Int. 2019, 96, 927–941. [Google Scholar] [CrossRef]
- Andrikopoulos, P.; Kieswich, J.; Pacheco, S.; Nadarajah, L.; Harwood, S.M.; O’Riordan, C.E.; Thiemermann, C.; Yaqoob, M.M. The MEK Inhibitor Trametinib Ameliorates Kidney Fibrosis by Suppressing ERK1/2 and mTORC1 Signaling. J. Am. Soc. Nephrol. 2019, 30, 33–49. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. [Google Scholar] [CrossRef]
- Nozaki, Y.; Kinoshita, K.; Yano, T.; Asato, K.; Shiga, T.; Hino, S.; Niki, K.; Nagare, Y.; Kishimoto, K.; Shimazu, H.; et al. Signaling through the interleukin-18 receptor α attenuates inflammation in cisplatin-induced acute kidney injury. Kidney Int. 2012, 82, 892–902. [Google Scholar] [CrossRef]
- Zhang, B.; Ramesh, G.; Norbury, C.C.; Reeves, W.B. Cisplatin-induced nephrotoxicity is mediated by tumor necrosis factor-alpha produced by renal parenchymal cells. Kidney Int. 2007, 72, 37–44. [Google Scholar] [CrossRef]
- Ramesh, G.; Reeves, W.B. TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J. Clin. Investig. 2002, 110, 835–842. [Google Scholar] [CrossRef]
- Li, A.; Wang, J.; Zhu, D.; Zhang, X.; Pan, R.; Wang, R. Arctigenin suppresses transforming growth factor-β1-induced expression of monocyte chemoattractant protein-1 and the subsequent epithelial-mesenchymal transition through reactive oxygen species-dependent ERK/NF-κB signaling pathway in renal tubular epithelial cells. Free Radic. Res. 2015, 49, 1095–1113. [Google Scholar]
- Liu, E.; Lv, L.; Zhan, Y.; Ma, Y.; Feng, J.; He, Y.; Wen, Y.; Zhang, Y.; Pu, Q.; Ji, F.; et al. METTL3/N6-methyladenosine/miR-21-5p promotes obstructive renal fibrosis by regulating inflammation through SPRY1/ERK/NF-κB pathway activation. J. Cell. Mol. Med. 2021, 25, 7660–7674. [Google Scholar] [CrossRef]
- Zhang, Q.; Liu, L.; Hu, Y.; Shen, L.; Li, L.; Wang, Y. Kv1.3 channel is involved in ox-LDL-induced macrophage inflammation via ERK/NF-kappaB signaling pathway. Arch. Biochem. Biophys. 2022, 730, 109394. [Google Scholar] [CrossRef]
- Yu, C.; Li, Z.; Nie, C.; Chang, L.; Jiang, T. Targeting Src homology phosphatase 2 ameliorates mouse diabetic nephropathy by attenuating ERK/NF-κB pathway-mediated renal inflammation. Cell Commun. Signal. 2023, 21, 362. [Google Scholar] [CrossRef]
- Yang, Q.; Wu, F.R.; Wang, J.N.; Gao, L.; Jiang, L.; Li, H.D.; Ma, Q.; Liu, X.Q.; Wei, B.; Zhou, L.; et al. Nox4 in renal diseases: An update. Free Radic. Biol. Med. 2018, 124, 466–472. [Google Scholar] [CrossRef]
- Meng, X.M.; Ren, G.L.; Gao, L.; Yang, Q.; Li, H.D.; Wu, W.F.; Huang, C.; Zhang, L.; Lv, X.W.; Li, J. NADPH oxidase 4 promotes cisplatin-induced acute kidney injury via ROS-mediated programmed cell death and inflammation. Lab. Investig. 2018, 98, 63–78. [Google Scholar] [CrossRef]
- Gao, Y.; Lu, X.; Zhang, G.; Liu, C.; Sun, S.; Mao, W.; Jiang, G.; Zhou, Y.; Zhang, N.; Tao, S.; et al. DRD4 alleviates acute kidney injury by suppressing ISG15/NOX4 axis-associated oxidative stress. Redox Biol. 2024, 70, 103078. [Google Scholar] [CrossRef]
- Xia, Z.; Wei, Z.; Li, X.; Liu, Y.; Gu, X.; Huang, S.; Zhang, X.; Wang, W. C/EBPα aggravates renal fibrosis in CKD through the NOX4-ROS-apoptosis pathway in tubular epithelial cells. Biochim. Biophys. Acta Mol. Basis Dis. 2024, 1870, 167039. [Google Scholar] [CrossRef]
- Lee, S.R.; Lee, H.E.; Yoo, J.Y.; An, E.J.; Song, S.J.; Han, K.H.; Cha, D.R.; Bae, Y.S. Nox4-SH3YL1 complex is involved in diabetic nephropathy. iScience 2024, 27, 108868. [Google Scholar] [CrossRef]
- Lee, C.F.; Qiao, M.; Schröder, K.; Zhao, Q.; Asmis, R. Nox4 is a novel inducible source of reactive oxygen species in monocytes and macrophages and mediates oxidized low density lipoprotein-induced macrophage death. Circ. Res. 2010, 106, 1489–1497. [Google Scholar] [CrossRef]
- Kim, S.J.; Kim, Y.S.; Kim, J.H.; Jang, H.Y.; Ly, D.D.; Das, R.; Park, K.S. Activation of ERK1/2-mTORC1-NOX4 mediates TGF-β1-induced epithelial-mesenchymal transition and fibrosis in retinal pigment epithelial cells. Biochem. Biophys. Res. Commun. 2020, 529, 747–752. [Google Scholar] [CrossRef]
- Fu, C.N.; Wei, H.; Gao, W.S.; Song, S.S.; Yue, S.W.; Qu, Y.J. Obesity increases neuropathic pain via the AMPK-ERK-NOX4 pathway in rats. Aging 2021, 13, 18606–18619. [Google Scholar] [CrossRef] [PubMed]
- Suman, I.; Šimić, L.; Čanadi Jurešić, G.; Buljević, S.; Klepac, D.; Domitrović, R. The interplay of mitophagy, autophagy, and apoptosis in cisplatin-induced kidney injury: Involvement of ERK signaling pathway. Cell Death Discov. 2024, 10, 98. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Ma, H.; Shao, J.; Wu, J.; Zhou, L.; Zhang, Z.; Wang, Y.; Huang, Z.; Ren, J.; Liu, S.; et al. A Role for Tubular Necroptosis in Cisplatin-Induced AKI. J. Am. Soc. Nephrol. 2015, 26, 2647–2658. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.N.; Liu, M.M.; Wang, F.; Wei, B.; Yang, Q.; Cai, Y.T.; Chen, X.; Liu, X.Q.; Jiang, L.; Li, C.; et al. RIPK1 inhibitor Cpd-71 attenuates renal dysfunction in cisplatin-treated mice via attenuating necroptosis, inflammation and oxidative stress. Clin. Sci. 2019, 133, 1609–1627. [Google Scholar] [CrossRef] [PubMed]
- Ning, Y.; Shi, Y.; Chen, J.; Song, N.; Cai, J.; Fang, Y.; Yu, X.; Ji, J.; Ding, X. Necrostatin-1 Attenuates Cisplatin-Induced Nephrotoxicity Through Suppression of Apoptosis and Oxidative Stress and Retains Klotho Expression. Front. Pharmacol. 2018, 9, 384. [Google Scholar] [CrossRef] [PubMed]
- Sears, S.M.; Orwick, A.; Siskind, L.J. Modeling Cisplatin-Induced Kidney Injury to Increase Translational Potential. Nephron 2023, 147, 13–16. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Inhibition of p300 by Garcinol Protects against Cisplatin-Induced Acute Kidney Injury through Suppression of Oxidative Stress, Inflammation, and Tubular Cell Death in Mice. Antioxidants 2020, 9, 1271. [Google Scholar] [CrossRef]
- Chen, H.C.; Hou, H.Y.; Sung, J.M.; Shieh, C.C. Deletion of NADPH oxidase 2 attenuates cisplatin-induced acute kidney injury through reducing ROS-induced proximal tubular cell injury and inflammation. Front. Med. 2023, 10, 1097671. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′ → 3′) | Accession No. |
---|---|---|
TNF-α | F: CACAGAAAGCATGATCCGCGACGT R: CGGCAGAGAGGAGGTTGACTTTCT | NM_013693 |
IL-6 | F: TAGTCCTTCCTACCCCAATTTCC R: TTGGTCCTTAGCCACTCCTTC | NM_031168 |
IL-1β | F: CGCAGCAGCACATCAACAAGAGC R: TGTCCTCATCCTGGAAGGTCCACG | NM_008361 |
NOX4 | F: CCCAAGTTCCAAGCTCATTTCC R: TGGTGACAGGTTTGTTGCTCCT | NM_015760 |
GAPDH | F: ACTCCACTCACGGCAAATTC R: TCTCCATGGTGGTGAAGACA | NM_001289726 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.E.; Kim, J.-Y.; Leem, J. Efficacy of Trametinib in Alleviating Cisplatin-Induced Acute Kidney Injury: Inhibition of Inflammation, Oxidative Stress, and Tubular Cell Death in a Mouse Model. Molecules 2024, 29, 2881. https://doi.org/10.3390/molecules29122881
Lee JE, Kim J-Y, Leem J. Efficacy of Trametinib in Alleviating Cisplatin-Induced Acute Kidney Injury: Inhibition of Inflammation, Oxidative Stress, and Tubular Cell Death in a Mouse Model. Molecules. 2024; 29(12):2881. https://doi.org/10.3390/molecules29122881
Chicago/Turabian StyleLee, Joung Eun, Jung-Yeon Kim, and Jaechan Leem. 2024. "Efficacy of Trametinib in Alleviating Cisplatin-Induced Acute Kidney Injury: Inhibition of Inflammation, Oxidative Stress, and Tubular Cell Death in a Mouse Model" Molecules 29, no. 12: 2881. https://doi.org/10.3390/molecules29122881
APA StyleLee, J. E., Kim, J.-Y., & Leem, J. (2024). Efficacy of Trametinib in Alleviating Cisplatin-Induced Acute Kidney Injury: Inhibition of Inflammation, Oxidative Stress, and Tubular Cell Death in a Mouse Model. Molecules, 29(12), 2881. https://doi.org/10.3390/molecules29122881