In Vitro and In Vivo Anti-Inflammatory Effects of Cannabidiol Isolated from Novel Hemp (Cannabis sativa L.) Cultivar Pink Pepper
Abstract
:1. Introduction
2. Results
2.1. Cell Viability of CBD in RAW 264.7 Cells
2.2. CBD Inhibited the Overproduction of Nitric Oxide in LPS-Induced RAW 264.7 Cells
2.3. The Effect of CBD on the Transcription Inactivation of Inflammatory Genes
2.4. CBD Inhibited the Increase in iNOS and Inflammatory Cytokines Induced by LPS Treatment
2.5. CBD Regulates Inflammation by Inhibiting MAPK Pathway
2.6. CBD Inhibits the Phosphorylation of NF-κB Stimulated by LPS
2.7. CBD Inhibits the Acute Inflammatory Response Induced by λ-Carrageenan in Mouse
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Sample Preparation
4.3. Supercritical Fluid Extraction (SFE) Procedure
4.4. CBD Purification
4.5. CBD Crystallization
4.6. Cell Culture and Cell Viability Assay
4.7. Nitric Oxide (NO) Assay
4.8. Reverse Transcription-Quantitative PCR (RT-qPCR)
4.9. Preparation of Cell Lysates and Nuclear Fractions and Western Blot Analysis
4.10. λ-Carrageenan-Induced Paw Edema Mouse Model
4.11. Measurement of Production of Inflammatory Factors in Mouse Paw Tissue
4.12. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Nathan, C.; Aihao, D. Nonresolving inflammation. Cell 2010, 140, 871–882. [Google Scholar] [CrossRef]
- Liu, S.; Yang, T.; Ming, T.W.; Gaun, T.K.W.; Zhou, T.; Wang, S.; Ye, B. Isosteroid alkaloids with different chemical structures from Fritillariae cirrhosae bulbus alleviate LPS-induced inflammatory response in RAW 264.7 cells by MAPK signaling pathway. Int. Immunopharmacol. 2020, 78, 106047. [Google Scholar] [CrossRef]
- Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2018, 9, 7204–7218. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef]
- Ciesielska, A.; Matyjek, M.; Kwiatkowska, K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell. Mol. Life Sci. 2021, 78, 1233–1261. [Google Scholar] [CrossRef]
- Byun, E.; Sung, N.; Byun, E.; Song, D.; Kim, J.; Park, J.; Song, B.; Park, S.; Lee, J.; Byun, M.; et al. The procyanidin trimer C1 inhibits LPS-induced MAPK and NF-κB signaling through TLR4 in macrophages. Int. Immunopharmacol. 2013, 15, 450–456. [Google Scholar] [CrossRef]
- Devinsky, O.; Cilio, M.R.; Cross, H.; Fernandez-Ruiz, J.; French, J.; Hill, C.; Katz, R.; Di, M.V.; Jutras-Aswad, D.; Notcutt, W.G.; et al. Cannabidiol: Pharmacology and potential therapeutic role in epilepsy and other neuropsychiatric disorders. Epilepsia 2014, 55, 791–802. [Google Scholar] [CrossRef]
- Stasiłowicz, A.; Anna, T.; Irma, P.; Judyta, C.P. Cannabis sativa L. as a natural drug meeting the criteria of a multitarget approach to treatment. Int. J. Mol. Sci. 2021, 22, 778. [Google Scholar] [CrossRef]
- Iftikhar, A.; Zafar, U.; Ahmed, W.; Shabbir, M.A.; Sameen, A.; Sahar, A.; Bhat, Z.F.; Kowalczewski, P.Ł.; Jarzębski, M.; Aadil, R.M. Applications of Cannabis sativa L. in food and its therapeutic potential: From a prohibited drug to a nutritional supplement. Molecules 2021, 26, 7699. [Google Scholar] [CrossRef]
- Verrico, C.D.; Wesson, S.; Konduri, V.; Hofferek, C.J.; Vazquez-Perez, J.; Blair, E.; Dunner, K.J.; Salimpour, P.; Decker, W.K.; Halpert, M.M. A randomized, double-blind, placebo-controlled study of daily cannabidiol for the treatment of canine osteoarthritis pain. Pain 2020, 161, 2191–2202. [Google Scholar] [CrossRef]
- Borgonetti, V.; Benatti, C.; Governa, P.; Isoldi, G.; Pellati, F.; Alboni, S.; Tascedda, F.; Montopoli, M.; Galeotti, N.; Manetti, F.; et al. Non-psychotropic Cannabis sativa L. phytocomplex modulates microglial inflammatory response through CB2 receptors-, endocannabinoids-, and NF-κB-mediated signaling. Phytother. Res. 2022, 36, 2246–2263. [Google Scholar] [CrossRef] [PubMed]
- Shannon, S.; Lewis, N.; Lee, H.; Hughes, S. Cannabidiol in anxiety and sleep: A large case series. Perm. J. 2019, 23, 18–041. [Google Scholar] [CrossRef] [PubMed]
- Das, L.; Liu, E.; Saeed, A.; Williams, D.W.; Hu, H.; Li, C.; Ray, A.E.; Shi, J. Industrial hemp as a potential bioenergy crop in comparison with kenaf, switchgrass and biomass sorghum. Bioresour. Technol. 2017, 244 Pt 1, 641–649. [Google Scholar] [CrossRef] [PubMed]
- Lim, J.D. Cannabis sativa Isolate KNU-18-1 (Cultivar: Pink Pepper), Whole Genome Sequencing Project, GenBank. 2022. Available online: https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_029168945.1/ (accessed on 13 March 2023).
- Lim, J.D. This Research was Supported by the Ministry of Science and ICT (MSIT, Korea), (Project No.: 2021-DD-UP-0379); figshare. Dataset. 2022. Available online: https://figshare.com/articles/dataset/This_research_was_supported_by_the_Ministry_of_Science_and_ICT_MSIT_Korea_Project_No_2021-DD-UP-0379_/21391449/1 (accessed on 13 March 2023).
- Kis, B.; Ifrim, F.C.; Buda, V.; Avram, S.; Pavel, I.Z.; Antal, D.; Paunescu, V.; Dehelean, C.A.; Ardelean, F.; Diaconeasa, Z.; et al. Cannabidiol—From plant to human body: A promising bioactive molecule with multi-target effects in cancer. Int. J. Mol. Sci. 2019, 20, 5905. [Google Scholar] [CrossRef] [PubMed]
- Penny, F.; Whiting, P.F.; Wolff, R.F.; Deshpande, S.; Nisio, M.D.; Duffy, S.; Hernandez, A.V.; Keurentjes, J.C.; Lang, S.; Misso, K.; et al. Cannabinoids for medical use: A systematic review and meta-analysis. JAMA 2015, 313, 2456–2473. [Google Scholar] [CrossRef]
- Porter, B.; Marie, B.S.; Milavetz, G.; Herr, K. Cannabidiol (CBD) use by older adults for acute and chronic pain. J. Gerontol. Nurs. 2021, 47, 6–15. [Google Scholar] [CrossRef]
- Hagenbach, U.; Luz, S.; Ghafoor, N.; Berger, J.M.; Grotenhermen, F.; Brenneisen, R.; Mäder, M. The treatment of spasticity with Δ9-tetrahydrocannabinol in persons with spinal cord injury. Spinal Cord. 2003, 45, 551–562. Available online: https://www.nature.com/articles/3101982 (accessed on 17 October 2022). [CrossRef]
- Langford, R.M.; Mares, J.; Novotna, A.; Vachova, M.; Novakova, I.; Notcutt, W.; Ratcliffe, S. A double-blind, randomized, placebo-controlled, parallel-group study of THC/CBD oromucosal spray in combination with the existing treatment regimen, in the relief of central neuropathic pain in patients with multiple sclerosis. J. Neurol. 2013, 260, 984–997. [Google Scholar] [CrossRef]
- Shannon, S.; Opila-Lehman, J. Effectiveness of cannabidiol oil for pediatric anxiety and insomnia as part of posttraumatic stress disorder: A case report. Perm. J. 2016, 20, 16-005. [Google Scholar] [CrossRef]
- Bergamaschi, M.M.; Queiroz, R.H.C.; Chagas, M.H.N.; Oliveira, D.C.G.; Martinis, B.S.D.; Kapczinski, F.; Quevedo, J.; Roesler, R.; Schröder, N.; Nardi, A.E.; et al. Cannabidiol reduces the anxiety induced by simulated public speaking in treatment-naïve social phobia patients. Neuropsychopharmacology 2011, 36, 1219–1226. [Google Scholar] [CrossRef]
- Blessing, E.M.; Steenkamp, M.M.; Manzanares, J.; Marmar, C.R. Cannabidiol as a potential treatment for anxiety disorders. Neurotherapeutics 2015, 12, 825–836. [Google Scholar] [CrossRef] [PubMed]
- Chakravarti, B.; Ravi, J.; Ganju, R.K. Cannabinoids as therapeutic agents in cancer: Current status and future implications. Oncotarget 2014, 5, 5852–5872. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.I.; Soboci, A.A.; Czarnecka, A.M.; Król, M.; Botta, B. The therapeutic aspects of the endocannabinoid system (ECS) for cancer and their development: From nature to laboratory. Curr. Pharm. Des. 2016, 22, 1756–1766. [Google Scholar] [CrossRef] [PubMed]
- Jadoon, K.A.; Tan, G.D.; O’Sullivan, S.E. A single dose of cannabidiol reduces blood pressure in healthy volunteers in a randomized crossover study. JCI Insight 2017, 2, e93760. [Google Scholar] [CrossRef] [PubMed]
- Jadoon, K.A.; Ratcliffe, S.H.; Barrett, D.A.; Thomas, E.L.; Stott, C.; Bell, J.D.; O’Sullivan, S.E.; Tan, G.D. Efficacy and safety of cannabidiol and tetrahydrocannabivarin on glycemic and lipid parameters in patients with type 2 diabetes: A randomized, double-blind, placebo-controlled, parallel group pilot study. Diabetes Care 2016, 39, 1777–1786. [Google Scholar] [CrossRef]
- Blaskovich, M.A.T.; Kavanagh, A.M.; Elliott, A.G.; Zhang, B.; Ramu, S.; Amado, M.; Lowe, G.J.; Hinton, A.O.; Pham, D.M.T.; Zuegg, J.; et al. The antimicrobial potential of cannabidiol. Commun. Biol. 2021, 4, 7. [Google Scholar] [CrossRef]
- Peng, J.; Fan, M.; An, C.; Ni, F.; Huang, W.; Luo, J. A narrative review of molecular mechanism and therapeutic effect of cannabidiol (CBD). Basic Clin. Pharmacol. Toxicol. 2022, 130, 439–456. [Google Scholar] [CrossRef]
- Atalay, S.; Jarocka-Karpowicz, I.; Skrzydlewska, E. Antioxidative and anti-inflammatory properties of cannabidiol. Antioxidants 2019, 9, 21. [Google Scholar] [CrossRef]
- Nichols, J.M.; Kaplan, B.L. Immune responses regulated by cannabidiol. Cannabis Cannabinoid Res. 2020, 5, 12–31. [Google Scholar] [CrossRef]
- Zulhendri, F.; Lesmana, R.; Tandean, S.; Christoper, A.; Chandrasekaran, K.; Irsyam, I.; Suwantika, A.A.; Abdulah, R.; Wathoni, N. Recent update on the anti-inflammatory activities of propolis. Molecules 2022, 27, 8473. [Google Scholar] [CrossRef]
- Ji, J.D.; Lee, Y.H.; Song, G.G. Prostaglandin E2 (PGE2): Roles in immune responses and inflammation. J. Rheum. Dis. 2004, 30, 307–316. [Google Scholar]
- Greenhough, A.; Smartt, H.J.; Moore, A.E.; Roberts, H.R.; Williams, A.C.; Paraskeva, C.; Kaidi, A. The COX-2/PGE 2 pathway: Key roles in the hallmarks of cancer and adaptation to the tumour microenvironment. Carcinogenesis 2009, 30, 377–386. [Google Scholar] [CrossRef]
- Park, J.W.; Qi, W.N.; Liu, J.Q.; Urbaniak, J.R.; Folz, R.J.; Chen, L.E. Inhibition of iNOS attenuates skeletal muscle reperfusion injury in extracellular superoxide dismutase knockout mice. Microsurgery 2005, 25, 606–613. [Google Scholar] [CrossRef]
- Zarghi, A.; Arfaei, S. Selective COX-2 inhibitors: A review of their structure-activity relationships. Iran J. Pharm. Res. 2011, 10, 655. [Google Scholar]
- Katsuyama, K.; Shichiri, M.; Marumo, F.; Hirata, Y. NO inhibits cytokine-induced iNOS expression and NF-κB activation by interfering with phosphorylation and degradation of IκB-α. Arterioscler. Thromb. Vasc. Biol. 1998, 18, 1796–1802. [Google Scholar] [CrossRef]
- Lechner, M.; Lirk, P.; Rieder, J. Inducible nitric oxide synthase (iNOS) in tumor biology: The two sides of the same coin. Semin. Cancer Biol. 2005, 15, 277–289. [Google Scholar] [CrossRef]
- Tzanavari, T.; Giannogonas, P.; Karalis, K.P. TNF-alpha and obesity. Curr. Dir. Autoimmun. 2010, 11, 145–156. [Google Scholar]
- Tanaka, T.; Narazaki, M.; Kishimoto, T. Interleukin (IL-6) immunotherapy. Cold Spring Harb. Perspect. Biol. 2018, 10, a028456. [Google Scholar] [CrossRef]
- Al-Khayri, J.M.; Sahana, G.R.; Nagella, P.; Joseph, B.V.; Alessa, F.M.; Al-Mssallem, M.Q. Flavonoids as Potential Anti-Inflammatory Molecules: A Review. Molecules 2022, 27, 2901. [Google Scholar] [CrossRef]
- Schultheiß, C.; Willscher, E.; Paschold, L.; Gottschick, C.; Klee, B.; Henkes, S.S.; Bosurgi, L.; Dutzmann, J.; Sedding, D.; Frese, T.; et al. The IL-1β, IL-6, and TNF cytokine triad is associated with post-acute sequelae of COVID-19. Cell Rep. Med. 2022, 3, 100663. [Google Scholar] [CrossRef]
- Peyravian, N.; Deo, S.; Daunert, S.; Jimenez, J.J. Cannabidiol as a novel therapeutic for immune modulation. Immunotargets Ther. 2022, 9, 131–140. [Google Scholar] [CrossRef]
- Wen, Y.; Wang, Z.; Zhang, R.; Zhu, Y.; Lin, G.; Li, R.; Zhang, J. The antinociceptive activity and mechanism of action of cannabigerol. Biomed. Pharmacother. 2023, 158, 114163. [Google Scholar] [CrossRef]
- Powles, T.; Poele, R.T.; Shamash, J.; Chaplin, T.; Propper, D.; Joel, S.; Oliver, T.; Liu, W.M. Cannabis-induced cytotoxicity in leukemic cell lines: The role of the cannabinoid receptors and the MAPK pathway. Blood 2005, 105, 1214–1221. [Google Scholar] [CrossRef]
- Tedesco, L.; Valerio, A.; Dossena, M.; Cardile, A.; Ragni, M.; Pagano, C.; Pagotto, U.; Carruba, M.O.; Vettor, R.; Nisoli, E. Cannabinoid receptor stimulation impairs mitochondrial biogenesis in mouse white adipose tissue, muscle, and liver: The role of eNOS, p38 MAPK, and AMPK pathways. Diabetes 2010, 59, 2826–2836. [Google Scholar] [CrossRef]
- Turu, G.; Hunyady, L. Signal transduction of the CB1 cannabinoid receptor. J. Mol. Endocrinol. 2010, 44, 75–85. [Google Scholar] [CrossRef]
- Do, Y.; McKallip, R.J.; Nagarkatti, M.; Nagarkatti, P.S. Activation through cannabinoid receptors 1 and 2 on dendritic cells triggers NF-κB-dependent apoptosis: Novel role for endogenous and exogenous cannabinoids in immunoregulation. J. Immunol. 2004, 173, 2373–2382. [Google Scholar] [CrossRef]
- Holland, S.; Coste, O.; Zhang, D.D.; Pierre, S.C.; Geisslinger, G.; Scholich, K. The ubiquitin ligase MYCBP2 regulates transient receptor potential vanilloid receptor 1 (TRPV1) internalization through inhibition of p38 MAPK signaling. J. Biol. Chem. 2011, 286, 3671–3680. [Google Scholar] [CrossRef]
- Huang, K.F.; Ma, K.H.; Liu, P.S.; Chen, B.W.; Chueh, S.H. Baicalein increases keratin 1 and 10 expression in HaCaT keratinocytes via TRPV4 receptor activation. Exp. Dermatol. 2016, 25, 623–629. [Google Scholar] [CrossRef]
- Xie, C.; Kang, J.; Li, Z.; Schauss, A.G.; Badger, T.M.; Nagarajan, S.; Wu, T.; Wu, X. The açaí flavonoid velutin is a potent anti-inflammatory agent: Blockade of LPS-mediated TNF-α and IL-6 production through inhibiting NF-κB activation and MAPK pathway. J. Nutr. Biochem. 2012, 23, 1184–1191. [Google Scholar] [CrossRef]
- Sun, P.; Zhou, K.; Wang, S.; Li, P.; Chen, S.; Lin, G.; Zhao, Y.; Wang, T. Involvement of MAPK/NF-κB signaling in the activation of the cholinergic anti-inflammatory pathway in experimental colitis by chronic vagus nerve stimulation. PLoS ONE 2013, 8, e69424. [Google Scholar] [CrossRef]
- Morris, C.J. Carrageenan-induced paw edema in the rat and mouse. Methods Mol. Biol. 2003, 225, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Myers, M.J.; Deaver, C.M.; Lewandowski, A.J. Molecular mechanism of action responsible for carrageenan-induced inflammatory response. Mol. Immunol. 2019, 109, 38–42. [Google Scholar] [CrossRef] [PubMed]
- Salau, O.; Bagde, A.; Kalvala, A.; Singh, M. Enhancement of transdermal permeation of cannabinoids and their pharmacodynamic evaluation in rats. Int. J. Pharm. 2022, 624, 122016. [Google Scholar] [CrossRef]
- Rock, E.M.; Limebeer, C.L.; Parker, L.A. Effect of cannabidiolic acid and ∆9-tetrahydrocannabinol on carrageenan-induced hyperalgesia and edema in a rodent model of inflammatory pain. Psychopharmacology 2018, 235, 3259–3271. [Google Scholar] [CrossRef] [PubMed]
- Salami, S.A.; Martinelli, F.; Giovino, A.; Bachari, A.; Arad, N.; Mantri, N. It Is Our Turn to Get Cannabis High: Put Cannabinoids in Food and Health Baskets. Molecules 2020, 25, 4036. [Google Scholar] [CrossRef]
- Niesink, R.J.; van Laar, M.W. Does cannabidiol protect against adverse psychological effects of THC? Front. Psychiatry 2013, 4, 130. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) |
---|---|---|
iNOS | AATGGCAACATCAGGTCGGCCATCACT | GCTGTGTGTCACAGAAGTCTCGAACTC |
COX2 | GGAGAGACTATCAAGATAGT | ATGGTCAGTAGACTTTTACA |
IL-1β | TGCAGAGTTCCCCAACTGGTACATC | GTGCTGCCTAATGTCCCCTTGAATC |
IL-6 | GAGGATACCACTCCCAACAGACC | AAGTGCATCATCGTTGTTCATACA |
TNF-α | ATGAGCACAGAAAGCATGATC | TACAGGCTTGTCACTCGAATT |
GAPDH | GTATGACTCCACTCACGGCAAA | GGTCTCGCTCCTGGAAGATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-H.; Hong, M.; Han, J.-H.; Ryu, B.R.; Lim, Y.S.; Lim, J.D.; Kim, C.H.; Lee, S.-U.; Kwon, T.-H. In Vitro and In Vivo Anti-Inflammatory Effects of Cannabidiol Isolated from Novel Hemp (Cannabis sativa L.) Cultivar Pink Pepper. Molecules 2023, 28, 6439. https://doi.org/10.3390/molecules28186439
Kim J-H, Hong M, Han J-H, Ryu BR, Lim YS, Lim JD, Kim CH, Lee S-U, Kwon T-H. In Vitro and In Vivo Anti-Inflammatory Effects of Cannabidiol Isolated from Novel Hemp (Cannabis sativa L.) Cultivar Pink Pepper. Molecules. 2023; 28(18):6439. https://doi.org/10.3390/molecules28186439
Chicago/Turabian StyleKim, Jong-Hui, Min Hong, Joon-Hee Han, Byeong Ryeol Ryu, Young Seok Lim, Jung Dae Lim, Chang Hyeug Kim, Soo-Ung Lee, and Tae-Hyung Kwon. 2023. "In Vitro and In Vivo Anti-Inflammatory Effects of Cannabidiol Isolated from Novel Hemp (Cannabis sativa L.) Cultivar Pink Pepper" Molecules 28, no. 18: 6439. https://doi.org/10.3390/molecules28186439
APA StyleKim, J.-H., Hong, M., Han, J.-H., Ryu, B. R., Lim, Y. S., Lim, J. D., Kim, C. H., Lee, S.-U., & Kwon, T.-H. (2023). In Vitro and In Vivo Anti-Inflammatory Effects of Cannabidiol Isolated from Novel Hemp (Cannabis sativa L.) Cultivar Pink Pepper. Molecules, 28(18), 6439. https://doi.org/10.3390/molecules28186439