The Isolation and Characterization of Antagonist Trichoderma spp. from the Soil of Abha, Saudi Arabia
Abstract
:1. Introduction
2. Results
Isolation of Trichoderma spp. from the Soil of Abha, Saudi Arabia
3. Discussion
4. Materials and Methods
4.1. Collection of Soil Samples and Isolation of Trichoderma spp. from the Soil of Abha, Saudi Arabia
4.1.1. Soil Sampling
4.1.2. Isolation of Fungi
4.2. Isolation and Characterization of Trichoderma spp. Antagonist to Plant Pathogenic Fungi
4.3. Effect of Different Temperature on the Growth of Trichoderma Isolates
4.4. Effect of Different Salt Concentration on the Growth of Trichoderma Isolates
5. Molecular Identification
5.1. DNA Extraction
5.2. PCR Amplification
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Anees, M.; Azim, R.; Ur Rehman, S.; Jamil, M.; El Hendawy, S.E.; Al-Suhaiban, N.A. Antifungal Potential of Trichoderma Strains Originated from North Western Regions of Pakistan against the Plant pathogens. Pakistan J. Bot. 2018, 50, 2031–2040. [Google Scholar]
- Xiao-Yan, S.; Qing-Tao, S.; Shu-Tao, X.; Xiu-Lan, C.; Cai-Yun, S.; Yu-Zhong, Z. Broad-Spectrum Antimicrobial Activity and High Stability of Trichokonins from Trichoderma koningii SMF2 against Plant pathogens. FEMS Microbiol. Lett. 2006, 260, 119–125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, S.; Kour, D.; Rana, K.L.; Dhiman, A.; Thakur, S.; Thakur, P.; Thakur, S.; Thakur, N.; Sudheer, S.; Yadav, N.; et al. Trichoderma: Biodiversity, Ecological Significances, and Industrial Applications. In Recent Advancement in White Biotechnology through Fungi; Springer: Cham, Switzerland, 2019; pp. 85–120. [Google Scholar]
- Guzmán-Guzmán, P.; Porras-Troncoso, M.D.; Olmedo-Monfil, V.; Herrera-Estrella, A. Trichoderma Species: Versatile Plant Symbionts. Phytopathology 2019, 109, 6–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nieto-Jacobo, M.F.; Steyaert, J.M.; Salazar-Badillo, F.B.; Vi Nguyen, D.; Rostás, M.; Braithwaite, M.; De Souza, J.T.; Jimenez-Bremont, J.F.; Ohkura, M.; Stewart, A.; et al. Environmental Growth Conditions of Trichoderma spp. Affects Indole Acetic Acid Derivatives, Volatile Organic Compounds, and Plant Growth Promotion. Front. Plant Sci. 2017, 8, 102. [Google Scholar] [CrossRef] [Green Version]
- Wu, Q.; Sun, R.; Ni, M.; Yu, J.; Li, Y.; Yu, C.; Dou, K.; Ren, J.; Chen, J. Identification of a Novel Fungus, Trichoderma asperellum GDFS1009, and Comprehensive Evaluation of Its Biocontrol Efficacy. PLoS ONE 2017, 12, e0179957. [Google Scholar] [CrossRef]
- Gurung, M. Evaluation of Trichoderma Asperellum as Biocontrol Agent for Phytophthora Foot and Root Rot of Citrus. Doctoral Dissertation, Texas A&M University-Kingsville, Kingsville, TX, USA, 2018. [Google Scholar]
- Alsabhan, A.H.; Perveen, K.; Alwadi, A.S. Heavy Metal Content and Microbial Population in the Soil of Riyadh Region, Saudi Arabia. J. King Saud Univ.-Sci. 2022, 34, 101671. [Google Scholar] [CrossRef]
- Al-Dhabaan, F.A. Mycoremediation of Crude Oil Contaminated Soil by Specific Fungi Isolated from Dhahran in Saudi Arabia. Saudi J. Biol. Sci. 2021, 28, 73–77. [Google Scholar] [CrossRef]
- Mazrou, Y.S.A.; Makhlouf, A.H.; Elseehy, M.M.; Awad, M.F.; Hassan, M.M. Antagonistic Activity and Molecular Characterization of Biological Control Agent Trichoderma harzianum from Saudi Arabia. Egypt. J. Biol. Pest Control 2020, 30, 4. [Google Scholar] [CrossRef] [Green Version]
- Elazab, N.T. Diversity and Biological Activities of Endophytic Fungi at Al-Qassim Region. J. Mol. Biol. Res. 2019, 9, 160. [Google Scholar] [CrossRef]
- Gherbawy, Y.A.; Hussein, N.A.; Al-Qurashi, A.A. Molecular Characterization of Trichoderma Populations Isolated from Soil of Taif City, Saudi Arabia. Int. J. Curr. Microbiol. Appl. Sci. 2014, 3, 1059–1071. [Google Scholar]
- Dean, R.; Van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 Fungal Pathogens in Molecular Plant Pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roy, C.K.; Akter, N.; Sarkar, M.K.I.; Pk, M.U.; Begum, N.; Zenat, E.A.; Jahan, M.A.A. Control of Early Blight of Tomato Caused by Alternaria solani and Screening of Tomato Varieties against the Pathogen. Open Microbiol. J. 2019, 13, 41–50. [Google Scholar] [CrossRef] [Green Version]
- Sunder, S.; Ram, S.; Agarwal, R. Brown Spot of Rice: An Overview Brown Spot of Rice: An Overview. Indian Phytopathol. 2014, 67, 201–215. [Google Scholar]
- Anwer, M.A.; Singh, B.K.; Prasad, B.D.; Yadav, A.K.; Kumari, P. Abiotic Stress Tolerant Trichoderma asperellum Tvb1 from Hot Spring and Its Antagonistic Potential Against Soil Borne Phytopathogens. Int. Arch. Appl. Sci. Technol. 2020, 11, 70–90. [Google Scholar] [CrossRef]
- Es-Soufi, R.; Tahiri, H.; Azaroual, L.; El Oualkadi, A.; Martin, P.; Badoc, A.; Lamarti, A. In Vitro Antagonistic Activity of Trichoderma harzianum and Bacillus amyloliquefaciens against Colletotrichum acutatumi. Adv. Microbiol. 2020, 10, 82–94. [Google Scholar] [CrossRef] [Green Version]
- El-katatny, M.H.; Emam, A.S. Control of postharvest tomato rot by spore suspension and antifungal metabolites of Trichoderma harzianum. Biotechnol. Food Sci. 2021, 1, 1505–1528. [Google Scholar]
- Kullnig, C.; Szakacs, G.; Kubicek, C.P. Molecular Identification of Trichoderma Species from Russia, Siberia and the Himalaya. Mycol. Res. 2000, 104, 1117–1125. [Google Scholar] [CrossRef]
- Brunner, K.; Peterbauer, C.K.; Mach, R.L.; Lorito, M.; Zeilinger, S.; Kubicek, C.P. The Nag1 N-Acetylglucosaminidase of Trichoderma atroviride Is Essential for Chitinase Induction by Chitin and of Major Relevance to Biocontrol. Curr. Genet. 2003, 43, 289–295. [Google Scholar] [CrossRef]
- Zeilinger, S.; Galhaup, C.; Payer, K.; Woo, S.L.; Mach, R.L.; Fekete, C.; Lorito, M.; Kubicek, C.P. Chitinase Gene Expression during Mycoparasitic Interaction of Trichoderma harzianum with Its Host. Fungal Genet. Biol. 1999, 26, 131–140. [Google Scholar] [CrossRef]
- Küçük, Ç.; Kivanç, M. In vitro antifungal activity of strains of Trichoderma harzianum. Turk. J. Biol. 2004, 28, 111–115. [Google Scholar]
- Lorito, M.; Woo, S.L.; D’Ambrosi, M.; Harman, G.E.; Hayes, C.K.; Kubicek, C.P.; Scala, F. Synergistic Interaction between Cell Wall Degrading Enzymes and Membrane Affecting Compounds. Mol. Plant-Microbe Interact. 1996, 9, 206–213. [Google Scholar] [CrossRef]
- Harman, G.E.; Kubicek, C.P. Trichoderma and Gliocladium, Volume 2: Enzymes, Biological Control and Commercial Applications; CRC Press: Boca Raton, FL, USA, 1998. [Google Scholar]
- Kubicek, C.P.; Mach, R.L.; Peterbauer, C.K.; Lorito, M. Trichoderma: From Genes to Biocontrol. J. Plant Pathol. 2001, 83, 11–23. [Google Scholar]
- Druzhinina, I.S.; Seidl-Seiboth, V.; Herrera-Estrella, A.; Horwitz, B.A.; Kenerley, C.M.; Monte, E.; Mukherjee, P.K.; Zeilinger, S.; Grigoriev, I.V.; Kubicek, C.P. Trichoderma: The Genomics of Opportunistic Success. Nat. Rev. Microbiol. 2011, 9, 749–759. [Google Scholar] [CrossRef] [PubMed]
- Kredics, L.; Antal, Z.; Manczinger, L.; Szekeres, A.; Kevei, F.; Nagy, E. Influence of Environmental Parameters on Trichoderma Strains with Biocontrol Potential. Food Technol. Biotechnol. 2003, 41, 37–42. [Google Scholar]
- Hajieghrari, B.; Torabi-Giglou, M.; Mohammadi, M.R.; Davari, M. Biological Potantial of Some Iranian Trichoderma Isolates in the Control of Soil Borne Plant Pathogenic Fungi. Afr. J. Biotechnol. 2008, 7, 967–972. [Google Scholar] [CrossRef]
- Hewedy, O.A.; Abdel Lateif, K.S.; Seleiman, M.F.; Shami, A.; Albarakaty, F.M.; El-Meihy, R.M. Phylogenetic Diversity of Trichoderma Strains and Their Antagonistic Potential against Soil-Borne Pathogens under Stress Conditions. Biology 2020, 9, 189. [Google Scholar] [CrossRef]
- Di Lelio, I.; Coppola, M.; Comite, E.; Molisso, D.; Lorito, M.; Woo, S.L.; Pennacchio, F.; Rao, R.; Digilio, M.C. Temperature Differentially Influences the Capacity of Trichoderma Species to Induce Plant Defense Responses in Tomato Against Insect Pests. Front. Plant Sci. 2021, 12, 678830. [Google Scholar] [CrossRef]
- Poosapati, S.; Durga Ravulapalli, P.; Tippirishetty, N.; Kumar Vishwanathaswamy, D.; Chunduri, S. Selection of High Temperature and Salinity Tolerant Trichoderma Isolates with Antagonistic Activity against Sclerotium rolfsii. SpringerPlus 2014, 3, 641. [Google Scholar] [CrossRef] [Green Version]
- Regragui, A.; Lahlou, H. Effect of Salinity on in Vitro Trichoderma harzianum Antagonism against Verticillium dahliae. Pak. J. Biol. Sci. 2005, 8, 872–876. [Google Scholar]
- Gunde-Cimerman, N.; Ramos, J.; Plemenitaš, A. Halotolerant and Halophilic fungi. Mycol. Res. 2009, 113, 1231–1241. [Google Scholar] [CrossRef]
- Ghildiyal, A.; Pandey, A. Isolation of Cold Tolerant Antifungal Strains of Trichoderma Sp. from Glacial Sites of Indian Himalayan Region. Res. J. Microbiol. 2008, 3, 559–564. [Google Scholar] [CrossRef] [Green Version]
- Zehra, A.; Dubey, M.K.; Meena, M.; Upadhyay, R.S. Effect of Different Environmental Conditions on Growth and Sporulation of Some Trichoderma Species. J. Environ. Biol. 2017, 38, 197–203. [Google Scholar] [CrossRef]
- Yusnawan, E.; Taufiq, A.; Wijanarko, A.; Susilowati, D.N.; Praptana, R.H.; Chandra-hioe, M.V.; Supriyo, A.; Inayati, A. Changes in Volatile Organic Compounds from Salt-tolerant Trichoderma and the Biochemical Response and Growth Performance in Saline-stressed Groundnut. Sustainability 2021, 13, 13226. [Google Scholar] [CrossRef]
- Castillo, F.D.H.; Berlanga Padilla, A.M.; Gallegos Morales, G.; Cepeda Siller, M.; Rodriguez Herrera, R.; Aguilar Gonzales, C.N.; Castillo Reyes, F. In Vitro Antagonist Action of Trichoderma Strains against Sclerotinia Sclerotiorum and Sclerotium Cepivorum. Am. J. Agric. Biol. Sci. 2011, 6, 410–417. [Google Scholar] [CrossRef] [Green Version]
- Perveen, K.; Bokhari, N.A. Antagonistic Activity of Trichoderma harzianum and Trichoderma viride Isolated from Soil of Date Palm Field against Fusarium oxysporum. Afr. J. Microbiol. Res. 2012, 6, 3348–3353. [Google Scholar] [CrossRef]
- Mazrou, Y.S.A.; Baazeem, A.; Makhlouf, A.H.; Sabry, A.; Ismail, M.; Hassan, M.M. Comparative Molecular Genetic Diversity between Trichoderma Spp. from Egypt and Saudi Arabia. Egypt. J. Biol. Pest Control 2020, 30, 120. [Google Scholar] [CrossRef]
- Henrique Fantin, L.; Lúcia de Souza Madureira Felício, A.; Hideki Sumida, C.; Marcelo Gonçalves, R.; Braga, K.; Alexandre de França, J.; Giovanetti Canteri, M. Characterisation of Trichoderma Strains Using FTIR-ATR Spectroscopy and Molecular Analysis. Eur. J. Plant Pathol. 2022, 162, 945–956. [Google Scholar] [CrossRef]
- Abha. Available online: https://goo.gl/maps/i6V7nWWtKxk6nQWMA (accessed on 2 January 2022).
- Jaklitsch, W.M.; Voglmayr, H. Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macaronesia. Stud. Mycol. 2015, 80, 1–87. [Google Scholar] [CrossRef] [Green Version]
- Samuels, G.J.; Dodd, S.L.; Gams, W.; Castlebury, L.A.; Petrini, O. Trichoderma Species Associated with the Green Mold Epidemic of Commercially Grown Agaricus bisporus. Mycologia 2002, 94, 146–170. [Google Scholar] [CrossRef]
- Liu, D.; Coloe, S.; Baird, R.; Pedersen, J. Rapid Mini-Preparation of Fungal DNA for PCR. J. Clin. Microbiol. 2000, 38, 471. [Google Scholar] [CrossRef]
- Gu, X.; Wang, R.; Sun, Q.; Wu, B.; Sun, J.Z. Four New Species of Trichoderma in the Harzianum Clade from Northern China. MycoKeys 2020, 73, 109–132. [Google Scholar] [CrossRef] [PubMed]






| S. NO | Soil Sample Code | CFU/g of Soil on PDA (102) | CFU/g of Soil on TSM (102) |
|---|---|---|---|
| 1 | A1 | 21 | 31 |
| 2 | A2 | 16 | 8.3 |
| 3 | A3 | 45.3 | 52 |
| 4 | A4 | 21 | 16.3 |
| 5 | A5 | 25.3 | 83 |
| 6 | A6 | 27.3 | 56.3 |
| S. No | Isolate Code | Total Radial Growth (mm) | Growth Rate (mm/day) |
|---|---|---|---|
| 1 | A (1) 1.1 | 81.2 | 11.6 |
| 2 | A (1) 2.2 | 54.6 | 7.8 |
| 3 | A (1) 1.2 T | 80.5 | 11.5 |
| 4 | A (1) 1.4 T | 79.8 | 11.4 |
| 5 | A (1) 2.1 | 25.2 | 3.6 |
| 6 | A (1) 2.1 T | 85 | 28.7 |
| 7 | A (1) 2.3 T | 85 | 6.7 |
| 8 | A (1) 2.4 T | 85 | 14.5 |
| 9 | A (1) 3.1 T | 13.3 | 1.9 |
| 10 | A (1) 3.2 T | 9.8 | 1.4 |
| 11 | A (1) 3.3 T | 45.5 | 6.5 |
| 12 | A (1) 3.4 T | 44.1 | 6.3 |
| 13 | A (2) 1.1 T | 42 | 6 |
| 14 | A (2) 1.2 T | 27.3 | 3.9 |
| 15 | A (2) 1.3 T | 70.7 | 10.1 |
| 16 | A (2) 1.4 T | 39.9 | 5.7 |
| 17 | A (2) 2.1 T | 53.9 | 7.7 |
| 18 | A (2) 3.1 T | 66.5 | 9.5 |
| 19 | A (2) 3.2 T | 81.9 | 11.7 |
| 20 | A (3) 1.1 T | 14.7 | 2.1 |
| 21 | A (3) 1.2 T | 57.4 | 8.2 |
| 22 | A (3) 1.3 T | 36.4 | 5.2 |
| 23 | A (3) 2.1 T | 65.1 | 9.3 |
| 24 | A (3) 2.2T | 53.9 | 7.7 |
| 25 | A (3) 2.3 T | 37.8 | 5.4 |
| 26 | A (3) 3.1 T | 85 | 14.5 |
| 27 | A (3) 3.2 T | 52.5 | 7.5 |
| 28 | A (3) 3.4 T | 64.4 | 9.2 |
| 29 | A (4) 1.1 | 81.2 | 11.6 |
| 30 | A (4) 1.2 T | 47.6 | 6.8 |
| 31 | A (4) 2.1 | 56.7 | 8.1 |
| 32 | A (4) 2.1 T | 45.5 | 6.5 |
| 33 | A (4) 2.2 T | 49.7 | 7.1 |
| 34 | A (4) 3.2 | 46.2 | 6.6 |
| 35 | A (5) 1.1 T | 81.9 | 11.7 |
| 36 | A (5) 1.2 T | 77.7 | 11.1 |
| 37 | A (5) 1.4 T | 72.1 | 10.3 |
| 38 | A (5) 2.1 T | 28 | 4 |
| 39 | A (5) 2.2 T | 73.5 | 10.5 |
| 40 | A (5) 3.1 T | 43.4 | 6.2 |
| 41 | A (5) 3.2 T | 50.4 | 7.2 |
| 42 | A (5) 3.3 T | 30.1 | 4.3 |
| 43 | A (5) 3.4 T | 27.3 | 3.9 |
| 44 | A (6) 1.2 T | 83.3 | 11.9 |
| 45 | A (6) 1.3 T | 84 | 12 |
| 46 | A (6) 2.1 T | 6.3 | 79 |
| 47 | A (6) 2.2T | 8.5 | 185 |
| 48 | A (6) 3.1 T | 81.2 | 11.6 |
| Code | A. alternata | F. oxysporum | H. rostratum |
|---|---|---|---|
| Percent Inhibition (%) | |||
| A (1) 2.1 T | 66 ± 0.82 | 82 ± 0.47 | 40 ± 0.82 |
| A (1) 2.3 T | 28 ± 0.82 | 19 ± 0.82 | 10 ± 1.25 |
| A (1) 2.4 T | 16 ± 0.82 | 22 ± 0.82 | 35 ± 0.82 |
| A (3) 3.1 T | 61 ± 0.82 | 64 ± 0.82 | 51± 0.47 |
| A (6) 2.1 T | 55 ± 1.25 | 19 ± 0.82 | 18 ± 0.82 |
| A (6) 2.2 T | 57 ± 1.25 | 62 ± 0.00 | 77 ± 0.82 |
| Code | Temp. | Radial Growth (mm) |
|---|---|---|
| A (1) 2.1 T | 26 °C | 85 ± 0.00 |
| 30 °C | 85 ± 0.00 | |
| 45 °C | 5 ± 0.00 | |
| 50 °C | 5 ± 0.00 | |
| A (1) 2.3 T | 26 °C | 85 ± 2.05 |
| 30 °C | 37 ± 23.37 | |
| 45 °C | 5 ± 0.00 | |
| 50 °C | 5 ± 0.00 | |
| A (1) 2.4 T | 26 °C | 85 ± 0.00 |
| 30 °C | 85 ± 2.36 | |
| 45 °C | 5 ± 0.00 | |
| 50 °C | 5 ± 0.00 | |
| A (3) 3.1 T | 26 °C | 85 ± 0.00 |
| 30 °C | 40 ± 18.71 | |
| 45 °C | 5 ± 0.00 | |
| 50 °C | 5 ± 0.00 | |
| A (6) 2.1 T | 26 °C | 79 ± 2.62 |
| 30 °C | 7 ± 0.47 | |
| 45 °C | 5 ± 0.00 | |
| 50 °C | 5 ± 0.00 | |
| A (6) 2.2 T | 26 °C | 85 ± 0.00 |
| 30 °C | 85 ± 5.73 | |
| 45 °C | 5 ± 0.00 | |
| 50 °C | 5 ± 0.00 |
| Code | Salinity | Radial Growth (mm) |
|---|---|---|
| A (1) 2.1 T | 0% | 85 ± 0.00 |
| 2% | 85 ± 0.00 | |
| 4% | 75.7 ± 3.30 | |
| 6% | 55.3 ± 1.70 | |
| 8% | 24.3 ± 1.25 | |
| 10% | 8.3 ± 0.47 | |
| A (1) 2.3 T | 0% | 85 ± 0.00 |
| 2% | 56 ± 1.41 | |
| 4% | 57.7 ± 2.05 | |
| 6% | 57 ± 16.57 | |
| 8% | 54.2 ± 2.36 | |
| 10% | 34.3 ± 11.15 | |
| A (1) 2.4 T | 0% | 85 ± 0.00 |
| 2% | 53 ± 2.45 | |
| 4% | 49 ± 9.90 | |
| 6% | 43.7 ± 4.64 | |
| 8% | 37.7 ± 12.28 | |
| 10% | 25 ± 4.55 | |
| A (3) 3.1 T | 0% | 85 ± 0.00 |
| 2% | 74.7 ± 2.62 | |
| 4% | 33.3 ± 4.03 | |
| 6% | 27.3 ± 5.25 | |
| 8% | 6 ± 0.00 | |
| 10% | 5 ± 0.00 | |
| A (6) 2.1 T | 0% | 85 ± 0.00 |
| 2% | 36.3 ± 13.96 | |
| 4% | 26.7 ± 3.30 | |
| 6% | 43.3 ± 13.02 | |
| 8% | 20.3 ± 0.47 | |
| 10% | 22.7 ± 2.36 | |
| A (6) 2.2 T | 0% | 85 ± 0.00 |
| 2% | 85 ± 0.00 | |
| 4% | 51 ± 6.38 | |
| 6% | 34 ± 2.16 | |
| 8% | 9.7 ± 0.94 | |
| 10% | 5 ± 0.00 |
| S. No. | Code | Location of Sample Collection [41] | Date of Collection |
|---|---|---|---|
| 1 | (A1) Forest | Al-soudah | 2 Junly 2019 |
| 2 | (A2) Agricultural soil | Al-badiei | 2 Junly 2019 |
| 3 | (A3) Agricultural soil | Al Areen | 2 Junly 2019 |
| 4 | (A4) Rocky soil | Almuazafina | 2 Junly 2019 |
| 5 | (A5) Soil near the water | Ain al-Dhibah | 16 Junly 2019 |
| 6 | (A6) Soil near the water | Sad wadi eashran | 15 Junly 2019 |
| Primer | Sequence 5′ 3′ |
|---|---|
| ITS5 (forward) | GGAAGTAAAAGTCGTAACAAGG |
| ITS4 (reverse) | TCCTCCGCTTATTGATATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alwadai, A.S.; Perveen, K.; Alwahaibi, M. The Isolation and Characterization of Antagonist Trichoderma spp. from the Soil of Abha, Saudi Arabia. Molecules 2022, 27, 2525. https://doi.org/10.3390/molecules27082525
Alwadai AS, Perveen K, Alwahaibi M. The Isolation and Characterization of Antagonist Trichoderma spp. from the Soil of Abha, Saudi Arabia. Molecules. 2022; 27(8):2525. https://doi.org/10.3390/molecules27082525
Chicago/Turabian StyleAlwadai, Aisha Saleh, Kahkashan Perveen, and Mona Alwahaibi. 2022. "The Isolation and Characterization of Antagonist Trichoderma spp. from the Soil of Abha, Saudi Arabia" Molecules 27, no. 8: 2525. https://doi.org/10.3390/molecules27082525
APA StyleAlwadai, A. S., Perveen, K., & Alwahaibi, M. (2022). The Isolation and Characterization of Antagonist Trichoderma spp. from the Soil of Abha, Saudi Arabia. Molecules, 27(8), 2525. https://doi.org/10.3390/molecules27082525

