Next Article in Journal
Quantitative Retention (Structure)–Activity Relationships in Predicting the Pharmaceutical and Toxic Properties of Potential Pesticides
Next Article in Special Issue
Doxorubicin-Based Hybrid Compounds as Potential Anticancer Agents: A Review
Previous Article in Journal
Rational Screening of High-Voltage Electrolytes and Additives for Use in LiNi0.5Mn1.5O4-Based Li-Ion Batteries
Previous Article in Special Issue
Effects of Regioisomerism on the Antiproliferative Activity of Hydroxystearic Acids on Human Cancer Cell Lines
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Synthesis and Anticancer Properties of New 3-Methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones

by
Agata Jaskulska
1,
Katarzyna Gach-Janczak
2,
Joanna Drogosz-Stachowicz
2,
Tomasz Janecki
1,* and
Anna Ewa Janecka
2,*
1
Institute of Organic Chemistry, Faculty of Chemistry, Lodz University of Technology, Żeromskiego 116, 90-924 Lodz, Poland
2
Department of Biomolecular Chemistry, Faculty of Medicine, Medicinal University of Lodz, Mazowiecka 6/8, 92-215 Lodz, Poland
*
Authors to whom correspondence should be addressed.
Molecules 2022, 27(11), 3597; https://doi.org/10.3390/molecules27113597
Submission received: 1 April 2022 / Revised: 21 April 2022 / Accepted: 1 June 2022 / Published: 3 June 2022
(This article belongs to the Special Issue Design and Synthesis of Organic Molecules as Antineoplastic Agents II)

Abstract

Quinolinones have been known for a long time as broad-spectrum synthetic antibiotics. More recently, the anticancer potential of this group of compounds has been investigated. Following this direction, we obtained a small library of 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones with various substituents at positions 1, 2, 6, and 7 of the quinolinone ring system. The cytotoxic activity of the synthesized analogs was tested in the MTT assay on two cancer cell lines in order to determine the structure–activity relationship. All compounds produced high cytotoxic effects in MCF-7, and even higher in HL-60 cells. 2-Ethyl-3-methylidene-1-phenylsulfonyl-2,3-dihydroquinolin-4(1H)-one, which was over 5-fold more cytotoxic for HL-60 than for normal HUVEC cells, was selected for further tests. This analog was shown to inhibit proliferation and induce DNA damage and apoptosis in HL-60 cells.

1. Introduction

Natural products, defined as chemical substances produced by living organisms, were generated for various purposes, the main of which was to develop and maintain different forms of life. According to the published data, 73% of currently available medications are either natural compounds isolated from plants, bacteria, or marine invertebrates or their chemically modified analogs [1]. The remaining 27% are totally synthetic drugs found by random screening.
Quinoline 1 is a compound found in coal tar. Numerous derivatives of quinoline, modified in one or both rings, were isolated from plants. A distinct group of natural compounds derived from quinoline are substituted quinolin-4-ones, also referred to as quinol-4-ones 2 (Figure 1) [1,2,3]. These compounds exhibit interesting biological activities and were used as intermediates in the synthesis of antibacterial, antifungal, and antimalarial agents [3,4,5,6]. More recently, the anticancer properties of synthetic, diversely substituted quinolin-4-ones have been extensively studied [7,8,9,10].
It is well known that the presence, position, and character of substituents play an important role in defining the biological activity of quinolinone molecules [11]. Substitution on nitrogen atom at position 1 is essential for overall potency, as well as the presence of a carbonyl group at position 4. The nature of substituents at positions 5–8 can affect the configuration of quinolinone molecules and influence anticancer activity. The substituent at position 3 should be co-planar with quinolinone moiety and the position 2 substituent should not disturb this co-planarity. One group of quinolinones, in which the condition of co-planarity is evidently fulfilled, are 3-alkylidenequinolin-4-ones 3. Furthermore, an exo-cyclic alkylidene moiety conjugated with a carbonyl group present in analogs 3 is a pharmacophoric unit known to be responsible for the cytotoxic properties of many natural products, including sesquiterpene lactones [12,13,14]. The cytotoxicity of compounds with an α,β-unsaturated carbonyl group is the result of their ability to alkylate cellular thiols in enzymes, other functional proteins, and in free intracellular glutathione, which disrupts some major processes in the cell, leading to inhibition of proliferation and the induction of apoptosis [15].
In our earlier paper, we introduced an exo-cyclic methylidene fragment into a quinolinone moiety, preparing 3-methylidene-2,3-dihydroquinolin-4-ones 4 (Figure 1) which were strongly cytotoxic against several cancer cell lines [16].
Encouraged by these results, herein, we describe the synthesis and cytotoxic activity of a series of 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5 (Figure 1) which were obtained in order to establish how various substituents in positions 1, 2, 6, and 7 of the quinolinone molecule can influence the in vitro cytotoxicity against promyelocytic leukemia HL-60 and breast cancer adenocarcinoma MCF-7. Normal human umbilical vein endothelial cells HUVEC were used for comparison. The most promising analog in terms of cytotoxicity and selectivity, 2-ethyl-3-methylidene-1-(phenylsulfonyl)-2,3-dihydroquinolin-4(1H)-one (5a), was evaluated for its ability to inhibit cell proliferation, induce DNA damage and apoptosis, and influence the mRNA level of an ABCB1 transporter that may be responsible for multidrug resistance in cancer cells.

2. Results and Discussion

2.1. Chemistry

The target compounds were synthesized by applying a modified methodology originally reported for the synthesis of 3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-ones [16]. Starting materials, methyl 2-(arylsulfonylamino)benzoates 7a-e, were synthesized by N-sulfonylation of the corresponding methyl 2-aminobenzoates 6 with arylsulfonyl chlorides. After crystallization with methanol, we obtained pure products 7a-e in good-to-moderate yields (58–85%) (Scheme 1). Next, we performed acylation of diethyl methylphosphonate (8) with obtained benzoates 7a-e in the presence of three equivalents of LDA and expected diethyl 2-oxo-2-[(2-arylsulfonylamino)phenyl]ethylphosphonate 9a-e were formed in good yields (62–87%). Condensation of 9a-e with selected alkyl and aryl aldehydes followed by the spontaneous intramolecular aza-Michael addition delivered 2-substituted 3-diethoxyphosphoryl-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 10a-t. The piperidine acetate was used as a catalyst and the reaction mixtures were stirred for 24–48 h at room temperature. Progress of the reaction was monitored by 31P-NMR. The crude products were purified by column chromatography. 1H, 13C, and 31P NMR spectra showed that obtained compounds were formed as mixtures of trans- and cis-2,3-dihydroquinolin-4(1H)-ones trans- and cis-10a-t and 3-diethoxyphosphoryl-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ols 10a-t, enol-10a-t, with the enol form strongly predominating (70–99%). Ketones 10 were formed as single trans-isomers or as mixtures of cis- and trans-isomers. Careful analysis of the 1H NMR spectra of the obtained compounds revealed characteristic singlets or doublets with chemical shifts in the range of 10.57–10.90 ppm and 4JH-p = 0.9–1.1 Hz, which were attributed to the protons of the hydroxyl group of the enol form. In case of ketones, configurational assignments were made on the bases of characteristic 3JH2-H3 coupling constants which were in the range of 1.1–1.5 Hz for trans isomers and 4.5–5.8 Hz for cis isomers. Thorough NMR analysis of 2-substituted 3-diethoxyphosphoryl-2,3-dihydroquinolinones was presented in our previous paper [16], and the results obtained in this work are with full agreement with that analysis. Table 1 shows trans- and cis-10a-t and enol-10a-t ratios, as well as yields of the synthesized products.
In the final step, mixtures of trans- and cis-2,3-dihydroquinolin-4(1H)-ones trans- and cis-10a-t and 2,3-dihydroquinolin-4(1H)-ols enol-10a-t were successfully used as Horner–Wadsworth–Emmons reagents in the olefination of formaldehyde. We performed the reaction using the standard procedure, with 30% formalin as a source of formaldehyde, in the presence of K2CO3 as a base. Progress of the reaction was monitored by TLC chromatography. We noticed that the time needed for completion of the reaction was significantly longer for 10 with alkyl substituents in position 2 (16 h) in comparison to aryl ones (3 h). After standard work-up and column chromatography of the crude products, the pure analogs 5a-t were obtained in yields given in Table 1.

2.2. Biology

2.2.1. In Vitro Cytotoxic Activity

The cytotoxicity of a series of 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t was tested against HL-60 and MCF-7 cell lines using the MTT assay. Carboplatin was used as a reference compound. The obtained results are summarized in Table 2. After 48 h incubation, all new analogs showed cytotoxic activity in low µM range against both cancer cell lines. The tested compounds were more cytotoxic for HL-60 than for MCF-7 cells. Analysis of the structure activity relationship revealed that quinolin-4(1H)-ones with alkyl substituent in position 2 were more potent than those bearing an aryl substituent in that position. In general, with one exception (5i), the highest activity was observed for analogs containing i-propyl substituent in position 2. In HL-60 cells, the most active analogs 5b, 5f, and 5r had IC50 values below 0.3 µM. Compounds 5m-p, with chlorine at position 6, were less but still very cytotoxic. The substituent on the nitrogen atom did not significantly affect the activity of the tested compounds.
In order to evaluate the influence of the new analogs on normal, non-cancerous cells, the selected compounds were tested on the HUVEC cell line. In most cases, the differences in IC50 values between normal and cancer cells were not very significant. Analog 5a (Figure 2a) showed the highest selectivity and was over 5-fold more cytotoxic for HL-60 than for HUVEC cells (Figure 2b). For comparison, the HUVEC/HL-60 IC50 ratio for carboplatin was 1.41.
Compound 5a was chosen for a more detailed evaluation of its anticancer potential in the HL-60 cell line. The MTT assay was performed for 5a after 24 h incubation and the IC50 value was 0.91 ± 0.03 µM (Figure 2c). Based on this data, three concentrations (0.9, 1.35 and 1.8 µM) were chosen for further experiments.

2.2.2. Inhibition of Cell Proliferation, Generation of DNA Damage, and Induction of Apoptosis by 5a

To evaluate the anticancer potential of 5a, the ability of this compound to inhibit cell proliferation, induce apoptotic cell death, and generate DNA damage was examined by flow cytometry using the ‘Apoptosis, DNA Damage, and Cell Proliferation Kit’ (BD Bioscience). After 24 h treatment with 5a in increasing concentrations, HL-60 cells were exposed to bromodeoxyuridine (BrdU) for additional 8 h. Then, the cells were simultaneously stained with fluorochrome-labeled anti-BrdU, anti-cleaved PARP (Asp214) and anti-H2AX (pS139). The representative results of multiparameter flow cytometry analysis are shown in Figure 3.
BrdU is an analog of thymidine, and its incorporation into DNA was used as an index of cell proliferation. 5a dose-dependently inhibited cell proliferation. At 1.8 µM concentration, this analog caused a 2.2-fold decrease in BrdU incorporation (Figure 4a).
To check whether the cytotoxic effect of 5a was associated with the induction of apoptosis, the pro-apoptotic activity of this compound was investigated. Apoptosis regulation is triggered by the activation of caspases [17]. Caspase-3, an effector caspase, cleaves a number of vital proteins, leading to cell death. The activity of caspase-3 was assessed by flow cytometry using fluorochrome-labeled antibodies recognizing 89 kDa-cleaved PARP fragments released from PARP by caspase-3 in the executive stage of apoptosis. Incubation of HL-60 cells with 10a (at 1.35 and 1.8 µM) for 24 h led to a significant increase in the number of apoptotic cells, whose population raised from 1.4% for control to 20.6% and 26.4%, respectively (Figure 4b).
It is well documented that apoptosis induced by many anticancer drugs may be a consequence of DNA damage [18]. Chemical genotoxins that target DNA can inhibit DNA replication, which leads to the collapse of replication forks and the formation of DNA double strand breaks (DSBs). The generation of DNA damage was evaluated using anti-H2AX (pS139) antibodies directed against the phosphorylated form of human H2AX protein at the pS139 residue that is considered to be a biomarker for DNA DSBs. The treatment of HL-60 cells with 5a increased the levels of phosphorylated H2AX by 4.7- and 7.8-fold (to 1.35 µM and 1.9 µM, respectively), indicating the dose-dependent genotoxic effect of the tested compound (Figure 4c).
Pro-apoptotic activity of 5a was also confirmed using FITC-Annexin V and PI double-staining, based on the loss of plasma membrane asymmetry (phosphatidylserine externalization), which is a marker of the earlier stages of apoptosis. Flow cytometry analysis showed that 5a (1.8 µM) increased early and late apoptotic cell fractions by up to 13.9% and 13.7% of the cell population, respectively (Figure 5).

2.2.3. Influence of 5a on ABCB1 Gene Expression

Overexpression of ATP-binding cassette (ABC) transporters causing multidrug resistance (MDR) in cancer cells is one of the major problems associated with poor therapeutic outcome of anticancer drugs [19]. ABC transporters reduce the cellular uptake of drugs into cancer cells, defending them from medical interventions. In leukemia cells ABCB1 (P-glycoprotein), overexpression has been observed [20,21]. In our previous study [16], we demonstrated that some selected 3-methylidenequinolin-4-ones significantly decreased the expression of ABCB1 gene in MCF-7 cells. We observed a 2-fold down regulation of this gene as compared with control, indicating that compounds with such a skeleton might have potential as ABCB1 transporter inhibitors, able to prevent MDR in MCF-7 cells. It seemed interesting to determine if 3-methylidenequinolin-4-one 5a would also down-regulate ABCB1 mRNA levels in leukemia HL-60 cells. Here, we tested the ABCB1 gene expression of 5a at two concentrations, 0.9 and 1.8 µM. Compound 5a decreased the ABCB1 mRNA level at a higher concentration (Figure 6).

3. Materials and Methods

3.1. Chemistry

3.1.1. General

Reagents and starting materials were purchased from commercial vendors and used without further purification. All organic solvents were dried over appropriate drying agents and distilled prior to use. Standard syringe techniques were used for transferring dry solvents. NMR spectra were recorded on a Bruker UltraShield 700 instrument, running at 700 MHz for 1H, 176 MHz for 13C, and 283 MHz for 31P. Chemical shifts (δ) are reported in ppm relative to residual solvent signals (CDCl3: 7.26 ppm for 1H, 77.16 ppm for 13C NMR). 31P NMR spectra were recorded using broadband proton decoupling. Melting points were determined in open capillaries and are uncorrected. Column chromatography was performed on Aldrich® silica gel 60 (230–400 mesh). Thin-layer chromatography was performed with precoated TLC sheets of silica gel 60 F254 (Aldrich®) and visualized by ultraviolet irradiation.
General procedures and characterization data for compounds 9a-e and 10a-t as well as 1H- and 13C NMR spectra of compounds 5a-t are given in Supplementary Materials.

3.1.2. Experimental Procedure for the Synthesis of 3-Methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t

A solution of the corresponding diethyl (4-hydroxy-1-sulfonyl-1,2-dihydro-3-yl)phosphonate 10a-t (1.0 mmol) and potassium carbonate (414 mg, 3.0 mmol) in THF (10 mL) was stirred at room temperature for 30 min under argon atmosphere. Then, formaldehyde solution, 36% in water (410 µL, 5.0 mmol), was added in one portion, and the solution was heated to 50 °C. The mixture was stirred for 3 h when the 2-aryl substituted substrate was used, and for 16 h in the case of the 2-alkyl substituent. The reaction was quenched with brine (10 mL) and the mixture was extracted with ethyl acetate (3 × 20 mL). The organic layers were combined, washed with 10% potassium carbonate, water, and brine (30 mL) and were dried over MgSO4. The evaporation of the solvent gave crude product, which was purified by column chromatography (eluent: hexane/ethyl acetate 3:1).
2-Ethyl-3-methylidene-1-(phenylsulfonyl)-2,3-dihydroquinolin-4(1H)-one (5a). Yield: 210 mg (64%). White solid. Rf (hexane/ethyl acetate 3:1) 0.44, mp: 110 °C. 1H-NMR (700 MHz, CDCl3): δ 7.90 (ddd, J = 7.8, 1.7, 0.5 Hz, 1H), 7.84 (ddd, J = 8.2, 1.1, 0.5 Hz, 1H), 7.63 (ddd, J = 8.2, 7.3, 1.7 Hz, 1H), 7.45 (ddt, J = 8.7, 7.3, 1.1 Hz, 1H), 7.38–7.36 (m, 2H), 7.35–7.33 (m, H), 7.29–7.26 (m, 2H), 5.96 (d, J = 1.0 Hz, 1H), 5.22 (t, J = 1.0 Hz, 1H), 4.94 (dd, J = 9.2, 6.7 Hz, 1H), 1.68 (ddq, J = 14.4, 9.2, 7.3 Hz, 1H), 1.47 (ddd, J = 14.4, 7.3, 6.7 Hz, 1H), 0.97 (t, J = 7.3 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 181.92, 141.25, 139.74, 137.78, 134.72, 133.36, 129.00, 128.40, 128.22, 128.09, 127.70, 127.15, 124.07, 63.16, 28.44, 10.70. ESI-MS: 328.0 ([M+H]+). Anal. Calcd. for C18H17NO3S: C, 66.04; H, 5.23. Found: C, 66.19; H, 5.21.
3-Methylidene-1-(phenylsulfonyl)-2-(propan-2-yl)-2,3-dihydroquinolin-4(1H)-one (5b). Yield: 100 mg (29%). White solid. Rf (hexane/ethyl acetate 3:1) 0.49, mp: 86 °C. 1H-NMR (700 MHz, CDCl3): δ 7.90 (dd, J = 7.6, 1.7 Hz, 1H), 7.86 (dd, J = 8.2, 1.2 Hz, 1H), 7.63 (ddd, J = 8.2, 7.6, 1.7 Hz, 1H), 7.45 (tt, J = 7.4, 1.2 Hz, 1H), 7.40–7.35 (m, 2H), 7.34 (td, J = 7.6, 1.2 Hz, 1H), 7.29–7.26 (m, 2H), 5.99 (d, J = 1.1 Hz, 1H), 5.17 (t, J = 1.1 Hz, 1H), 4.54 (d, J = 10.3 Hz, 1H), 1.61 (dp, J = 10.3, 6.6 Hz, 1H), 1.08 (d, J = 6.6 Hz, 3H), 0.82 (d, J = 6.6 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 182.36, 140.19, 139.92, 138.15, 134.80, 133.31, 128.98, 128.32, 128.14, 128.04, 127.04, 125.35, 68.23, 30.64, 19.83, 19.35. Anal. Calcd. for C19H19NO3S: C, 66.84; H, 5.61. Found: C, 66.63; H, 5.52.
3-Methylidene-2-phenyl-1-(phenylsulfonyl)-2,3-dihydroquinolin-4(1H)-one (5c). Yield: 190 mg (51%). White solid. Rf (hexane/ethyl acetate 3:1) 0.49, mp: 150 °C. 1H-NMR (700 MHz, CDCl3): δ 7.83 (ddd, J = 9.4, 8.0, 1.3 Hz, 2H), 7.53 (ddd, J = 8.2, 7.3, 1.7 Hz, 1H), 7.50 (ddt, J = 8.7, 7.4, 1.3 Hz, 1H), 7.48–7.46 (m, 2H), 7.35–7.29 (m, 4H), 7.25–7.10 (m, 3H), 7.19–7.15 (m, 1H), 6.32 (s, 1H), 6.23 (d, J = 1.0 Hz, 1H), 5.43 (t, J = 1.0 Hz, 1H). 13C NMR (176 MHz, CDCl3): δ 182.08, 140.00, 138.86, 137.91, 137.41, 134.87, 133.54, 129.10, 128.65, 128.16, 128.14, 128.10, 128.08, 127.77, 127.08, 126.37, 63.63. Anal. Calcd. for C22H17NO3S: C, 70.38; H, 4.56. Found: C, 70.19; H, 4.50.
2-(4-Methoxyphenyl)-3-methylidene-1-(phenylsulfonyl)-2,3-dihydroquinolin-4(1H)-one (5d). Yield: 210 mg (52%). White solid. Rf (hexane/ethyl acetate 3:1) 0.36, mp: 152 °C. 1H-NMR (700 MHz, CDCl3): δ 7.84 (ddd, J = 7.8, 1.7, 0.5 Hz, 1H), 7.79 (ddd, J = 8.2, 1.2, 0.5 Hz, 1H), 7.53 (ddd, J = 8.2, 7.3, 1.7 Hz, 1H), 7.49 (ddt, J = 8.7, 7.6, 1.2 Hz, 1H), 7.47–7.44 (m, 2H), 7.34–7.31 (m, 2H), 7.24 (ddd, J = 7.8, 7.3, 1.1 Hz, 1H), 7.22–7.18 (m, 2H), 6.74–6.71 (m, 2H), 6.26 (s, 1H), 6.19 (d, J = 1.0 Hz, 1H), 5.39 (t, J = 1.0 Hz, 1H), 3.69 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 182.20, 159.38, 139.97, 139.05, 137.95, 134.83, 133.51, 129.40, 129.09, 128.36, 128.22, 128.19, 128.03, 127.76, 127.05, 126.07, 114.01, 63.25, 55.27. Anal. Calcd. for C23H19NO4S: C, 68.13; H, 4.72. Found: C, 68.41; H, 4.83.
1-((4-Chlorophenyl)sulfonyl)-2-ethyl-3-methylidene-2,3-dihydroquinolin-4(1H)-one (5e). Yield: 340 mg (94%). White solid. Rf (hexane/ethyl acetate 3:1) 0.56, mp: 118 °C. 1H-NMR (700 MHz, CDCl3): δ 7.91 (dd, J = 7.8, 1.7 Hz, 1H), 7.82 (dd, J = 8.2, 1.1 Hz, 1H), 7.63 (ddd, J = 8.2, 7.3, 1.7 Hz, 1H), 7.36 (td, J = 7.5, 1.1 Hz, 1H), 7.32–7.28 (m, 2H), 7.26–7.23 (m, 2H), 6.03 (d, J = 1.0 Hz, 1H), 5.27 (t, J = 1.0 Hz, 1H), 4.94 (dd, J = 9.2, 6.6 Hz, 1H), 1.67 (ddq, J = 14.4, 9.2, 7.3 Hz, 1H), 1.47 (dp, J = 14.4, 7.3 Hz, 1H), 0.96 (t, J = 7.3 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 181.76, 141.22, 139.99, 139.40, 136.38, 134.82, 129.28, 129.07, 128.26, 128.13, 127.34, 124.24, 63.29, 28.39, 10.66. ESI-MS: 362.0 ([M+H]+). Anal. Calcd. for C18H16ClNO3S: C, 59.75; H, 4.46. Found: C, 59.54; H, 4.57.
1-((4-Chlorophenyl)sulfonyl)-3-methylidene-2-(propan-2-yl)-2,3-dihydroquinolin-4(1H)-one (5f). Yield: 300 mg (80%). White solid. Rf (hexane/ethyl acetate 3:1) 0.56, mp: 126 °C. 1H-NMR (700 MHz, CDCl3): δ 7.91 (dd, J = 7.6, 1.7 Hz, 1H), 7.83 (dd, J = 8.2, 1.1 Hz, 1H), 7.63 (ddd, J = 8.2, 7.6, 1.7 Hz, 1H), 7.35 (td, J = 7.6, 1.1 Hz, 1H), 7.31–7.29 (m, 2H), 7.26–7.23 (m, 2H), 6.06 (d, J = 1.0 Hz, 1H), 5.22 (t, J = 1.0 Hz, 1H), 4.53 (d, J = 10.3 Hz, 1H), 1.60 (dp, J = 10.3, 6.6 Hz, 1H), 1.06 (d, J = 6.6 Hz, 3H), 0.81 (d, J = 6.6 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 182.13, 139.89, 139.83, 139.76, 136.62, 134.87, 129.23, 129.01, 128.25, 128.17, 127.86, 127.21, 125.49, 68.30, 30.55, 19.75, 19.27. Anal. Calcd. for C19H18ClNO3S: C, 60.72; H, 4.83. Found: C, 60.65; H, 4.89.
1-((4-Chlorophenyl)sulfonyl)-3-methylidene-2-phenyl-1-(phenylsulfonyl)-2,3-dihydroquinolin-4(1H)-one (5g). Yield: 230 mg (56%). White solid. Rf (hexane/ethyl acetate 3:1) 0.54, mp: 178 °C. 1H-NMR (700 MHz, CDCl3): δ 7.85 (dd, J = 7.6, 1.7 Hz, 1H), 7.80 (dd, J = 8.2, 1.1 Hz, 1H), 7.54 (ddd, J = 8.2, 7.6, 1.7 Hz, 1H), 7.42–7.38 (m, 2H), 7.33–7.28 (m, 4H), 7.25 (td, J = 7.6, 1.1 Hz, 1H), 7.25–7.19 (m, 2H), 7.20–7.15 (m, 1H), 6.33 (s, 1H), 6.31 (d, J = 1.0 Hz, 1H), 5.48 (t, J = 1.0 Hz, 1H). 13C NMR (176 MHz, CDCl3): δ 181.95, 140.22, 139.70, 138.93, 137.20, 136.48, 134.97, 129.41, 129.16, 128.72, 128.27, 128.20, 128.10, 128.06, 127.30, 127.05, 126.50, 63.78. Anal. Calcd. for C22H16ClNO3S: C, 64.47; H, 3.93. Found: C, 64.66; H, 3.92.
1-((4-Chlorophenyl)sulfonyl)-2-(4-methoxyphenyl)-3-methylidene-2,3-dihydroquinolin-4(1H)-one (5h). Yield: 420 mg (95%). White solid. Rf (hexane/ethyl acetate 3:1) 0.35, mp: 140 °C. 1H-NMR (700 MHz, CDCl3): δ 7.85 (dd, J = 7.5, 1.7 Hz, 1H), 7.77 (dd, J = 8.3, 1.1 Hz, 1H), 7.53 (ddd, J = 8.3, 7.5, 1.7 Hz, 1H), 7.40–7.37 (m, 2H), 7.31–7.28 (m, 2H), 7.24 (td, J = 7.5, 1.1 Hz, 1H), 7.20–7.18 (m, 2H), 6.75–6.71 (m, 2H), 6.27 (s, 2H), 5.45 (d, J = 1.0 Hz, 1H), 3.68 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 182.05, 159.44, 140.14, 139.64, 139.07, 136.50, 134.91, 129.37, 129.15, 129.13, 128.31, 128.18, 128.11, 128.09, 127.23, 126.20, 114.06, 63.37, 55.26. Anal. Calcd. for C23H18ClNO4S: C, 62.80; H, 4.12. Found: C, 62.83; H, 4.19.
2-Ethyl-6,7-dimethoxy-3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5i). Yield: 170 mg (42%). White solid. Rf (hexane/ethyl acetate 3:1) 0.10, mp: 168 °C. 1H-NMR (700 MHz, CDCl3): δ 7.31 (s, 1H), 7.30 (s, 1H), 7.26–7.23 (m, 2H), 7.07–7.04 (m, 2H), 5.91 (d, J = 1.1 Hz, 1H), 5.17 (t, J = 1.1 Hz, 1H), 4.89 (dd, J = 9.0, 7.0 Hz, 1H), 4.01 (s, 3H), 3.90 (s, 3H), 2.30 (s, 3H), 1.70 (ddq, J = 14.6, 9.0, 7.0 Hz, 1H), 1.45 (dp, J = 14.2, 7.0 Hz, 1H), 0.96 (t, J = 7.0 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 180.88, 154.38, 148.23, 144.22, 141.15, 135.19, 134.60, 129.52, 127.73, 123.40, 121.15, 110.63, 108.43, 63.47, 56.64, 56.20, 28.36, 21.61, 10.78. ESI-MS: 402.0 ([M+H]+). Anal. Calcd. for C21H23NO5S: C, 62.83; H, 5.77. Found: C, 62.87; H, 5.83.
6,7-Dimethoxy-3-methylidene-2-(propan-2-yl)-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5j). Yield: 350 mg (85%). White solid. Rf (hexane/ethyl acetate 3:1) 0.10, mp: 150 °C. 1H-NMR (700 MHz, CDCl3): δ 7.31 (s, 1H), 7.30 (s, 1H), 7.25–7.23 (m, 2H), 7.06–7.03 (m, 2H), 5.92 (d, J = 1.3 Hz, 1H), 5.12 (dd, J = 1.3, 0.7 Hz, 1H), 4.48 (d, J = 10.1 Hz, 1H), 4.01 (s, 3H), 3.88 (s, 3H), 2.29 (s, 3H), 1.63 (dhept, J = 10.1, 6.6 Hz, 1H), 1.06 (d, J = 6.6 Hz, 3H), 0.78 (d, J = 6.6 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 181.30, 154.39, 148.12, 144.11, 139.77, 135.57, 134.87, 129.46, 127.65, 124.66, 121.20, 110.21, 108.40, 68.46, 56.64, 56.16, 30.52, 21.57, 19.99, 19.36. Anal. Calcd. for C22H25NO5S: C, 63.60; H, 6.06. Found: C, 63.56; H, 6.04.
6,7-Dimethoxy-3-methylidene-2-phenyl-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5k). Yield: 340 mg (76%). Pale yellow solid. Rf (hexane/ethyl acetate 3:1) 0.12, mp: 196 °C. 1H-NMR (700 MHz, CDCl3): δ 7.38–7.33 (m, 2H), 7.31 (dt, J = 8.1, 1.2 Hz, 2H), 7.29 (s, 1H), 7.25 (s, 1H), 7.25–7.20 (m, 2H), 7.20–7.15 (m, 1H), 7.14–7.10 (m, 2H), 6.26 (s, 1H), 6.18 (d, J = 1.1 Hz, 1H), 5.39 (t, J = 1.1 Hz, 1H), 3.97 (s, 3H), 3.83 (s, 3H), 2.34 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 181.06, 154.48, 148.15, 144.48, 138.86, 137.89, 135.46, 134.73, 129.63, 128.00, 127.81, 127.02, 125.71, 121.28, 110.35, 108.34, 63.91, 56.60, 56.07, 21.65. Anal. Calcd. for C25H23NO5S: C, 66.80; H, 5.16. Found: C, 66.96; H, 5.18.
6,7-Dimethoxy-2-(4-methoxyphenyl)-3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5l). Yield: 360 mg (75%). Pale yellow solid. Rf (hexane/ethyl acetate 3:1) 0.06, mp: 196 °C. 1H-NMR (700 MHz, CDCl3): δ 7.37–7.32 (m, 2H), 7.26 (s, 1H), 7.25 (s, 1H), 7.23–7.19 (m, 2H), 7.14–7.09 (m, 2H), 6.76–6.72 (m, 2H), 6.21 (s, 1H), 6.15 (d, J = 1.1 Hz, 1H), 5.35 (t, J = 1.1 Hz, 1H), 3.97 (s, 3H), 3.84 (s, 3H), 3.70 (s, 3H), 2.34 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 181.18, 159.32, 154.45, 148.12, 144.43, 139.04, 135.41, 134.76, 129.91, 129.62, 128.29, 127.80, 125.45, 121.32, 113.93, 110.42, 108.31, 63.52, 56.60, 56.08, 55.26, 21.66. Anal. Calcd. for C26H25NO6S: C, 65.12; H, 5.25. Found: C, 65.21; H, 5.29.
6-Chloro-2-ethyl-3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5m). Yield: 50 mg (13%). White solid. Rf (hexane/ethyl acetate 3:1) 0.53, mp: 126 °C. 1H-NMR (700 MHz, CDCl3): δ 7.88 (d, J = 2.6 Hz, 1H), 7.83 (d, J = 8.7 Hz, 1H), 7.59 (dd, J = 8.7, 2.6 Hz, 1H), 7.31–7.27 (m, 2H), 7.14–7.10 (m, 2H), 6.03–6.00 (m, 1H), 5.28 (t, J = 0.9 Hz, 1H), 4.94 (dd, J = 9.2, 6.7 Hz, 1H), 2.35 (s, 3H), 1.69 (ddq, J = 14.4, 9.2, 7.3 Hz, 1H), 1.48 (ddd, J = 14.4, 7.3, 6.7 Hz, 1H), 0.99 (t, J = 7.3 Hz, 4H). 13C NMR (176 MHz, CDCl3): δ 181.05, 144.60, 140.79, 138.36, 134.71, 134.59, 133.15, 129.79, 129.76, 129.08, 127.74, 127.72, 124.76, 63.05, 28.43, 21.68, 10.68. ESI-MS: 375.9 ([M+H]+). Anal. Calcd. for C19H18ClNO3S: C, 60.72; H, 4.83. Found: C, 60.67; H, 4.94.
6-Chloro-3-methylidene-2-(propan-2-yl)-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5n). Yield: 130 mg (33%). White solid. Rf (hexane/ethyl acetate 3:1) 0.56, mp: 130 °C. 1H-NMR (700 MHz, CDCl3): δ 7.86 (d, J = 2.6 Hz, 1H), 7.82 (d, J = 8.7 Hz, 1H), 7.57 (dd, J = 8.7, 2.6 Hz, 1H), 7.29–7.24 (m, 2H), 7.11–7.08 (m, 2H), 6.02 (d, J = 1.1 Hz, 1H), 5.21 (t, J = 1.1 Hz, 1H), 4.53 (d, J = 10.2 Hz, 1H), 2.33 (s, 3H), 1.59 (dp, J = 10.2, 6.6 Hz, 1H), 1.06 (d, J = 6.6 Hz, 3H), 0.81 (d, J = 6.6 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 181.44, 144.51, 139.41, 138.73, 135.00, 134.63, 133.01, 129.72, 129.39, 129.13, 127.74, 127.66, 126.05, 68.03, 30.62, 21.66, 19.79, 19.28. Anal. Calcd. for C20H20ClNO3S: C, 61.61; H, 5.17. Found: C, 61.49; H, 5.25.
6-Chloro-3-methylidene-2-phenyl-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5o). Yield: 220 mg (52%). White solid. Rf (hexane/ethyl acetate 3:1) 0.58, mp: 162 °C. 1H-NMR (700 MHz, CDCl3): δ 7.79 (d, J = 2.6 Hz, 1H), 7.78 (d, J = 8.8 Hz, 1H), 7.47 (dd, J = 8.7, 2.6 Hz, 1H), 7.38–7.35 (m, 2H), 7.28 (dt, J = 8.3, 1.2 Hz, 2H), 7.25–7.22 (m, 2H), 7.22–7.18 (m, 1H), 7.17–7.14 (m, 2H), 6.30 (s, 1H), 6.26 (d, J = 1.0 Hz, 1H), 5.47 (t, J = 1.0 Hz, 1H), 2.37 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 181.22, 144.81, 138.60, 138.42, 137.16, 134.82, 134.71, 133.05, 129.85, 129.54, 129.01, 128.76, 128.26, 127.79, 127.70, 127.05, 127.00, 63.49, 21.68. Anal. Calcd. for C23H18ClNO3S: C, 65.17; H, 4.28. Found: C, 64.98; H, 4.39.
6-Chloro-2-(4-methoxyphenyl)-3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5p). Yield: 340 mg (75%). White solid. Rf (hexane/ethyl acetate 3:1) 0.36, mp: 150°C. 1H-NMR (700 MHz, CDCl3): δ 7.78 (d, J = 2.6 Hz, 1H), 7.75 (d, J = 8.7 Hz, 1H), 7.46 (dd, J = 8.7, 2.6 Hz, 1H), 7.37–7.34 (m, 2H), 7.19–7.16 (m, 2H), 7.15–7.13 (m, 2H), 6.76–6.72 (m, 2H), 6.24 (d, J = 1.0 Hz, 1H), 6.22 (d, J = 1.0 Hz, 1H), 5.43 (t, J = 1.0 Hz, 1H), 3.70 (s, 3H), 2.35 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 181.35, 159.50, 144.76, 138.61, 138.57, 134.87, 134.66, 133.00, 129.83, 129.59, 129.10, 129.05, 128.33, 127.78, 127.64, 126.70, 114.12, 63.12, 55.30, 21.68. Anal. Calcd. for C24H20ClNO4S: C, 63.50; H, 4.44. Found: C, 63.37; H, 4.53.
6. -Bromo-2-ethyl-3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5q). Yield: 270 mg (64%). White solid. Rf (hexane/ethyl acetate 3:1) 0.52, mp: 132 °C. 1H-NMR (700 MHz, CDCl3): δ 8.02 (dd, J = 2.3, 0.5 Hz, 1H), 7.74 (dd, J = 8.7, 0.5 Hz, 1H), 7.72 (dd, J = 8.7, 2.3 Hz, 1H), 7.29–7.26 (m, 2H), 7.12–7.09 (m, 2H), 5.99 (d, J = 1.0 Hz, 1H), 5.26 (t, J = 1.0 Hz, 1H), 4.92 (dd, J = 9.2, 6.7 Hz, 1H), 2.34 (s, 3H), 1.67 (ddq, J = 14.4, 9.2, 7.3 Hz, 1H), 1.47 (ddd, J = 14.4, 7.3, 6.7 Hz, 1H), 0.97 (t, J = 7.3 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 180.98, 144.63, 140.85, 138.91, 137.50, 134.80, 130.84, 129.96, 129.80, 129.32, 127.74, 124.74, 120.85, 63.07, 28.45, 21.68, 10.68. ESI-MS: 419.9 ([M+H]+). Anal. Calcd. for C19H18BrNO3S: C, 54.29; H, 4.32. Found: C, 54.32; H, 4.30.
6-Bromo-3-methylidene-2-(propan-2-yl)-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5r). Yield: 210 mg (48%). White solid. Rf (hexane/ethyl acetate 3:1) 0.56, mp: 118 °C. 1H-NMR (700 MHz, CDCl3): δ 8.01 (d, J = 2.4 Hz, 1H), 7.76 (d, J = 8.7 Hz, 1H), 7.71 (dd, J = 8.7, 2.4 Hz, 1H), 7.30–7.25 (m, 2H), 7.12–7.08 (m, 2H), 6.02 (d, J = 1.1 Hz, 1H), 5.21 (t, J = 1.1 Hz, 1H), 4.53 (d, J = 10.2 Hz, 1H), 2.33 (s, 3H), 1.60 (dp, J = 10.2, 6.6 Hz, 1H), 1.06 (d, J = 6.6 Hz, 3H), 0.82 (d, J = 6.6 Hz, 3H). 13C NMR (176 MHz, CDCl3): δ 181.37, 144.54, 139.47, 139.28, 137.54, 135.08, 130.84, 129.75, 129.57, 129.38, 127.68, 126.01, 120.70, 68.05, 30.68, 21.67, 19.81, 19.30. Anal. Calcd. for C20H20BrNO3S: C, 55.31; H, 4.64. Found: C, 55.38; H, 4.63.
6-Bromo-3-methylidene-2-phenyl-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5s). Yield: 240 mg (51%). White solid. Rf (hexane/ethyl acetate 3:1) 0.57, mp: 162 °C. 1H-NMR (700 MHz, CDCl3): δ 7.94 (d, J = 2.4 Hz, 1H), 7.71 (d, J = 8.7 Hz, 1H), 7.62 (dd, J = 8.7, 2.4 Hz, 1H), 7.38–7.35 (m, 2H), 7.28 (ddt, J = 7.6, 2.4, 1.0 Hz, 2H), 7.24 (ddd, J = 7.6, 6.7, 1.3 Hz, 2H), 7.22–7.18 (m, 1H), 7.17–7.14 (m, 2H), 6.29 (t, J = 0.9 Hz, 1H), 6.25 (d, J = 1.0 Hz, 1H), 5.46 (t, J = 0.9 Hz, 1H), 2.37 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 181.17, 144.87, 139.16, 138.52, 137.63, 137.20, 134.93, 130.82, 129.90, 129.73, 129.27, 128.82, 128.32, 127.83, 127.10, 126.96, 120.83, 63.54, 21.73. Anal. Calcd. for C23H18BrNO3S: C, 58.98; H, 3.87. Found: C, 58.79; H, 3.96.
6-Bromo-2-(4-methoxyphenyl)-3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-one (5t). Yield: 190 mg (38%). White solid. Rf (hexane/ethyl acetate 3:1) 0.38, mp: 168 °C. 1H-NMR (700 MHz, CDCl3): δ 7.94 (d, J = 2.4 Hz, 1H), 7.69 (d, J = 8.7 Hz, 1H), 7.61 (dd, J = 8.7, 2.4 Hz, H), 7.38–7.34 (m, 2H), 7.20–7.15 (m, 2H), 7.16–7.14 (m, 2H), 6.77–6.72 (m, 2H), 6.24 (s, 1H), 6.22 (d, J = 1.0 Hz, 1H), 5.43 (t, J = 1.0 Hz, 1H), 3.71 (s, 3H), 2.36 (s, 3H). 13C NMR (176 MHz, CDCl3): δ 181.27, 159.56, 144.79, 139.11, 138.66, 137.56, 134.95, 130.74, 129.86, 129.76, 129.29, 129.13, 128.36, 127.80, 126.66, 120.75, 114.17, 63.14, 55.33, 21.70. Anal.Calcd. for C24H20BrNO4S: C, 57.84; H, 4.05. Found: C, 57.71; H, 4.09.

3.2. Biology

3.2.1. Cell Lines and Cell Culture

The promyelocytic leukemia HL-60 and breast cancer adenocarcinoma MCF-7 cell lines were purchased from the European Collection of Cell Cultures (ECACC). Leukemia cells were cultured in RPMI 1640 plus GlutaMax I medium (Gibco/Life Technologies, Carlsbad, CA, USA). MCF-7 cells were maintained in Minimum Essential Medium Eagle (Sigma Aldrich, St. Louis, MO, USA) and supplemented with 2 mM glutamine and men non-essential amino acid solution (Sigma Aldrich, St. Louis, MO, USA). Both media were supplemented with 10% heat-inactivated fetal bovine serum (Biological Industries, Beit-Haemek, Israel) and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin) (Sigma-Aldrich, St. Louis, MO, USA). Human umbilical vein endothelial cells (HUVECs) were purchased from the American Type Culture Collection (ATCC). Cells were cultured using EGM-2 Endothelial Medium BulletKit purchased from Lonza (Lonza, Walkersville, MD, USA). Cells were maintained at 37 °C in 5% CO2 atmosphere and grown until 80% confluent.
The tested compounds were dissolved in sterile dimethyl sulfoxide (DMSO) and further diluted with culture medium. The final concentration of DMSO in cell cultures was less than 0.1% v/v. Controls without and with 0.1% DMSO were performed in each experiment. At the used concentration, DMSO had no effect on the observed parameters.

3.2.2. In Vitro Cytotoxicity Assay (MTT)

The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, which measures the activity of cellular dehydrogenases, was performed according to the Mosmann method [22]. Exponentially growing cells were seeded into 24-well plates at a density of 8 × 104 cells/mL and left to grow for 24 h. After 24 h or 48 h of incubation with various concentrations of the tested compounds (dissolved in DMSO and diluted with complete culture medium), cells were incubated with 0.1 mL of MTT solution (5 mg/mL in phosphate buffered saline) for 1.5 h. The metabolically active cells reduced MTT to blue formazan crystals. The plates were centrifuged, and the supernatant was discarded. DMSO (1 mL) was added to each well to dissolve the crystals, whose absorbance was measured at 560 nm using FlexStation 3 Multi-Mode Microplate Reader (Molecular Devices, LLC, San Jose, CA, USA). The untreated cells were used as control. The IC50 values were calculated from the concentration–response curves. The data were expressed as mean ± SEM of three independent experiments.

3.2.3. Analysis of Apoptosis by Flow Cytometry Using FITC-Annexin V and Propidium Iodide (PI) Double-Staining

Apoptotic cell death was determined using FITC-Annexin V Apoptosis Detection Kit I (BD Bioscience, San Jose, CA, USA). Briefly, HL-60 cells were seeded in the 6-well plates (4.0 × 105 cells/well) in 2 mL of the culture medium and treated with 10a for 24 h. Afterwards, the cells were collected by centrifugation (300× g, 5 min), washed with PBS, re-suspended in binding buffer and stained with FITC-conjugated annexin V and propidium iodide (PI) according to the manufacturer guidelines (15 min, at room temperature). The samples were analyzed by flow cytometry using CytoFLEX (Beckman Coulter, Inc., Brea, CA, USA). Data analysis was performed using Kaluza Analysis Software v2 (Beckman Coulter, Inc., Brea, CA, USA).

3.2.4. Analysis of Cell Proliferation, Apoptosis, and DNA Damage by Flow Cytometry

Cell proliferation, DNA damage, and apoptotic cell death were determined using Apoptosis, DNA Damage, and Cell Proliferation Kit (BD Bioscience, San Jose, CA, USA), according to the manufacturer protocol. Briefly, HL-60 cells were seeded in 6-well plates (4.0 × 105 cells/mL) in 2 mL of growth medium and treated with 5a for 24 h. Afterwards, the bromodeoxyuridine (BrdU, 10 µM) was added and the cells were incubated for additional 8 h. Next, the cells were collected by centrifugation (300× g, 5 min), counted, fixed, and permeabilized according to the manufacturer’s instructions. The cells were incubated with DNase (300 µg/mL in PBS) for 1 h at 37 °C and then simultaneously stained with fluorochrome-labeled anti-BrdU, H2AX (pS139), and cleaved PARP (Asp214) antibodies, for 20 min at room temperature. After washing, DNA staining with DAPI (1 µg/mL of the staining buffer) was performed, and the cells were analyzed by flow cytometry using CytoFLEX (Beckman Coulter, Inc., Brea, CA, USA).

3.2.5. Real-Time PCR

The mRNA level of the ABCB1 gene was assessed using quantitative real-time PCR. Briefly, HL-60 cells were seeded in 6-well plates (4.0 × 105 cells/mL) in 2 mL of growth medium and treated with 5a for 24 h. Total RNA was extracted using the Total RNA Mini Kit (A&A Biotechnology, Gdynia, Poland) according to the manufacturer’s protocol. The concentration of RNA used for further experiments was 500 ng. cDNA was synthesized using Transcriba Kit (A&A Biotechnology, Gdynia, Poland). The amplification of cDNA was performed using RT PCR Mix SYBR (A&A Biotechnology, Gdynia, Poland) and gene specific primers (Table 3) in the Stratagene Mx3005P QPCR System (Agilent Technologies, Inc. Santa Clara, CA, USA) according to the manufacturer’s guidelines. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference gene. The expression level of ABCB1 gene was determined by the 2−∆∆CT method [23].

3.2.6. Statistical Analysis

All statistical calculations were performed using Prism 5.0 software (GraphPad Software Inc., San Diego, CA, USA). Results from three independent experiments performed in triplicate were expressed as mean ± SEM. Statistical significance was assessed using Student’s t-test (for comparisons of two treatment groups) or one-way ANOVA followed by a post-hoc multiple comparison Student–Newman–Keuls test (for comparisons of three or more groups). p-values < 0.05 were considered statistically significant.

4. Conclusions

Quinolinones have been known for years as efficient, broad spectrum antibiotics. In the last decade, yet another important activity of these compounds, their ability to inhibit cancer cell proliferation, has been investigated. In order to obtain a wide spectrum of diversely substituted quinolinone derivatives, the development of synthetic methods leading to such compounds has been pursued. Here, we used the well-recognized Horner–Wadsworth–Emmons (HWE) olefination in order to introduce the exo-methylidene group onto the heterocyclic ring of dihydroquinolin-4(1H)-ones. The α,β-unsaturated carbonyl function is a structural element responsible for interaction with various cellular proteins, which disturbs many cellular processes.
The aim of this study was to establish the structure–activity relationship of the new series of dihydroquinolin-4(1H)-ones. Using the routine MTT assay, the cytotoxicity of the analogs was assessed on two cancer cell types: an adherent breast cancer MCF-7 and a non-adherent leukemia HL-60. All new analogs were more cytotoxic for HL-60 than for MCF-7 cells. Analysis of the structure–activity relationship revealed that introducing any groups into the aromatic ring (R1 and R2) was not advantageous for activity. The substituent on the nitrogen atom (R3) did not significantly affect the activity of the tested compounds. The most important turned out to be position 2 (R4). The quinolin-4(1H)-ones with an alkyl substituent in that position were more potent than those bearing an aryl group. In general, iso-propyl as R4 generated more cytotoxic analogs than ethyl.
The ideal anticancer drug candidates should be highly cytotoxic for cancer cells but much less for normal, healthy cells. The selectivity of the new analogs, expressed as the IC50 ratio of HUVEC/HL60 cells, was calculated for the selected analogs, and values between 1 and 5.5 were obtained. These values showed that very high cytotoxicity against cancer cells did not go hand-in-hand with high selectivity. However, even approved drugs used for cancer treatment are in most cases strongly cytotoxic for normal cells. The difference between healthy and cancer cells is that the latter proliferate much faster and therefore are more susceptible to the action of drugs. The analog 5a, 2-ethyl-3-methylidene-1-phenylsulfonyl-2,3-dihydroquinolin-4(1H)-one, which was 5-fold more cytotoxic for HL-60 than for HUVEC cells, was further evaluated in terms of its mode of action. This compound inhibited proliferation and induced apoptosis in HL-60 cells, which could be attributed to its ability to induce DNA damage. Additionally, the 5a down-regulated ABCB1 mRNA level decreased the risk of MDR development. Based on these findings, the described structurally diversified dihydroquinolin-4(1H)-ones can serve as lead structures and can be further optimized with the purpose of finding new possibilities for cancer treatment.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules27113597/s1, general procedures and characterization data for compounds 9a-e and 10a-t, 1H- and 13C-NMR spectra of compounds 5a-t.

Author Contributions

Conceptualization, A.E.J. and T.J.; methodology, A.J., K.G.-J. and J.D.-S.; formal analysis, A.J. and J.D.-S.; writing—original draft preparation, A.J., K.G.-J. and A.E.J.; writing—review and editing, A.E.J. and T.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Center of Research and Development (Warsaw, Poland) in the framework of project InterChemMed (POWR.03.02.00-00-I029/16), co-funded by the European Social Fund. This study was supported financially by the grant from the Medical University of Lodz No. 503/1-156-02/503-11-001-19-00.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The studies of flow cytometry were carried out at the Research Laboratory CoreLab of the Medical University of Lodz.

Conflicts of Interest

The authors declare no conflict of interest.

Sample Availability

Samples of the compounds are available from the authors.

References

  1. Shiro, T.; Fukaya, T.; Tobe, M. The chemistry and biological activity of heterocycle-fused quinolinone derivatives: A review. Eur. J. Med. Chem. 2015, 97, 397–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Beniddir, M.A.; Le Borgne, E.; Iorga, B.I.; Loaec, N.; Lozach, O.; Meijer, L.; Awang, K.; Litaudon, M. Acridone alkaloids from Glycosmis chlorosperma as DYRK1A inhibitors. J. Nat. Prod. 2014, 77, 1117–1122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Cretton, S.; Dorsaz, S.; Azzollini, A.; Favre-Godal, Q.; Marcourt, L.; Ebrahimi, S.N.; Voinesco, F.; Michellod, E.; Sanglard, D.; Gindro, K.; et al. Antifungal Quinoline Alkaloids from Waltheria indica. J. Nat. Prod. 2016, 79, 300–307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Emmerson, A.M.; Jones, A.M. The quinolones: Decades of development and use. J. Antimicrob. Chemother. 2003, 51, 13–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Kahriman, N.; Iskender, N.Y.; Yucel, M.; Yayli, N.; Demir, E.; Demirbag, Z. Microwave-assisted synthesis of 1,3′-diaza-flavanone/flavone and their alkyl derivatives with antimicrobial activity. J. Heterocycl. Chem. 2012, 49, 71–79. [Google Scholar] [CrossRef] [Scilit]
  6. Naeem, A.; Badshah, S.L.; Muska, M.; Ahmad, N.; Khan, K. The current case of quinolones: Synthetic approaches and antibacterial activity. Molecules 2016, 21, 268. [Google Scholar] [CrossRef] [Scilit]
  7. Batalha, P.N.; Vieira de Souza, M.C.; Peña-Cabrera, E.; Cruz, D.C.; da Costa Santos Boechat, F. Quinolones in the search for new anticancer agents. Curr. Pharm. Des. 2016, 22, 6009–6020. [Google Scholar] [CrossRef] [Scilit]
  8. Rajput, S.; Gardner, C.R.; Failes, T.W.; Arndt, G.M.; Black, D.S.; Kumar, N. Synthesis and anticancer evaluation of 3-substituted quinolin-4-ones and 2,3-dihydroquinolin-4-ones. Bioorg. Med. Chem. 2014, 22, 105–115. [Google Scholar] [CrossRef] [Scilit]
  9. Gong, Y.; Kato, K. New synthesis of 2-trifluoromethyl-2,3-dihydro-1H-quinolin-4-ones. J. Fluor. Chem. 2004, 125, 767–773. [Google Scholar] [CrossRef] [Scilit]
  10. Xiao, X.; Liu, X.; Dong, S.; Cai, Y.; Lin, L.; Feng, X. Asymmetric synthesis of 2,3-dihydroquinolin-4-one derivatives catalyzed by a chiral bisguanidium salt. Chem. Eur. J. 2012, 18, 15922–15926. [Google Scholar] [CrossRef] [Scilit]
  11. Abdel-Aal, M.A.A.; Abdel-Aziz, S.A.; Shaykoon, M.S.A.; Abuo-Rahma, G.E.A. Toward anticancer fluoroquinolones: A rewiew article. Arch. Pharm. 2019, 352, 1800376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Janecka, A.; Wyrębska, A.; Gach, K.; Fichna, J.; Janecki, T. Natural and synthetic α-methylenelactones and α-methylenelactams with anticancer potential. Drug Discov. Today 2012, 17, 561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Ma, X.; Wu, K.; Xu, A.; Jiao, P.; Li, H.; Xing, L. The sesquiterpene lactone eupatolide induces apoptosis in non-small cell lung cancer cells by suppressing STAT3 signaling. Environ. Toxicol. Pharmacol. 2021, 81, 103513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. De Cicco, P.; Busà, R.; Ercolano, G.; Formisano, C.; Allegra, M.; Taglialatela-Scafati, O.; Ianaro, A. Inhibitory effects of cynaropicrin on human melanoma progression by targeting MAPK, NF-κB, and Nrf-2 signaling pathways in vitro. Phytother Res. 2020, 35, 1432–1442. [Google Scholar] [CrossRef] [Scilit]
  15. Pati, H.N.; Das, U.; Sharma, R.K.; Dimmock, J.R. Cytotoxic thiol alkylators. Mini Rev. Med. Chem. 2007, 7, 131–139. [Google Scholar] [CrossRef] [Scilit]
  16. Koszuk, J.; Bartosik, T.; Wojciechowki, J.; Wolf, W.M.; Janecka, A.; Drogosz, J.; Długosz, A.; Krajewska, U.; Mirowski, M.; Janecki, T. Synthesis of 3-methylidene-1-tosyl-2,3-dihydroquinolin-4(1H)-ones as potent cytotoxic agents. Chem. Biodivers. 2018, 15, e1800242. [Google Scholar] [CrossRef] [Scilit]
  17. Degterev, A.; Boyce, M.; Yuan, J. A decade of caspases. Oncogene 2003, 22, 8543–8567. [Google Scholar] [CrossRef] [Scilit]
  18. Roos, W.P.; Kaina, B. DNA damage-induced cell death by apoptosis. Trends Mol. Med. 2006, 12, 440–450. [Google Scholar] [CrossRef] [Scilit]
  19. Dlugosz, A.; Janecka, A. ABC Transporters in the Development of Multidrug Resistance in Cancer Therapy. Curr. Pharm. Des. 2016, 22, 4705–4716. [Google Scholar] [CrossRef] [Scilit]
  20. de Figueiredo-Pontes, L.L.; Pintão, M.C.; Oliveira, L.C.; Dalmazzo, L.F.; Jácomo, R.H.; Garcia, A.B.; Falcão, R.P.; Rego, E.M. Determination of P-glycoprotein, MDR-related protein 1, breast cancer resistance protein, and lung-resistance protein expression in leukemic stem cells of acute myeloid leukemia. Cytom. B Clin. Cytom. 2008, 74, 163–168. [Google Scholar] [CrossRef] [Scilit]
  21. Robey, R.W.; Pluchino, K.M.; Hall, M.D.; Fojo, A.T.; Bates, S.E. Gottesman MM. Revisiting the role of ABC transporters in multidrug-resistant cancer. Nat. Rev. Cancer 2018, 18, 452–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef] [Scilit]
  23. Winer, J.; Jung, C.K.; Shackel, I.; Williams, P.M. Development and Validation of Real-Time Quantitative Reverse Transcriptase–Polymerase Chain Reaction for Monitoring Gene Expression in Cardiac Myocytes. Anal. Biochem. 1999, 15, 41–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Chemical structure of quinoline, 4-quinolinones, and some diversely substituted analogs with quinolone skeleton.
Figure 1. Chemical structure of quinoline, 4-quinolinones, and some diversely substituted analogs with quinolone skeleton.
Molecules 27 03597 g001
Scheme 1. Synthesis of 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t.
Scheme 1. Synthesis of 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t.
Molecules 27 03597 sch001
Figure 2. Structure of the selected compound 5a (a). Metabolic activity of (b) HL-60 and HUVEC cells treated with various concentrations of 5a for 48 h; (c) HL-60 cells treated with various concentration of 5a for 24 h, measured by MTT assay.
Figure 2. Structure of the selected compound 5a (a). Metabolic activity of (b) HL-60 and HUVEC cells treated with various concentrations of 5a for 48 h; (c) HL-60 cells treated with various concentration of 5a for 24 h, measured by MTT assay.
Molecules 27 03597 g002
Figure 3. Representative scattered blots of multiparameter flow cytometry analysis of cell proliferation, DNA damage and apoptosis in HL-60 cells treated with 5a (1.8µM) for 24 h. Panel (a): DAPI vs. BrdU PerCP-Cy.5.5 staining profile. BrdU positive cells are in the inside frame. Panel (b): cleaved PARP (Asp214) PE vs. H2AX (pS139) Alexa profile. Squares Q1 + Q2 represent H2AX (pS139) Alexa positive cells, squares Q2 + Q4 represent cleaved PARP (Asp214) PE positive cells, whereas square Q3 represents H2AX (pS139) Alexa and cleaved PARP (Asp214) PE negative cells.
Figure 3. Representative scattered blots of multiparameter flow cytometry analysis of cell proliferation, DNA damage and apoptosis in HL-60 cells treated with 5a (1.8µM) for 24 h. Panel (a): DAPI vs. BrdU PerCP-Cy.5.5 staining profile. BrdU positive cells are in the inside frame. Panel (b): cleaved PARP (Asp214) PE vs. H2AX (pS139) Alexa profile. Squares Q1 + Q2 represent H2AX (pS139) Alexa positive cells, squares Q2 + Q4 represent cleaved PARP (Asp214) PE positive cells, whereas square Q3 represents H2AX (pS139) Alexa and cleaved PARP (Asp214) PE negative cells.
Molecules 27 03597 g003
Figure 4. Quantitative analysis of inhibition of cell proliferation (BrdU test); (a) induction of apoptosis (PARP test) (b) and induction of DNA damage (H2AX test) (c) by 5a (1.8 µM) in HL-60 cells. Data are presented as mean ± SEM of three independent experiments. Statistical significance was assessed using one-way ANOVA and a post-hoc multiple comparison Student–Newman–Keuls test. *** p < 0.001 vs. control.
Figure 4. Quantitative analysis of inhibition of cell proliferation (BrdU test); (a) induction of apoptosis (PARP test) (b) and induction of DNA damage (H2AX test) (c) by 5a (1.8 µM) in HL-60 cells. Data are presented as mean ± SEM of three independent experiments. Statistical significance was assessed using one-way ANOVA and a post-hoc multiple comparison Student–Newman–Keuls test. *** p < 0.001 vs. control.
Molecules 27 03597 g004
Figure 5. Induction of apoptosis in HL-60 cells treated with 5a (1.8 µM) for 24 h: (a) Representative scattered blots of flow cytometry analysis of apoptosis by double-staining with FITC-Annexin-V and PI. The percentage of viable cells is shown in quadrant Q3. Quadrant Q4 indicates the percentage of early apoptotic cells (Annexin V-positive cells), whereas quadrant Q2 shows the percentage of late apoptotic/death cells (Annexin V-and PI-positive cells). (b) Quantitative analysis of apoptotic cell death by Annexin V and PI assay. Data are presented as mean ±SEM of three independent experiments. Statistical significance was assessed using Student’s t test. *** p < 0.001 vs. control.
Figure 5. Induction of apoptosis in HL-60 cells treated with 5a (1.8 µM) for 24 h: (a) Representative scattered blots of flow cytometry analysis of apoptosis by double-staining with FITC-Annexin-V and PI. The percentage of viable cells is shown in quadrant Q3. Quadrant Q4 indicates the percentage of early apoptotic cells (Annexin V-positive cells), whereas quadrant Q2 shows the percentage of late apoptotic/death cells (Annexin V-and PI-positive cells). (b) Quantitative analysis of apoptotic cell death by Annexin V and PI assay. Data are presented as mean ±SEM of three independent experiments. Statistical significance was assessed using Student’s t test. *** p < 0.001 vs. control.
Molecules 27 03597 g005
Figure 6. Real-time PCR analysis of ABCB1 mRNA levels in HL-60 cells treated with 5a for 24 h. Data are presented as mean ± SEM of three independent experiments. Statistical significance was assessed using one-way ANOVA and a post-hoc multiple comparison Student–Newman–Keuls test. * p < 0.05 vs. control.
Figure 6. Real-time PCR analysis of ABCB1 mRNA levels in HL-60 cells treated with 5a for 24 h. Data are presented as mean ± SEM of three independent experiments. Statistical significance was assessed using one-way ANOVA and a post-hoc multiple comparison Student–Newman–Keuls test. * p < 0.05 vs. control.
Molecules 27 03597 g006
Table 1. Yields of trans- and cis-3-(diethoxyphosphoryl)-1-sulfonyl-2,3-dihydroquinolin-4-ones trans- and cis-10a-t, 3-(diethoxyphosphoryl)-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ols enol-10a-t, and 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t.
Table 1. Yields of trans- and cis-3-(diethoxyphosphoryl)-1-sulfonyl-2,3-dihydroquinolin-4-ones trans- and cis-10a-t, 3-(diethoxyphosphoryl)-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ols enol-10a-t, and 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t.
CompoundR1R2R3R4105
trans-10/cis-10/
enol-10 1
Yield [%] 2Yield [%] 2
aHHPhenylEt2.0/4.0/94.04664
bi-Pr2.0/1.0/97.07229
cPhenyl1.0/–/99.07151
d4-Methoxyphenyl1.0/–/99.08752
eHH4-ChlorophenylEt1.5/2.5/96.08094
fi-Pr2.5/0.5/97.05480
gPhenyl1.0/–/99.07356
h4-Methoxyphenyl1.0/–/99.07795
iOMeOMe4-MethylphenylEt5.0/25.0/70.06542
ji-Pr8.0/3.0/89.05185
kPhenyl3.0/2.0/95.06976
l4-Methoxyphenyl2.0/2.0/96.05775
mClH4-MethylphenylEt1.0/2.0/97.08813
ni-Pr1.5/0.5/98.08533
oPhenyl1.0/–/99.07552
p4-Methoxyphenyl1.0/–/99.06375
qBrH4-MethylphenylEt1.0/3.0/96.06064
ri-Pr1.5/0.5/98.07748
sPhenyl1.0/–/99.07651
t4-Methoxyphenyl1.0/–/99.07338
1 Determined from 31P-NMR spectra of the product. 2 Yield of pure isolated product, based on 9 and 10, respectively.
Table 2. In vitro cytotoxic activity of 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t tested on two cancer (MCF-7, HL-60) and one normal (HUVEC) cell lines.
Table 2. In vitro cytotoxic activity of 3-methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones 5a-t tested on two cancer (MCF-7, HL-60) and one normal (HUVEC) cell lines.
Molecules 27 03597 i001
5a-t
CompoundR1R2R3R4IC50 [µM] 1
MCF-7HL-60HUVECHUVEC/HL-60 IC50 Ratio
5aHHPhenylEt2.74 ± 0.070.34 ± 0.031.87 ± 0.025.50
5bi-Pr0.83 ± 0.020.29 ± 0.020.78 ± 0.212.67
5cPhenyl2.25 ± 0.201.36 ± 0.13
5d4-Methoxyphenyl1.21 ± 0.241.12 ± 0.37
5eHH4-ChlorophenylEt1.61 ± 0.070.37 ± 0.050.75 ± 0.002.03
5fi-Pr0.86 ± 0.020.23 ± 0.010.99 ± 0.074.30
5gPhenyl1.89 ± 0.030.78 ± 0.07
5h4-Methoxyphenyl2.10 ± 0.160.92 ± 0.01
5iOMeOMe4-MethylphenylEt1.01 ± 0.050.37 ± 0.020.42 ± 0.081.14
5ji-Pr1.44 ± 0.070.43 ± 0.020.99 ± 0.072.30
5kPhenyl1.46 ± 0.090.58 ± 0.02
5l4-Methoxyphenyl1.15 ± 0.041.48 ± 0.06
5mClH4-MethylphenylEt3.48 ± 0.421.75 ± 0.03
5ni-Pr1.65 ± 0.050.67 ± 0.010.68 ± 0.031.01
5oPhenyl3.67 ± 0.412.04 ± 0.05
5p4-Methoxyphenyl3.60 ± 0.192.07 ± 0.02
5qBrH4-MethylphenylEt1.83 ± 0.150.61 ± 0.041.00 ± 0.221.64
5ri-Pr0.83 ± 0.020.19 ± 0.030.47 ± 0.032.47
5sPhenyl2.67 ± 0.050.62 ± 0.01
5t4-Methoxyphenyl2.81 ± 0.050.74 ± 0.06
Carboplatin2.90 ± 0.103.80 ± 0.455.35± 0.051.41
1 Compound concentration required to inhibit metabolic activity by 50%. Values are expressed as mean ± SEM from concentration–response curves of at least three experiments using a nonlinear estimation (quasi-Newton algorithm) method.
Table 3. Primer sequences for real-time PCR reaction.
Table 3. Primer sequences for real-time PCR reaction.
GenePrimer Sequences
Forward PrimerReverse Primer
GAPDH5′ GTCGCTGTTGAAGTCAGAGGAG 3′5′ CGTGTCAGTGGTGGACCTGAC 3′
ABCB15′ GTGGGGCAAGTCAGTTCATT 3′5′ TCTTCACCTCCAGGCTCAGT 3′
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jaskulska, A.; Gach-Janczak, K.; Drogosz-Stachowicz, J.; Janecki, T.; Janecka, A.E. Synthesis and Anticancer Properties of New 3-Methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones. Molecules 2022, 27, 3597. https://doi.org/10.3390/molecules27113597

AMA Style

Jaskulska A, Gach-Janczak K, Drogosz-Stachowicz J, Janecki T, Janecka AE. Synthesis and Anticancer Properties of New 3-Methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones. Molecules. 2022; 27(11):3597. https://doi.org/10.3390/molecules27113597

Chicago/Turabian Style

Jaskulska, Agata, Katarzyna Gach-Janczak, Joanna Drogosz-Stachowicz, Tomasz Janecki, and Anna Ewa Janecka. 2022. "Synthesis and Anticancer Properties of New 3-Methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones" Molecules 27, no. 11: 3597. https://doi.org/10.3390/molecules27113597

APA Style

Jaskulska, A., Gach-Janczak, K., Drogosz-Stachowicz, J., Janecki, T., & Janecka, A. E. (2022). Synthesis and Anticancer Properties of New 3-Methylidene-1-sulfonyl-2,3-dihydroquinolin-4(1H)-ones. Molecules, 27(11), 3597. https://doi.org/10.3390/molecules27113597

Article Metrics

Back to TopTop