Antioxidant, Antiapoptotic, and Anti-Inflammatory Effects of Hesperetin in a Mouse Model of Lipopolysaccharide-Induced Acute Kidney Injury
Abstract
1. Introduction
2. Results
2.1. Hesperetin Ameliorated LPS-Induced Structural Injury
2.2. Hesperetin Attenuated LPS-Induced Renal Dysfunction
2.3. Hesperetin Inhibited LPS-Induced Oxidative Stress
2.4. Hesperetin Alleviated LPS-Induced Apoptosis
2.5. Hesperetin Mitigated LPS-Induced Inflammatory Responses
3. Discussion
4. Materials and Methods
4.1. Animal Experiments
4.2. Histological Examination, IHC, and IF Staining
4.3. TUNEL Assay
4.4. Biochemial Analyses in Blood and Kidney
4.5. Western Blot Analysis
4.6. qRT-PCR
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Dolin, H.H.; Papadimos, T.J.; Chen, X.; Pan, Z.K. Characterization of Pathogenic Sepsis Etiologies and Patient Profiles: A Novel Approach to Triage and Treatment. Microbiol. Insights 2019, 12, 1–8. [Google Scholar] [CrossRef]
- Rubens, M.; Saxena, A.; Ramamoorthy, V.; Das, S.; Khera, R.; Hong, J.; Armaignac, D.; Veledar, E.; Nasir, K.; Gidel, L. Increasing Sepsis Rates in the United States: Results From National Inpatient Sample, 2005 to 2014. J. Intensive Care Med. 2020, 35, 858–868. [Google Scholar] [CrossRef] [PubMed]
- He, F.-F.; Wang, Y.-M.; Chen, Y.-Y.; Huang, W.; Li, Z.-Q.; Zhang, C. Sepsis-induced AKI: From pathogenesis to therapeutic approaches. Front. Pharmacol. 2022, 13, 981578. [Google Scholar] [CrossRef]
- Chawla, L.S.; Kimmel, P.L. Acute kidney injury and chronic kidney disease: An integrated clinical syndrome. Kidney Int. 2012, 82, 516–524. [Google Scholar] [CrossRef]
- Liu, J.; Xie, H.; Ye, Z.; Li, F.; Wang, L. Rates, predictors, and mortality of sepsis-associated acute kidney injury: A systematic review and meta-analysis. BMC Nephrol. 2020, 21, 318. [Google Scholar] [CrossRef]
- Gabarin, R.S.; Li, M.; Zimmel, P.A.; Marshall, J.C.; Li, Y.; Zhang, H. Intracellular and Extracellular Lipopolysaccharide Signaling in Sepsis: Avenues for Novel Therapeutic Strategies. J. Innate Immun. 2021, 13, 323–332. [Google Scholar] [CrossRef] [PubMed]
- Anders, H.-J.; Banas, B.; Schlöndorff, D. Signaling danger: Toll-like receptors and their potential roles in kidney disease. J. Am. Soc. Nephrol. 2004, 15, 854–867. [Google Scholar] [CrossRef] [PubMed]
- Peerapornratana, S.; Manrique-Caballero, C.L.; Gómez, H.; Kellum, J.A. Acute kidney injury from sepsis: Current concepts, epidemiology, pathophysiology, prevention and treatment. Kidney Int. 2019, 96, 1083–1099. [Google Scholar] [CrossRef] [PubMed]
- Gómez, H.; Kellum, J.A. Sepsis-induced acute kidney injury. Curr. Opin. Cirt. Care 2016, 22, 546–553. [Google Scholar] [CrossRef]
- Wang, Z.; Wu, J.; Hu, Z.; Luo, C.; Wang, P.; Zhang, Y.; Li, H. Dexmedetomidine Alleviates Lipopolysaccharide-Induced Acute Kidney Injury by Inhibiting p75NTR-Mediated Oxidative Stress and Apoptosis. Oxid. Med. Cell. Longev. 2020, 2020, 5454210. [Google Scholar] [CrossRef]
- Kim, K.; Leem, J. Hispidulin Ameliorates Endotoxin-Induced Acute Kidney Injury in Mice. Molecules 2022, 27, 2019. [Google Scholar] [CrossRef] [PubMed]
- Doi, K.; Leelahavanichkul, A.; Yuen, P.S.T.; Star, R.A. Animal models of sepsis and sepsis-induced kidney injury. J. Clin. Investig. 2009, 119, 2868–2878. [Google Scholar] [CrossRef]
- Khan, A.; Ikram, M.; Hahm, J.R.; Kim, M.O. Antioxidant and Anti-Inflammatory Effects of Citrus Flavonoid Hesperetin: Special Focus on Neurological Disorders. Antioxidants 2020, 9, 609. [Google Scholar] [CrossRef] [PubMed]
- Parhiz, H.; Roohbakhsh, A.; Soltani, F.; Rezaee, R.L.; Iranshahi, M. Antioxidant and anti-inflammatory properties of the citrus flavonoids hesperidin and hesperetin: An updated review of their molecular mechanisms and experimental models. Phytother. Res. 2015, 29, 323–331. [Google Scholar] [CrossRef]
- Liu, P.; Li, J.; Liu, M.; Zhang, M.; Xue, Y.; Zhang, Y.; Han, X.; Jing, X.; Chu, L. Hesperetin modulates the Sirt1/Nrf2 signaling pathway in counteracting myocardial ischemia through suppression of oxidative stress, inflammation, and apoptosis. Biomed. Pharmacother. 2021, 139, 111552. [Google Scholar] [CrossRef]
- Zhao, H.; Xian, G.; Zeng, J.; Zhong, G.; An, D.; Peng, Y.; Hu, D.; Lin, Y.; Li, J.; Su, S.; et al. Hesperetin, a Promising Dietary Supplement for Preventing the Development of Calcific Aortic Valve Disease. Antioxidants 2022, 11, 2093. [Google Scholar] [CrossRef]
- Li, J.; Wang, T.; Liu, P.; Yang, F.; Wang, X.; Zheng, W.; Sun, W. Hesperetin ameliorates hepatic oxidative stress and inflammation via the PI3K/AKT-Nrf2-ARE pathway in oleic acid-induced HepG2 cells and a rat model of high-fat diet-induced NAFLD. Food Funct. 2021, 12, 3898–3918. [Google Scholar] [CrossRef]
- Lin, Z.; Fu, C.; Yan, Z.; Wu, Y.; Zhan, J.; Lou, Z.; Liao, X.; Pan, J. The protective effect of hesperetin in osteoarthritis: An in vitro and in vivo study. Food Funct. 2020, 11, 2654–2666. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Lei, H.; Hu, X.; Dong, W. Hesperetin ameliorates DSS-induced colitis by maintaining the epithelial barrier via blocking RIPK3/MLKL necroptosis signaling. Eur. J. Pharmacol. 2020, 873, 172992. [Google Scholar] [CrossRef]
- Wang, N.; Geng, C.; Sun, H.; Wang, X.; Li, F.; Liu, X. Hesperetin ameliorates lipopolysaccharide-induced acute lung injury in mice through regulating the TLR4-MyD88-NF-κB signaling pathway. Arch. Pharm. Res. 2019, 42, 1063–1070. [Google Scholar] [CrossRef] [PubMed]
- Ikram, M.; Muhammad, T.; Rehman, S.U.; Khan, A.; Jo, M.G.; Ali, T.; Kim, M.O. Hesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-κB Signaling in an Aβ Mouse Model. Mol. Neurobiol. 2019, 56, 6293–6309. [Google Scholar] [CrossRef]
- Wang, H.-W.; Shi, L.; Xu, Y.-P.; Qin, X.-Y.; Wang, Q.-Z. Hesperetin alleviates renal interstitial fibrosis by inhibiting tubular epithelial-mesenchymal transition in vivo and in vitro. Exp. Ther. Med. 2017, 14, 3713–3719. [Google Scholar] [CrossRef]
- Chen, Y.-J.; Kong, L.; Tang, Z.-Z.; Zhang, Y.-M.; Liu, Y.; Wang, T.-Y.; Liu, Y.-W. Hesperetin ameliorates diabetic nephropathy in rats by activating Nrf2/ARE/glyoxalase 1 pathway. Biomed. Pharmacother. 2019, 111, 1166–1175. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Wei, W.; Li, Y.; Huang, J.; Ci, X. Hesperetin relieves cisplatin-induced acute kidney injury by mitigating oxidative stress, inflammation and apoptosis. Chem. Biol. Interact. 2019, 308, 269–278. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Dahiya, V.; Kasala, E.R.; Bodduluru, L.N.; Lahkar, M. The renoprotective activity of hesperetin in cisplatin induced nephrotoxicity in rats: Molecular and biochemical evidence. Biomed. Pharmacother. 2017, 89, 1207–1215. [Google Scholar] [CrossRef] [PubMed]
- Park, J.-H.; Leem, J.; Lee, S.-J. Protective Effects of Carnosol on Renal Interstitial Fibrosis in a Murine Model of Unilateral Ureteral Obstruction. Antioxidants 2022, 11, 2341. [Google Scholar] [CrossRef]
- Jo, J.; Kim, J.-Y.; Leem, J. Protective Effects of Orexin A in a Murine Model of Cisplatin-Induced Acute Kidney Injury. J. Clin. Med. 2022, 11, 7196. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Leem, J.; Jeon, E.J. Protective Effects of Melatonin Against Aristolochic Acid-Induced Nephropathy in Mice. Biomolecules 2020, 10, 11. [Google Scholar] [CrossRef]
- Kim, J.W.; Jo, J.; Kim, J.-Y.; Choe, M.; Leem, J.; Park, J.-H. Melatonin Attenuates Cisplatin-Induced Acute Kidney Injury through Dual Suppression of Apoptosis and Necroptosis. Biology 2019, 8, 64. [Google Scholar] [CrossRef]
- Gwon, M.-G.; Gu, H.; Leem, J.; Park, K.-K. Protective Effects of 6-Shogaol, an Active Compound of Ginger, in a Murine Model of Cisplatin-Induced Acute Kidney Injury. Molecules 2021, 26, 5931. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Choi, Y.; Leem, J.; Song, J.E. Heme Oxygenase-1 Induction by Cobalt Protoporphyrin Ameliorates Cholestatic Liver Disease in a Xenobiotic-Induced Murine Model. Int. J. Mol. Sci. 2021, 22, 8253. [Google Scholar] [CrossRef]
- Rahal, A.; Kumar, A.; Singh, V.; Yadav, B.; Tiwari, R.; Chakraborty, S.; Dhama, K. Oxidative stress, prooxidants, and antioxidants: The interplay. Biomed. Res. Int. 2014, 2014, 761264. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Leem, J.; Park, K.-K. Antioxidant, Anti-Apoptotic, and Anti-Inflammatory Effects of Farrerol in a Mouse Model of Obstructive Uropathy. Curr. Issues Mol. Biol. 2023, 45, 337–352. [Google Scholar] [CrossRef] [PubMed]
- Gu, H.; Gwon, M.-G.; Kim, J.H.; Leem, J.; Lee, S.-J. Oridonin Attenuates Cisplatin-Induced Acute Kidney Injury via Inhibiting Oxidative Stress, Apoptosis, and Inflammation in Mice. Biomed. Res. Int. 2022, 2022, 3002962. [Google Scholar] [CrossRef]
- Ronco, C.; Bellomo, R.; Kellum, J.A. Acute kidney injury. Lancet 2019, 394, 1949–1964. [Google Scholar] [CrossRef]
- Tang, C.; Livingston, M.J.; Safirstein, R.; Dong, Z. Cisplatin nephrotoxicity: New insights and therapeutic implications. Nat. Rev. Nephrol. 2023, 19, 53–72. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Park, J.-H.; Kim, K.; Jo, J.; Leem, J.; Park, K.-K. Pharmacological Inhibition of Caspase-1 Ameliorates Cisplatin-Induced Nephrotoxicity through Suppression of Apoptosis, Oxidative Stress, and Inflammation in Mice. Mediat. Inflamm. 2018, 2018, 6571676. [Google Scholar] [CrossRef]
- Wang, S.; Zeng, M.; Li, B.; Kan, Y.; Zhang, B.; Zheng, X.; Feng, W. Raw and salt-processed Achyranthes bidentata attenuate LPS-induced acute kidney injury by inhibiting ROS and apoptosis via an estrogen-like pathway. Biomed. Pharmacother. 2020, 129, 110403. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Lee, S.-J.; Maeng, Y.-I.; Leem, J.; Park, K.-K. Protective Effects of Bee Venom against Endotoxemia-Related Acute Kidney Injury in Mice. Biology 2020, 9, 154. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Leem, J.; Park, K.-K. Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules 2020, 25, 5717. [Google Scholar] [CrossRef]
- Yang, Q.; Wu, F.-R.; Wang, J.-N.; Gao, L.; Jiang, L.; Li, H.-D.; Ma, Q.; Liu, X.-Q.; Wei, B.; Zhou, L.; et al. Nox4 in renal diseases: An update. Free Radic. Biol. Med. 2018, 124, 466–472. [Google Scholar] [CrossRef]
- Li, J.; Zhang, Z.; Wang, L.; Jiang, L.; Qin, Z.; Zhao, Y.; Su, B. Maresin 1 Attenuates Lipopolysaccharide-Induced Acute Kidney Injury via Inhibiting NOX4/ROS/NF-κB Pathway. Front. Pharmacol. 2021, 12, 782660. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Leem, J.; Hong, H.L. Melittin Ameliorates Endotoxin-Induced Acute Kidney Injury by Inhibiting Inflammation, Oxidative Stress, and Cell Death in Mice. Oxid, Med. Cell. Longev. 2021, 2021, 8843051. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.-M.; Ren, G.-L.; Gao, L.; Yang, Q.; Li, H.-D.; Wu, W.-F.; Huang, C.; Zhang, L.; Lv, X.-W.; Li, J. NADPH oxidase 4 promotes cisplatin-induced acute kidney injury via ROS-mediated programmed cell death and inflammation. Lab. Investig. 2018, 98, 63–78. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Kahweol Ameliorates Cisplatin-Induced Acute Kidney Injury through Pleiotropic Effects in Mice. Biomedicines 2020, 8, 572. [Google Scholar] [CrossRef]
- Yoo, J.Y.; Cha, D.R.; Kim, B.; An, E.J.; Lee, S.R.; Cha, J.J.; Kang, Y.S.; Ghee, J.Y.; Han, J.Y.; Bae, Y.S. LPS-Induced Acute Kidney Injury Is Mediated by Nox4-SH3YL1. Cell Rep. 2020, 33, 108245. [Google Scholar] [CrossRef]
- Hong, Y.A.; Park, C.W. Catalytic Antioxidants in the Kidney. Antioxidants 2021, 10, 130. [Google Scholar] [CrossRef]
- Shree, A.; Islam, J.; Yadav, V.; Sultana, S.; Khan, H.A. Hesperetin alleviates DMH induced toxicity via suppressing oxidative stress and inflammation in the colon of Wistar rats. Environ. Toxicol. 2022, 37, 2153–2166. [Google Scholar] [CrossRef]
- Li, S.; Shao, L.; Fang, J.; Zhang, J.; Chen, Y.; Yeo, A.J.; Lavin, M.F.; Yu, G.; Shao, H. Hesperetin attenuates silica-induced lung injury by reducing oxidative damage and inflammatory response. Exp. Ther. Med. 2021, 21, 297. [Google Scholar] [CrossRef] [PubMed]
- Samie, A.; Sedaghat, R.; Baluchnejadmojarad, T.; Roghani, M. Hesperetin, a citrus flavonoid, attenuates testicular damage in diabetic rats via inhibition of oxidative stress, inflammation, and apoptosis. Life Sci. 2018, 210, 132–139. [Google Scholar] [CrossRef]
- Zaafar, D.; Khalil, H.M.A.; Rasheed, R.A.; Eltelbany, R.F.A.; Zaitone, S.A. Hesperetin mitigates sorafenib-induced cardiotoxicity in mice through inhibition of the TLR4/NLRP3 signaling pathway. PLoS ONE 2022, 17, e0271631. [Google Scholar] [CrossRef]
- Guzel, E.E.; Tektemur, N.K. Hesperetin may alleviate the development of doxorubicin-induced pulmonary toxicity by decreasing oxidative stress and apoptosis in male rats. Tissue Cell 2021, 73, 101667. [Google Scholar] [CrossRef]
- Wan, J.; Kuang, G.; Zhang, L.; Jiang, R.; Chen, Y.; He, Z.; Ye, D. Hesperetin attenuated acetaminophen-induced hepatotoxicity by inhibiting hepatocyte necrosis and apoptosis, oxidative stress and inflammatory response via upregulation of heme oxygenase-1 expression. Int. Immunopharmacol. 2020, 83, 106435. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Protective Effects of SPA0355, a Thiourea Analogue, Against Lipopolysaccharide-Induced Acute Kidney Injury in Mice. Antioxidants 2020, 9, 585. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Hong, H.-L.; Kim, G.M.; Leem, J.; Kwon, H.H. Protective Effects of Carnosic Acid on Lipopolysaccharide-Induced Acute Kidney Injury in Mice. Molecules 2021, 26, 7589. [Google Scholar] [CrossRef]
- Anderberg, S.B.; Luther, T.; Frithiof, R. Physiological aspects of Toll-like receptor 4 activation in sepsis-induced acute kidney injury. Acta. Physiol. 2017, 219, 573–588. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Jiang, H.; Wu, F.; Chi, X.; Pang, Y.; Jin, H.; Sun, Y.; Zhang, S. Neuroprotective Effects of Hesperetin in Regulating Microglia Polarization after Ischemic Stroke by Inhibiting TLR4/NF-κB Pathway. J. Healthc. Eng. 2021, 2021, 9938874. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Zhang, Q.; Wen, J.; Chen, T.; He, L.; Wang, Y.; Yin, J.; Wu, R.; Xue, R.; Li, S.; et al. Ischemic Duration and Frequency Determines AKI-to-CKD Progression Monitored by Dynamic Changes of Tubular Biomarkers in IRI Mice. Front. Physiol. 2019, 10, 153. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Inhibition of p300 by Garcinol Protects against Cisplatin-Induced Acute Kidney Injury through Suppression of Oxidative Stress, Inflammation, and Tubular Cell Death in Mice. Antioxidants 2020, 9, 1271. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′→3′) | Accession No. |
---|---|---|
NOX4 | F: TGTTGGGCCTAGGATTGTGTT R: AGGGACCTTCTGTGATCCTCG | NM_015760 |
Catalase | F: CCATCGCCAATGGCAATTAC R: AGGCCAAACCTTGGTCAGATC | NM_009804 |
MnSOD | F: GTAGGGCCTGTCCGATGATG R: CGCTACTGAGAAAGGTGCCA | NM_0136671 |
PUMA | F: AGCAGCACTTAGAGTCGCC R: CCTGGGTAAGGGGAGGAGT | NM_133234 |
Bax | F: GGTTGCCCTCTTCTACTTT R: AGCCACCCTGGTCTTG | NM_007527 |
TNF-α | F: GTTCTGTCCCTTTCACTCACTG R: GGTAGAGAATGGATGAACAC | NM_013693 |
IL-6 | F: ACGGCCTTCCCTACTTCACA R: CATTTCCACGATTTCCCAGA | NM_031168 |
IL-1β | F: CTGTCCTGATGAGAGCATCC R: TGTCCATTGAGGTGGAGAGC | NM_008361 |
TLR4 | F: GTGCCAATTTCATGGGTCT R: AGCCTGGTGACATTCCAAGACG | NM_021297 |
MyD88 | F: TCATGTTCTCCATACCCTTGGT R: AAACTGCGAGTGGGGTCAG | NM_010851 |
GAPDH | F: ATGGTGAAGGTCGGTGTGAAC R: TTGATGTTAGTGGGGTCTCGC | NM_008084 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, A.Y.; Choi, H.J.; Kim, K.; Leem, J. Antioxidant, Antiapoptotic, and Anti-Inflammatory Effects of Hesperetin in a Mouse Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules 2023, 28, 2759. https://doi.org/10.3390/molecules28062759
Yang AY, Choi HJ, Kim K, Leem J. Antioxidant, Antiapoptotic, and Anti-Inflammatory Effects of Hesperetin in a Mouse Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules. 2023; 28(6):2759. https://doi.org/10.3390/molecules28062759
Chicago/Turabian StyleYang, Ah Young, Hye Jin Choi, Kiryeong Kim, and Jaechan Leem. 2023. "Antioxidant, Antiapoptotic, and Anti-Inflammatory Effects of Hesperetin in a Mouse Model of Lipopolysaccharide-Induced Acute Kidney Injury" Molecules 28, no. 6: 2759. https://doi.org/10.3390/molecules28062759
APA StyleYang, A. Y., Choi, H. J., Kim, K., & Leem, J. (2023). Antioxidant, Antiapoptotic, and Anti-Inflammatory Effects of Hesperetin in a Mouse Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules, 28(6), 2759. https://doi.org/10.3390/molecules28062759