Naringenin Prevents Oxidative Stress and Inflammation in LPS-Induced Liver Injury through the Regulation of LncRNA-mRNA in Male Mice
Abstract
:1. Introduction
2. Results
2.1. Nar Alters LPS-Induced Changes in Serum Levels
2.2. Nar Prevented LPS-Induced Inflammation and Oxidative Stress
2.3. Nar Induced Transcriptome Alterations in the Liver
2.4. Nar Changed the Expression of DEmRNAs in Mice Liver
2.5. LncRNA and mRNA Differential Gene Co-Expression Networks in the Liver
2.6. Nar Prevents the Expression of lncRNA and Its Target Genes
2.7. Nar Reduces Liver Inflammatory in AML-12 Cells and Diet-Induced Obese Mice
3. Discussion
4. Materials and Methods
4.1. Animals and Sample Collection
4.2. Cell Culture
4.3. Enzyme-Linked Immunosorbent Assay and Biochemical Measurements
4.4. Histological Evaluation
4.5. Liver Transcriptome Sequencing and Annotation
4.6. RNA Isolation and Quantitative Real-Time PCR
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Zhang, F.; Wang, X.; Qiu, X.; Wang, J.; Fang, H.; Wang, Z.; Sun, Y.; Xia, Z. The protective effect of Esculentoside A on experimental acute liver injury in mice. PLoS ONE 2014, 9, e113107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, H.; Young, D.W.; Gusovsky, F.; Chow, J.C. Cellular events mediated by lipopolysaccharide-stimulated toll-like receptor 4. MD-2 is required for activation of mitogen-activated protein kinases and Elk-1. J. Biol. Chem. 2000, 275, 20861–20866. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luster, M.I.; Simeonova, P.P.; Gallucci, R.M.; Matheson, J.M.; Yucesoy, B. Immunotoxicology: Role of inflammation in chemical-induced hepatotoxicity. Int. J. Immunopharmacol. 2000, 22, 1143–1147. [Google Scholar] [CrossRef] [PubMed]
- Rajsbaum, R.; García-Sastre, A.; Versteeg, G.A. TRIMmunity: The roles of the TRIM E3-ubiquitin ligase family in innate antiviral immunity. J. Mol. Biol. 2014, 426, 1265–1284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yap, M.W.; Stoye, J.P. TRIM proteins and the innate immune response to viruses. Adv. Exp. Med. Biol. 2012, 770, 93–104. [Google Scholar] [CrossRef]
- Ikeda, K.; Inoue, S. TRIM proteins as RING finger E3 ubiquitin ligases. Adv. Exp. Med. Biol. 2012, 770, 27–37. [Google Scholar] [CrossRef]
- McNab, F.W.; Rajsbaum, R.; Stoye, J.P.; O’Garra, A. Tripartite-motif proteins and innate immune regulation. Curr. Opin. Immunol. 2011, 23, 46–56. [Google Scholar] [CrossRef]
- Tsuchida, T.; Zou, J.; Saitoh, T.; Kumar, H.; Abe, T.; Matsuura, Y.; Kawai, T.; Akira, S. The ubiquitin ligase TRIM56 regulates innate immune responses to intracellular double-stranded DNA. Immunity 2010, 33, 765–776. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Wang, L.; Fu, B.; Berman, M.A.; Diallo, A.; Dorf, M.E. TRIM65 regulates microRNA activity by ubiquitination of TNRC6. Proc. Natl. Acad. Sci. USA 2014, 111, 6970–6975. [Google Scholar] [CrossRef] [Green Version]
- Yuan, X.; Wang, J.; Tang, X.; Li, Y.; Xia, P.; Gao, X. Berberine ameliorates nonalcoholic fatty liver disease by a global modulation of hepatic mRNA and lncRNA expression profiles. J. Transl. Med. 2015, 13, 24. [Google Scholar] [CrossRef]
- Molina, M.F.; Sanchez-Reus, I.; Iglesias, I.; Benedi, J. Quercetin, a flavonoid antioxidant, prevents and protects against ethanol-induced oxidative stress in mouse liver. Biol. Pharm. Bull. 2003, 26, 1398–1402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vera-Ramirez, L.; Pérez-Lopez, P.; Varela-Lopez, A.; Ramirez-Tortosa, M.; Battino, M.; Quiles, J.L. Curcumin and liver disease. BioFactors 2013, 39, 88–100. [Google Scholar] [CrossRef] [PubMed]
- Naeini, F.; Namkhah, Z.; Ostadrahimi, A.; Tutunchi, H.; Hosseinzadeh-Attar, M.J. A Comprehensive Systematic Review of the Effects of Naringenin, a Citrus-Derived Flavonoid, on Risk Factors for Nonalcoholic Fatty Liver Disease. Adv. Nutr. 2021, 12, 413–428. [Google Scholar] [CrossRef] [PubMed]
- Rehman, M.U.; Tahir, M.; Quaiyoom Khan, A.; Khan, R.; Lateef, A.; Hamiza, O.O.; Ali, F.; Sultana, S. Diosmin protects against trichloroethylene-induced renal injury in Wistar rats: Plausible role of p53, Bax and caspases. Br. J. Nutr. 2013, 110, 699–710. [Google Scholar] [CrossRef] [Green Version]
- Faghihzadeh, F.; Hekmatdoost, A.; Adibi, P. Resveratrol and liver: A systematic review. J. Res. Med. Sci. Off. J. Isfahan Univ. Med. Sci. 2015, 20, 797–810. [Google Scholar] [CrossRef]
- Ezzat, S.M.; Salama, M.M.; Seif El-Din, S.H.; Saleh, S.; El-Lakkany, N.M.; Hammam, O.A.; Salem, M.B.; Botros, S.S. Metabolic profile and hepatoprotective activity of the anthocyanin-rich extract of Hibiscus sabdariffa calyces. Pharm. Biol. 2016, 54, 3172–3181. [Google Scholar] [CrossRef] [Green Version]
- Lila, M.A. Anthocyanins and Human Health: An In Vitro Investigative Approach. J. Biomed. Biotechnol. 2004, 2004, 306–313. [Google Scholar] [CrossRef]
- Miler, M.; Živanović, J.; Ajdžanović, V.; Oreščanin-Dušić, Z.; Milenković, D.; Konić-Ristić, A.; Blagojević, D.; Milošević, V.; Šošić-Jurjević, B. Citrus flavanones naringenin and hesperetin improve antioxidant status and membrane lipid compositions in the liver of old-aged Wistar rats. Exp. Gerontol. 2016, 84, 49–60. [Google Scholar] [CrossRef]
- Pari, L.; Gnanasoundari, M. Influence of naringenin on oxytetracycline mediated oxidative damage in rat liver. Basic Clin. Pharmacol. Toxicol. 2006, 98, 456–461. [Google Scholar] [CrossRef]
- Tsuhako, R.; Yoshida, H.; Sugita, C.; Kurokawa, M. Naringenin suppresses neutrophil infiltration into adipose tissue in high-fat diet-induced obese mice. J. Nat. Med. 2020, 74, 229–237. [Google Scholar] [CrossRef]
- Lee, M.H.; Yoon, S.; Moon, J.O. The flavonoid naringenin inhibits dimethylnitrosamine-induced liver damage in rats. Biol. Pharm. Bull. 2004, 27, 72–76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salehi, B.; Fokou, P.V.T.; Sharifi-Rad, M.; Zucca, P.; Pezzani, R.; Martins, N.; Sharifi-Rad, J. The Therapeutic Potential of Naringenin: A Review of Clinical Trials. Pharmaceuticals 2019, 12, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eichenberger, M.; Lehka, B.J.; Folly, C.; Fischer, D.; Martens, S.; Simón, E.; Naesby, M. Metabolic engineering of Saccharomyces cerevisiae for de novo production of dihydrochalcones with known antioxidant, antidiabetic, and sweet tasting properties. Metab. Eng. 2017, 39, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Shen, S.C.; Ko, C.H.; Tseng, S.W.; Tsai, S.H.; Chen, Y.C. Structurally related antitumor effects of flavanones in vitro and in vivo: Involvement of caspase 3 activation, p21 gene expression, and reactive oxygen species production. Toxicol. Appl. Pharmacol. 2004, 197, 84–95. [Google Scholar] [CrossRef]
- Heo, H.J.; Kim, D.O.; Shin, S.C.; Kim, M.J.; Kim, B.G.; Shin, D.H. Effect of antioxidant flavanone, naringenin, from Citrus junoson neuroprotection. J. Agric. Food Chem. 2004, 52, 1520–1525. [Google Scholar] [CrossRef]
- Hernández-Aquino, E.; Muriel, P. Beneficial effects of naringenin in liver diseases: Molecular mechanisms. World J. Gastroenterol. 2018, 24, 1679–1707. [Google Scholar] [CrossRef]
- Lin, H.J.; Ku, K.L.; Lin, I.H.; Yeh, C.C. Naringenin attenuates hepatitis B virus X protein-induced hepatic steatosis. BMC Complement. Altern. Med. 2017, 17, 505. [Google Scholar] [CrossRef]
- Assini, J.M.; Mulvihill, E.E.; Burke, A.C.; Sutherland, B.G.; Telford, D.E.; Chhoker, S.S.; Sawyez, C.G.; Drangova, M.; Adams, A.C.; Kharitonenkov, A.; et al. Naringenin prevents obesity, hepatic steatosis, and glucose intolerance in male mice independent of fibroblast growth factor 21. Endocrinology 2015, 156, 2087–2102. [Google Scholar] [CrossRef] [Green Version]
- Wali, A.F.; Rashid, S.; Rashid, S.M.; Ansari, M.A.; Khan, M.R.; Haq, N.; Alhareth, D.Y.; Ahmad, A.; Rehman, M.U. Naringenin Regulates Doxorubicin-Induced Liver Dysfunction: Impact on Oxidative Stress and Inflammation. Plants 2020, 9, 550. [Google Scholar] [CrossRef]
- Yoshida, H.; Takamura, N.; Shuto, T.; Ogata, K.; Tokunaga, J.; Kawai, K.; Kai, H. The citrus flavonoids hesperetin and naringenin block the lipolytic actions of TNF-alpha in mouse adipocytes. Biochem. Biophys. Res. Commun. 2010, 394, 728–732. [Google Scholar] [CrossRef]
- Yoshida, H.; Watanabe, W.; Oomagari, H.; Tsuruta, E.; Shida, M.; Kurokawa, M. Citrus flavonoid naringenin inhibits TLR2 expression in adipocytes. J. Nutr. Biochem. 2013, 24, 1276–1284. [Google Scholar] [CrossRef] [PubMed]
- Kim, V.N.; Han, J.; Siomi, M.C. Biogenesis of small RNAs in animals. Nat. Reviews. Mol. Cell Biol. 2009, 10, 126–139. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Ren, K.; Zhu, X.; Zheng, Z.; Yi, G. Long Noncoding RNAs: Advances in Lipid Metabolism. Adv. Clin. Chem. 2018, 87, 1–36. [Google Scholar] [CrossRef] [PubMed]
- Simion, V.; Haemmig, S.; Feinberg, M.W. LncRNAs in vascular biology and disease. Vasc. Pharmacol. 2019, 114, 145–156. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Huang, S.; Xue, P.; Fu, J.; Liu, L.; Zhang, C.; Yang, L.; Xia, L.; Sun, L.; Huang, S.K.; et al. LncRNA PTPRE-AS1 modulates M2 macrophage activation and inflammatory diseases by epigenetic promotion of PTPRE. Sci. Adv. 2019, 5, eaax9230. [Google Scholar] [CrossRef] [Green Version]
- Ou, M.; Li, X.; Zhao, S.; Cui, S.; Tu, J. Long non-coding RNA CDKN2B-AS1 contributes to atherosclerotic plaque formation by forming RNA-DNA triplex in the CDKN2B promoter. EBioMedicine 2020, 55, 102694. [Google Scholar] [CrossRef]
- Jin, L.; Song, Q.; Zhang, W.; Geng, B.; Cai, J. Roles of long noncoding RNAs in aging and aging complications. Biochim. Et Biophys. Acta. Mol. Basis Dis. 2019, 1865, 1763–1771. [Google Scholar] [CrossRef]
- Zhao, Q.; Pang, G.; Yang, L.; Chen, S.; Xu, R.; Shao, W. Long Noncoding RNAs Regulate the Inflammatory Responses of Macrophages. Cells 2021, 11, 5. [Google Scholar] [CrossRef]
- Sun, L.; Goff, L.A.; Trapnell, C.; Alexander, R.; Lo, K.A.; Hacisuleyman, E.; Sauvageau, M.; Tazon-Vega, B.; Kelley, D.R.; Hendrickson, D.G.; et al. Long noncoding RNAs regulate adipogenesis. Proc. Natl. Acad. Sci. USA 2013, 110, 3387–3392. [Google Scholar] [CrossRef] [Green Version]
- Dickson, I. Hepatocellular carcinoma: A role for lncRNA in liver cancer. Nature reviews. Gastroenterol. Hepatol. 2016, 13, 122–123. [Google Scholar] [CrossRef]
- Feng, J.; Yang, G.; Liu, Y.; Gao, Y.; Zhao, M.; Bu, Y.; Yuan, H.; Yuan, Y.; Yun, H.; Sun, M.; et al. LncRNA PCNAP1 modulates hepatitis B virus replication and enhances tumor growth of liver cancer. Theranostics 2019, 9, 5227–5245. [Google Scholar] [CrossRef] [PubMed]
- Smekalova, E.M.; Kotelevtsev, Y.V.; Leboeuf, D.; Shcherbinina, E.Y.; Fefilova, A.S.; Zatsepin, T.S.; Koteliansky, V. lncRNA in the liver: Prospects for fundamental research and therapy by RNA interference. Biochimie 2016, 131, 159–172. [Google Scholar] [CrossRef] [PubMed]
- Nicaise, C.; Weichselbaum, L.; Schandene, L.; Gangji, V.; Dehavay, F.; Bouchat, J.; Balau, B.; Vogl, T.; Soyfoo, M.S. Phagocyte-specific S100A8/A9 is upregulated in primary Sjögren’s syndrome and triggers the secretion of pro-inflammatory cytokines in vitro. Clin. Exp. Rheumatol. 2017, 35, 129–136. [Google Scholar] [PubMed]
- Yen, F.L.; Wu, T.H.; Lin, L.T.; Cham, T.M.; Lin, C.C. Naringenin-loaded nanoparticles improve the physicochemical properties and the hepatoprotective effects of naringenin in orally-administered rats with CCl(4)-induced acute liver failure. Pharm. Res. 2009, 26, 893–902. [Google Scholar] [CrossRef]
- Elsawy, H.; Algefare, A.I.; Alfwuaires, M.; Khalil, M.; Elmenshawy, O.M.; Sedky, A.; Abdel-Moneim, A.M. Naringin alleviates methotrexate-induced liver injury in male albino rats and enhances its antitumor efficacy in HepG2 cells. Biosci. Rep. 2020, 40, BSR20193686. [Google Scholar] [CrossRef]
- Mu, H.; Zhou, Q.; Yang, R.; Zeng, J.; Li, X.; Zhang, R.; Tang, W.; Li, H.; Wang, S.; Shen, T.; et al. Naringin Attenuates High Fat Diet Induced Non-alcoholic Fatty Liver Disease and Gut Bacterial Dysbiosis in Mice. Front. Microbiol. 2020, 11, 585066. [Google Scholar] [CrossRef]
- Hernández-Aquino, E.; Quezada-Ramírez, M.A.; Silva-Olivares, A.; Casas-Grajales, S.; Ramos-Tovar, E.; Flores-Beltrán, R.E.; Segovia, J.; Shibayama, M.; Muriel, P. Naringenin attenuates the progression of liver fibrosis via inactivation of hepatic stellate cells and profibrogenic pathways. Eur. J. Pharmacol. 2019, 865, 172730. [Google Scholar] [CrossRef]
- Hua, Y.Q.; Zeng, Y.; Xu, J.; Xu, X.L. Naringenin alleviates nonalcoholic steatohepatitis in middle-aged Apoe(-/-)mice: Role of SIRT1. Phytomedicine: Int. J. Phytother. Phytopharm. 2021, 81, 153412. [Google Scholar] [CrossRef]
- Luo, D.D.; Chen, J.F.; Liu, J.J.; Xie, J.H.; Zhang, Z.B.; Gu, J.Y.; Zhuo, J.Y.; Huang, S.; Su, Z.R.; Sun, Z.H. Tetrahydrocurcumin and octahydrocurcumin, the primary and final hydrogenated metabolites of curcumin, possess superior hepatic-protective effect against acetaminophen-induced liver injury: Role of CYP2E1 and Keap1-Nrf2 pathway. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2019, 123, 349–362. [Google Scholar] [CrossRef]
- Li, Y.; Han, M.F.; Li, W.N.; Shi, A.C.; Zhang, Y.Y.; Wang, H.Y.; Wang, F.X.; Li, L.; Wu, T.; Ding, L.; et al. SOCS3 expression correlates with severity of inflammation in mouse hepatitis virus strain 3-induced acute liver failure and HBV-ACLF. J. Huazhong Univ. Sci. Technol. Med. Sci. 2014, 34, 348–353. [Google Scholar] [CrossRef]
- Zeng, W.; Jin, L.; Zhang, F.; Zhang, C.; Liang, W. Naringenin as a potential immunomodulator in therapeutics. Pharmacol. Res. 2018, 135, 122–126. [Google Scholar] [CrossRef] [PubMed]
- Quinn, J.J.; Chang, H.Y. Unique features of long non-coding RNA biogenesis and function. Nat. Rev. Genet. 2016, 17, 47–62. [Google Scholar] [CrossRef] [PubMed]
- Geisler, S.; Coller, J. RNA in unexpected places: Long non-coding RNA functions in diverse cellular contexts. Nat. Rev. Mol. Cell Biol. 2013, 14, 699–712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, X.; Wen, S.W.; Kaminga, A.C.; Liu, A. Gut metabolites and inflammation factors in non-alcoholic fatty liver disease: A systematic review and meta-analysis. Sci. Rep. 2020, 10, 8848. [Google Scholar] [CrossRef] [PubMed]
- Kamanova, J.; Sun, H.; Lara-Tejero, M.; Galán, J.E. The Salmonella Effector Protein SopA Modulates Innate Immune Responses by Targeting TRIM E3 Ligase Family Members. PLoS Pathog. 2016, 12, e1005552. [Google Scholar] [CrossRef]
- Su, Y.J.; Xu, F.; Yu, J.P.; Yue, D.S.; Ren, X.B.; Wang, C.L. Up-regulation of the expression of S100A8 and S100A9 in lung adenocarcinoma and its correlation with inflammation and other clinical features. Chin. Med. J. 2010, 123, 2215–2220. [Google Scholar]
- Wang, S.; Song, R.; Wang, Z.; Jing, Z.; Wang, S.; Ma, J. S100A8/A9 in Inflammation. Front. Immunol. 2018, 9, 1298. [Google Scholar] [CrossRef] [Green Version]
- Wang, F.; Liu, Y.; Yuan, J.; Yang, W.; Mo, Z. Compound C Protects Mice from HFD-Induced Obesity and Nonalcoholic Fatty Liver Disease. Int. J. Endocrinol. 2019, 2019, 3206587. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.S.; Nam, Y.; Chung, Y.H.; Kim, H.R.; Park, E.S.; Chung, S.J.; Kim, J.H.; Sohn, U.D.; Kim, H.C.; Oh, K.W.; et al. Beneficial effects of phosphatidylcholine on high-fat diet-induced obesity, hyperlipidemia and fatty liver in mice. Life Sci. 2014, 118, 7–14. [Google Scholar] [CrossRef]
- Hasan, M.I.; Das, S.K.; Chowdhury, E.H. A better and copacetic protocol for histopathological slide preparation using H&E stain: A review. J. Fish. 2021, 2, 57–67. [Google Scholar]
Gene | Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) |
---|---|---|
Glutamate-cysteine ligase catalytic subunit (GCLC) | TCAGCCTCCTCCTCCAAACTCC | TGAGCACACACAAACCAC |
Glutamate-cysteine ligase modifier subunit (GCLM) | TCACAATGACCCGAAAGAACTG | ACCCAATCCTGGGCTTCAT |
Tumor necrosis factor α (TNFα) | GCACTGAGAGCATGATCCGAGAC | CGACCAGGAGGAAGGAGAAGAGG |
Interleukin-6 (IL-6) | ATAAGGGAAATGTCGAGGCTGTGC | GGGTGGTGGCTTTGTCTGGATTC |
Monocyte chemoattractant protein-1 (MCP1) | AGCACCAGCCAACTCTCAC | TCTGGACCCATTCCTTCTTG |
Interleukin-1β (IL-1β) | CCAATTCAGGGACCCTACCC | GTTTTGGGTGCAGCACTTCAT |
MSTRG.19540.3 | GGGAAACAGCGCGACCACCC | TGACGCAGGTGTACGCAGATCA |
MSTRG.6826.5 | ACTAGAGCAAAGAGACAGGACGAAGC | GTGTGTACTGTAGCCACTTAATTCTGT |
Calcin-binding protein a9 (S100a9) | ACTGGGCTTACACTGCTCTTACCAA | CCTTTAGACTTGGTTGGGCAGCTGT |
Calcin-binding protein a8 (S100a8) | TGTAGACATATCCAGGGACCCAGCC | TCTGGAAGGGAAGAGCGTTGTCTC |
Tripartite motif containing 56 (Trim56) | TTGTTTCTCTTGCAGGTAGTCAACT | CAACCCACTCTCTCCTGGTCCCTAA |
β-actin | GGCACCACACCTTCTACAATG | GGGGTGTTGAAGGTCTCAAAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ji, M.; Deng, Z.; Rong, X.; Li, R.; You, Z.; Guo, X.; Cai, C.; Zhao, Y.; Gao, P.; Cao, G.; et al. Naringenin Prevents Oxidative Stress and Inflammation in LPS-Induced Liver Injury through the Regulation of LncRNA-mRNA in Male Mice. Molecules 2023, 28, 198. https://doi.org/10.3390/molecules28010198
Ji M, Deng Z, Rong X, Li R, You Z, Guo X, Cai C, Zhao Y, Gao P, Cao G, et al. Naringenin Prevents Oxidative Stress and Inflammation in LPS-Induced Liver Injury through the Regulation of LncRNA-mRNA in Male Mice. Molecules. 2023; 28(1):198. https://doi.org/10.3390/molecules28010198
Chicago/Turabian StyleJi, Mengting, Zhao Deng, Xiaoyin Rong, Ruixiao Li, Ziwei You, Xiaohong Guo, Chunbo Cai, Yan Zhao, Pengfei Gao, Guoqing Cao, and et al. 2023. "Naringenin Prevents Oxidative Stress and Inflammation in LPS-Induced Liver Injury through the Regulation of LncRNA-mRNA in Male Mice" Molecules 28, no. 1: 198. https://doi.org/10.3390/molecules28010198
APA StyleJi, M., Deng, Z., Rong, X., Li, R., You, Z., Guo, X., Cai, C., Zhao, Y., Gao, P., Cao, G., Li, B., & Yang, Y. (2023). Naringenin Prevents Oxidative Stress and Inflammation in LPS-Induced Liver Injury through the Regulation of LncRNA-mRNA in Male Mice. Molecules, 28(1), 198. https://doi.org/10.3390/molecules28010198