Construction of a Collagen-like Protein Based on Elastin-like Polypeptide Fusion and Evaluation of Its Performance in Promoting Wound Healing
Abstract
1. Introduction
2. Results
2.1. Construction and Expression of the hCol-ELP Fusion Protein
2.2. Characterization of the hCol-ELP Fusion Protein
2.3. The hCol-ELP Fusion Protein Possesses an Outstanding Capacity to Induce Cell Proliferation and Migration, as Well as to Promote Collagen Regeneration
2.4. The hCol-ELP Fusion Protein Accelerates Wound Healing In Vivo
2.5. The hCol-ELP Fusion Protein Improves the Healing Quality of the Wound Epidermis and Collagen Deposition
2.6. Detection of Expression of Wound-Tissue-Related Factors via RT-PCR
3. Discussion
4. Materials and Methods
4.1. Construction of the Fusion Protein
4.2. Protein Expression and Purification
4.3. Characterization of the Fusion Protein
4.3.1. Purity and Concentration of the Protein
4.3.2. Morphology and Structure of Protein
4.3.3. Collagen Properties of Protein
4.3.4. Stability of Protein
4.4. In Vitro Assays of Function
4.4.1. Proliferation Assay
4.4.2. In Vitro Wound Healing Assay
4.4.3. Collagen I Regeneration Assay
4.5. In Vivo Wound Healing Assay
4.5.1. Skin Wound Healing Model in Mice
4.5.2. Histological Analysis
4.5.3. Immunofluorescence Staining Analysis
4.5.4. RT-PCR Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Takeo, M.; Lee, W.; Ito, M. Wound healing and skin regeneration. Cold Spring Harb. Perspect. Med. 2015, 5, a023267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sorg, H.; Tilkorn, D.J.; Hager, S.; Hauser, J.; Mirastschijski, U. Skin Wound Healing: An Update on the Current Knowledge and Concepts. Eur. Surg. Res. 2017, 58, 81–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Zhou, C.; Luo, C.; Qian, B.; Liu, S.; Zeng, Y.; Hou, J.; Deng, B.; Sun, Y.; Yang, J.; et al. N-acetyl cysteine-loaded graphene oxide-collagen hybrid membrane for scarless wound healing. Theranostics 2019, 9, 5839–5853. [Google Scholar] [CrossRef] [Scilit]
- Boucek, R.J. Factors affecting wound healing. Otolaryngol. Clin. N. Am. 1984, 17, 243–264. [Google Scholar] [CrossRef] [Scilit]
- Carter, M.J.; Fylling, C.P.; Parnell, L.K. Use of platelet rich plasma gel on wound healing: A systematic review and meta-analysis. Eplasty 2011, 11, e38. [Google Scholar]
- Chuncharunee, A.; Waikakul, S.; Wongkajornsilp, A.; Chongkolwatana, V.; Chuncharunee, L.; Sirimontaporn, A.; Rungruang, T.; Sreekanth, G.P. Invalid freeze-dried platelet gel promotes wound healing. Saudi Pharm. J. 2019, 27, 33–40. [Google Scholar] [CrossRef] [Scilit]
- Sarangthem, V.; Singh, T.D.; Dinda, A.K. Emerging Role of Elastin-like Polypeptides in Regenerative Medicine. Adv. Wound Care 2021, 10, 257–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almine, J.F.; Wise, S.G.; Weiss, A.S. Elastin signaling in wound repair. Birth Defects Res. C Embryo Today 2012, 96, 248–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wollina, U. One-stage Reconstruction of Soft Tissue Defects with the Sandwich Technique: Collagen-elastin Dermal Template and Skin Grafts. J. Cutan. Aesthet. Surg. 2011, 4, 176–182. [Google Scholar] [CrossRef] [Scilit]
- Veit, G.; Kobbe, B.; Keene, D.R.; Paulsson, M.; Koch, M.; Wagener, R. Collagen XXVIII, a novel von Willebrand factor A domain-containing protein with many imperfections in the collagenous domain. J. Biol. Chem. 2006, 281, 3494–3504. [Google Scholar] [CrossRef] [Scilit]
- Yu, Z.; An, B.; Ramshaw, J.A.; Brodsky, B. Bacterial collagen-like proteins that form triple-helical structures. J. Struct. Biol. 2014, 186, 451–461. [Google Scholar] [CrossRef] [Scilit]
- Kadler, K.E.; Baldock, C.; Bella, J.; Boot-Handford, R.P. Collagens at a glance. J. Cell Sci. 2007, 120, 1955–1958. [Google Scholar] [CrossRef] [Scilit]
- Fields, G.B. Synthesis and biological applications of collagen-model triple-helical peptides. Org. Biomol. Chem. 2010, 8, 1237–1258. [Google Scholar] [CrossRef] [Scilit]
- Shoulders, M.D.; Raines, R.T. Collagen structure and stability. Annu. Rev. Biochem. 2009, 78, 929–958. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wang, Z.; Dong, Y. Collagen-Based Biomaterials for Tissue Engineering. ACS Biomater. Sci. Eng. 2023, 9, 1132–1150. [Google Scholar] [CrossRef] [Scilit]
- Avila Rodriguez, M.I.; Rodriguez Barroso, L.G.; Sanchez, M.L. Collagen: A review on its sources and potential cosmetic applications. J. Cosmet. Dermatol. 2018, 17, 20–26. [Google Scholar] [CrossRef] [Scilit]
- Cao, C.; Xiao, Z.; Ge, C.; Wu, Y. Animal by-products collagen and derived peptide, as important components of innovative sustainable food systems-a comprehensive review. Crit. Rev. Food Sci. Nutr. 2022, 62, 8703–8727. [Google Scholar] [CrossRef] [Scilit]
- You, S.; Liu, S.; Dong, X.; Li, H.; Zhu, Y.; Hu, L. Intravaginal Administration of Human Type III Collagen-Derived Biomaterial with High Cell-Adhesion Activity to Treat Vaginal Atrophy in Rats. ACS Biomater. Sci. Eng. 2020, 6, 1977–1988. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.; Zheng, Z.; Yuan, J.; Zhang, C.; Cao, W.; Qin, X. Collagen Peptides Derived from Sipunculus nudus Accelerate Wound Healing. Molecules 2021, 26, 1385. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Liu, Y.; Tang, L.; Xiao, H.; Yang, Z.; Wang, S. Preparation of Recombinant Human Collagen III Protein Hydrogels with Sustained Release of Extracellular Vesicles for Skin Wound Healing. Int. J. Mol. Sci. 2022, 23, 6289. [Google Scholar] [CrossRef] [Scilit]
- Chang, D.K.; Louis, M.R.; Gimenez, A.; Reece, E.M. The Basics of Integra Dermal Regeneration Template and its Expanding Clinical Applications. Semin. Plast. Surg. 2019, 33, 185–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kolokythas, P.; Aust, M.C.; Vogt, P.M.; Paulsen, F. Dermal subsitute with the collagen-elastin matrix Matriderm in burn injuries: A comprehensive review. Handchir. Mikrochir. Plast. Chir. 2008, 40, 367–371. [Google Scholar] [CrossRef] [Scilit]
- Schneider, J.; Biedermann, T.; Widmer, D.; Montano, I.; Meuli, M.; Reichmann, E.; Schiestl, C. Matriderm versus Integra: A comparative experimental study. Burns 2009, 35, 51–57. [Google Scholar] [CrossRef] [Scilit]
- De Angelis, B.; Gentile, P.; Tati, E.; Bottini, D.J.; Bocchini, I.; Orlandi, F.; Pepe, G.; Di Segni, C.; Cervelli, G.; Cervelli, V. One-Stage Reconstruction of Scalp after Full-Thickness Oncologic Defects Using a Dermal Regeneration Template (Integra). Biomed. Res. Int. 2015, 2015, 698385. [Google Scholar] [CrossRef] [Scilit]
- Qiu, X.; Wang, J.; Wang, G.; Wen, H. Vascularization of Lando((R)) dermal scaffold in an acute full-thickness skin-defect porcine model. J. Plast. Surg. Hand Surg. 2018, 52, 204–209. [Google Scholar] [CrossRef] [Scilit]
- Center for Devices and Radiological Health. Medical devices containing materials derived from animal sources (except for in vitro diagnostic devices), guidance for FDA reviewers and industry; availability—FDA. Notice. Fed. Regist. 1998, 63, 60009–60010. [Google Scholar]
- Zmurko, J.; Vasey, D.B.; Donald, C.L.; Armstrong, A.A.; McKee, M.L.; Kohl, A.; Clayton, R.F. Mitigating the risk of Zika virus contamination of raw materials and cell lines in the manufacture of biologicals. J. Gen. Virol. 2018, 99, 219–229. [Google Scholar] [CrossRef] [Scilit]
- Leikina, E.; Mertts, M.V.; Kuznetsova, N.; Leikin, S. Type I collagen is thermally unstable at body temperature. Proc. Natl. Acad. Sci. USA 2002, 99, 1314–1318. [Google Scholar] [CrossRef] [Scilit]
- Gurumurthy, B.; Pal, P.; Griggs, J.A.; Janorkar, A.V. Optimization of Collagen-Elastin-like Polypeptide-Bioglass Scaffold Composition for Osteogenic Differentiation of Adipose-Derived Stem Cells. Materialia 2020, 9, 100572. [Google Scholar] [CrossRef] [Scilit]
- Wang, K.; Meng, X.; Guo, Z. Elastin Structure, Synthesis, Regulatory Mechanism and Relationship with Cardiovascular Diseases. Front. Cell Dev. Biol. 2021, 9, 596702. [Google Scholar] [CrossRef] [Scilit]
- Reichheld, S.E.; Muiznieks, L.D.; Stahl, R.; Simonetti, K.; Sharpe, S.; Keeley, F.W. Conformational transitions of the cross-linking domains of elastin during self-assembly. J. Biol. Chem. 2014, 289, 10057–10068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mead, B.P.; Mastorakos, P.; Suk, J.S.; Klibanov, A.L.; Hanes, J.; Price, R.J. Targeted gene transfer to the brain via the delivery of brain-penetrating DNA nanoparticles with focused ultrasound. J. Control Release 2016, 223, 109–117. [Google Scholar] [CrossRef] [Scilit]
- Varanko, A.K.; Su, J.C.; Chilkoti, A. Elastin-Like Polypeptides for Biomedical Applications. Annu. Rev. Biomed. Eng. 2020, 22, 343–369. [Google Scholar] [CrossRef] [Scilit]
- MacEwan, S.R.; Hassouneh, W.; Chilkoti, A. Non-chromatographic purification of recombinant elastin-like polypeptides and their fusions with peptides and proteins from Escherichia coli. J. Vis. Exp. 2014, 88, e51583. [Google Scholar] [CrossRef] [Scilit]
- Hassouneh, W.; Christensen, T.; Chilkoti, A. Elastin-like polypeptides as a purification tag for recombinant proteins. Curr. Protoc. Protein Sci. 2010, 61, 11–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amiram, M.; Luginbuhl, K.M.; Li, X.; Feinglos, M.N.; Chilkoti, A. A depot-forming glucagon-like peptide-1 fusion protein reduces blood glucose for five days with a single injection. J. Control Release 2013, 172, 144–151. [Google Scholar] [CrossRef] [Scilit]
- Liang, P.; Wang, G.; Liu, X.; Wang, Z.; Wang, J.; Gao, W. Spatiotemporal combination of thermosensitive polypeptide fused interferon and temozolomide for post-surgical glioblastoma immunochemotherapy. Biomaterials 2021, 264, 120447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yeboah, A.; Maguire, T.; Schloss, R.; Berthiaume, F.; Yarmush, M.L. Stromal Cell-Derived Growth Factor-1 Alpha-Elastin Like Peptide Fusion Protein Promotes Cell Migration and Revascularization of Experimental Wounds in Diabetic Mice. Adv. Wound Care 2017, 6, 10–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Devalliere, J.; Dooley, K.; Hu, Y.; Kelangi, S.S.; Uygun, B.E.; Yarmush, M.L. Co-delivery of a growth factor and a tissue-protective molecule using elastin biopolymers accelerates wound healing in diabetic mice. Biomaterials 2017, 141, 149–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, X.; Zaro, J.L.; Shen, W.C. Fusion protein linkers: Property, design and functionality. Adv. Drug Deliv. Rev. 2013, 65, 1357–1369. [Google Scholar] [CrossRef] [Scilit]
- Davison-Kotler, E.; Marshall, W.S.; Garcia-Gareta, E. Sources of Collagen for Biomaterials in Skin Wound Healing. Bioengineering 2019, 6, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amruthwar, S.S.; Puckett, A.D.; Janorkar, A.V. Preparation and characterization of novel elastin-like polypeptide-collagen composites. J. Biomed. Mater. Res. A 2013, 101, 2383–2391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, X.; Chen, Y.; Qi, J.; Zhu, S.; Wu, Y.; Xiong, J.; Hu, F.; Guo, Z.; Liang, X. Design and pharmaceutical evaluation of bifunctional fusion protein of FGF21 and GLP-1 in the treatment of nonalcoholic steatohepatitis. Eur. J. Pharmacol. 2023, 952, 175811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kallis, P.J.; Friedman, A.J. Collagen Powder in Wound Healing. J. Drugs Dermatol. 2018, 17, 403–408. [Google Scholar]
- Obagi, Z.; Damiani, G.; Grada, A.; Falanga, V. Principles of Wound Dressings: A Review. Surg. Technol. Int. 2019, 35, 50–57. [Google Scholar]
- Guo, S.; Dipietro, L.A. Factors affecting wound healing. J. Dent. Res. 2010, 89, 219–229. [Google Scholar] [CrossRef] [Scilit]
- Sarangthem, V.; Sharma, H.; Goel, R.; Ghose, S.; Park, R.W.; Mohanty, S.; Chaudhuri, T.K.; Dinda, A.K.; Singh, T.D. Application of elastin-like polypeptide (ELP) containing extra-cellular matrix (ECM) binding ligands in regenerative medicine. Int. J. Biol. Macromol. 2022, 207, 443–453. [Google Scholar] [CrossRef] [Scilit]
- Bulutoglu, B.; Devalliere, J.; Deng, S.L.; Acun, A.; Kelangi, S.S.; Uygun, B.E.; Yarmush, M.L. Tissue scaffolds functionalized with therapeutic elastin-like biopolymer particles. Biotechnol. Bioeng. 2020, 117, 1575–1583. [Google Scholar] [CrossRef] [Scilit]
- Dong, Z.; Liu, Q.; Han, X.; Zhang, X.; Wang, X.; Hu, C.; Li, X.; Liang, J.; Chen, Y.; Fan, Y. Electrospun nanofibrous membranes of recombinant human collagen type III promote cutaneous wound healing. J. Mater. Chem. B 2023, 11, 6346–6360. [Google Scholar] [CrossRef] [Scilit]
- Shiratsuchi, E.; Nakaba, M.; Yamada, M. Elastin hydrolysate derived from fish enhances proliferation of human skin fibroblasts and elastin synthesis in human skin fibroblasts and improves the skin conditions. J. Sci. Food Agric. 2016, 96, 1672–1677. [Google Scholar] [CrossRef] [Scilit]
- Kotwal, G.J.; Sarojini, H.; Chien, S. Pivotal role of ATP in macrophages fast tracking wound repair and regeneration. Wound Repair. Regen. 2015, 23, 724–727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Y.; Zhu, Y.; Zheng, Y.; Liu, Z.; Zhong, Y.; Deng, Y.; Zhao, Y. Effects of salting-in/out-assisted extractions on structural, physicochemical and functional properties of Tenebrio molitor larvae protein isolates. Food Chem. 2021, 338, 128158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hemtong, W.; Chuncharunee, A.; Sreekanth, G.P. Topical Application of ASPP 092, a Diarylheptanoid Isolated from Curcuma comosa Roxb, Accelerates Wound Healing. Future Pharmacol. 2023, 3, 1–13. [Google Scholar] [CrossRef] [Scilit]








| Group | Wound Closure Rate | ||||
|---|---|---|---|---|---|
| Day 3 | Day 5 | Day 7 | Day 11 | Day 14 | |
| Model | 10.39 ± 9.70% | 18.48 ± 9.67% | 27.62 ± 8.11% | 29.75 ± 9.35% | 61.81 ± 9.17% |
| hCol | 23.82 ± 11.86% * | 39.53 ± 10.26% * | 48.79 ± 7.58% * | 61.88 ± 11.28% * | 85.47 ± 1.96% * |
| ELP | 24.96 ± 6.77% * | 40.25 ± 6.93% * | 48.70 ± 6.43% * | 61.60 ± 4.95% * | 86.72 ± 2.99% * |
| hCol-ELP | 33.02 ± 7.34% **** | 45.77 ± 10.61% **** | 52.64 ± 10.14% **** | 62.95 ± 12.45% **** | 90.36 ± 3.24% *** |
| Group | The Width of Wound Surface | The Thickness of Epidermis | ||
|---|---|---|---|---|
| Day 7 | Day 14 | Day 7 | Day 14 | |
| Model | 9.26 ± 0.88 mm | 4.84 ± 0.72 mm | 91.51 ± 9.03 μm | 77.13 ± 10.49 μm |
| hCol | 7.46 ± 1.29 mm * | 2.98 ± 0.76 mm ** | 73.40 ± 16.96 μm * | 61.65 ± 8.92 μm |
| ELP | 6.72 ± 0.64 mm ** | 3.63 ± 0.82 mm | 69.80 ± 17.74 μm * | 59.16 ± 6.85 μm |
| hCol-ELP | 6.08 ± 0.97 mm *** | 2.94 ± 0.22 mm ** | 65.15 ± 5.75 μm ** | 53.33 ± 6.99 μm * |
| Gene Name | Primer Forward (5′-3′) | Primer Reverse (3′-5′) |
|---|---|---|
| COL1A1 | GCCAAATATGTGTCTGTGACTCA | GGGCGAGTAGGAGCAGTTG |
| GAPDH | CCTGCCTCTACTGGCGCTGC | GCAGTGGGGACACGGAAGGC |
| Gene Name | Primer Forward (5′-3′) | Primer Reverse (3′-5′) |
|---|---|---|
| GAPDH | GCCCAGAACATCATCCCTGCAT | GCCTGCTTCACCACCTTCTTGA |
| TNF-α | GGTGCCTATGTCTCAGCCTCTTC | TGATCTGAGTGTGAGGGTCTGGG |
| IL-6 | GGATACCACTCCCAACAGACCTG | TGTTCTTCATGTACTCCAGGTAGCT |
| COL1α1 | AGAGCGGAGAGTACTGGATCGAC | GGGAATCCATCGGTCATGCTCTC |
| α-SMA | GATGCAGAAGGAGATCACAGCCC | CCCAGCTTCGTCGTATTCCTGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Wu, Y.; Xiong, F.; Yu, W.; Wang, T.; Xiong, J.; Zhou, L.; Hu, F.; Ye, X.; Liang, X. Construction of a Collagen-like Protein Based on Elastin-like Polypeptide Fusion and Evaluation of Its Performance in Promoting Wound Healing. Molecules 2023, 28, 6773. https://doi.org/10.3390/molecules28196773
Chen Y, Wu Y, Xiong F, Yu W, Wang T, Xiong J, Zhou L, Hu F, Ye X, Liang X. Construction of a Collagen-like Protein Based on Elastin-like Polypeptide Fusion and Evaluation of Its Performance in Promoting Wound Healing. Molecules. 2023; 28(19):6773. https://doi.org/10.3390/molecules28196773
Chicago/Turabian StyleChen, Yingli, Yuanyuan Wu, Fengmin Xiong, Wei Yu, Tingting Wang, Jingjing Xiong, Luping Zhou, Fei Hu, Xianlong Ye, and Xinmiao Liang. 2023. "Construction of a Collagen-like Protein Based on Elastin-like Polypeptide Fusion and Evaluation of Its Performance in Promoting Wound Healing" Molecules 28, no. 19: 6773. https://doi.org/10.3390/molecules28196773
APA StyleChen, Y., Wu, Y., Xiong, F., Yu, W., Wang, T., Xiong, J., Zhou, L., Hu, F., Ye, X., & Liang, X. (2023). Construction of a Collagen-like Protein Based on Elastin-like Polypeptide Fusion and Evaluation of Its Performance in Promoting Wound Healing. Molecules, 28(19), 6773. https://doi.org/10.3390/molecules28196773
