Protective Effects of 6-Shogaol, an Active Compound of Ginger, in a Murine Model of Cisplatin-Induced Acute Kidney Injury
Abstract
:1. Introduction
2. Results
2.1. 6-Shogaol Ameliorated Cisplatin-Induced AKI
2.2. 6-Shogaol Attenuated Cisplatin-Induced Oxidative Stress
2.3. 6-Shogaol Inhibited Cisplatin-Induced Tubular Cell Death
2.4. 6-Shogaol Suppressed Cisplatin-Induced Inflammation
3. Discussion
4. Materials and Methods
4.1. Animals and Treatment
4.2. Assessment of Renal Function
4.3. Histological Analysis and IHC Staining
4.4. Western Blot Analysis
4.5. Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
4.6. TUNEL Assay
4.7. Measurement of Serum Cytokines
4.8. Evaluation of Oxidative Stress
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Ronco, C.; Bellomo, R.; Kellum, J.A. Acute kidney injury. Lancet 2019, 394, 1949–1964. [Google Scholar] [CrossRef]
- Chawla, L.S.; Eggers, P.W.; Star, R.A.; Kimmel, P.L. Acute kidney injury and chronic kidney disease as interconnected syndromes. N. Engl. J. Med. 2014, 371, 58–66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mehta, R.L.; Awdishu, L.; Davenport, A.; Murray, P.T.; Macedo, E.; Cerda, J.; Chakaravarthi, R.; Holden, A.L.; Goldstein, S.L. Phenotype standardization for drug-induced kidney disease. Kidney Int. 2015, 88, 226–234. [Google Scholar] [CrossRef] [PubMed]
- Santos, M.L.C.; de Brito, B.B.; da Silva, F.A.F.; Botelho, A.C.D.S.; de Melo, F.F. Nephrotocity in cancer treatment: An overview. World J. Clin. Oncol. 2020, 11, 190–204. [Google Scholar] [CrossRef] [PubMed]
- Holditch, S.J.; Brown, C.N.; Lombardi, A.M.; Nguyen, K.N.; Edelstein, C.L. Recent Advances in Models, Mechanisms, Biomarkers, and Interventions in Cisplatin-Induced Acute Kidney Injury. Int. J. Mol. Sci. 2019, 20, 3011. [Google Scholar] [CrossRef] [Green Version]
- Ridzuan, N.R.A.; Rashid, N.A.; Othman, F.; Budin, S.B.; Hussan, F.; Teoh, S.L. Protective Role of Natural Products in Cisplatin-Induced Nephrotoxicity. Mini Rev. Med. Chem. 2019, 19, 1134–1143. [Google Scholar] [CrossRef]
- Sánchez-González, P.D.; López-Hernández, F.J.; López-Novoa, J.M.; Morales, A.I. An integrative view of the pathophysiological events leading to cisplatin nephrotoxicity. Crit. Rev. Toxicol. 2011, 41, 803–821. [Google Scholar] [CrossRef]
- Arulselvan, P.; Fard, M.T.; Tan, W.S.; Gothai, S.; Fakurazi, S.; Norhaizan, M.E.; Kumar, S.S. Role of Antioxidants and Natural Products in Inflammation. Oxid. Med. Cell. Longev. 2016, 2016, 5276130. [Google Scholar] [CrossRef] [Green Version]
- Newman, D.J.; Cragg, G.M. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J. Nat. Prod. 2020, 83, 770–803. [Google Scholar] [CrossRef]
- Bischoff-Kont, I.; Fürst, R. Benefits of Ginger and Its Constituent 6-Shogaol in Inhibiting Inflammatory Processes. Pharmaceuticals 2021, 14, 571. [Google Scholar] [CrossRef]
- Kubra, I.R.; Rao, L.J.M. An impression on current developments in the technology, chemistry, and biological activities of ginger (Zingiber officinale Roscoe). Crit. Rev. Food Sci. Nutr. 2012, 52, 651–688. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Melittin Ameliorates Endotoxin-Induced Acute Kidney Injury by Inhibiting Inflammation, Oxidative Stress, and Cell Death in Mice. Oxid. Med. Cell. Longev. 2021, 2021, 8843051. [Google Scholar] [CrossRef] [PubMed]
- Pabla, N.; Dong, Z. Cisplatin nephrotoxicity: Mechanisms and renoprotective strategies. Kidney Int. 2008, 73, 994–1007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Leem, J.; Jeon, E.J. Protective Effects of Melatonin against Aristolochic Acid-Induced Nephropathy in Mice. Biomolecules 2020, 10, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, N.; Wei, W.; Fan, X.; Ci, X. Farrerol Attenuates Cisplatin-Induced Nephrotoxicity by Inhibiting the Reactive Oxygen Species-Mediated Oxidation, Inflammation, and Apoptotic Signaling Pathways. Front. Physiol. 2019, 10, 1419. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. [Google Scholar] [CrossRef] [Green Version]
- Yang, L.; Yang, F.; Teng, L.; Katayama, I. 6-Shogaol Protects Human Melanocytes against Oxidative Stress through Activation of the Nrf2-Antioxidant Response Element Signaling Pathway. Int. J. Mol. Sci. 2020, 21, 3537. [Google Scholar] [CrossRef]
- Nonaka, K.; Bando, M.; Sakamoto, E.; Inagaki, Y.; Naruishi, K.; Yumoto, H.; Kido, J.-I. 6-Shogaol Inhibits Advanced Glycation End-Products-Induced IL-6 and ICAM-1 Expression by Regulating Oxidative Responses in Human Gingival Fibroblasts. Molecules 2019, 24, 3705. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Protective Effects of SPA0355, a Thiourea Analogue, Against Lipopolysaccharide-Induced Acute Kidney Injury in Mice. Antioxidants 2020, 9, 585. [Google Scholar] [CrossRef]
- Qi, Z.; Li, Z.; Li, W.; Liu, Y.; Wang, C.; Lin, H.; Liu, J.; Li, P. Pseudoginsengenin DQ Exhibits Therapeutic Effects in Cisplatin-Induced Acute Kidney Injury via Sirt1/NF-κB and Caspase Signaling Pathway without Compromising Its Antitumor Activity in Mice. Molecules 2018, 23, 3038. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Kahweol Ameliorates Cisplatin-Induced Acute Kidney Injury through Pleiotropic Effects in Mice. Biomedicines 2020, 8, 572. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Ma, H.; Shao, J.; Wu, J.; Zhou, L.; Zhang, Z.; Wang, Y.; Huang, Z.; Ren, J.; Liu, S.; et al. A Role for Tubular Necroptosis in Cisplatin-Induced AKI. J. Am. Soc. Nephrol. 2015, 26, 2647–2658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.W.; Jo, J.; Kim, J.-Y.; Choe, M.; Leem, J.; Park, J.-H. Melatonin Attenuates Cisplatin-Induced Acute Kidney Injury through Dual Suppression of Apoptosis and Necroptosis. Biology 2019, 8, 64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jing, T.; Liao, J.; Shen, K.; Chen, X.; Xu, Z.; Tian, W.; Wang, Y.; Jin, B.; Pan, H. Protective effect of urolithin a on cisplatin-induced nephrotoxicity in mice via modulation of inflammation and oxidative stress. Food Chem. Toxicol. 2019, 129, 108–114. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Inhibition of p300 by Garcinol Protects against Cisplatin-Induced Acute Kidney Injury through Suppression of Oxidative Stress, Inflammation, and Tubular Cell Death in Mice. Antioxidants 2020, 9, 1271. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.-G.; Kim, M.O.; Kim, S.-H.; Kim, H.J.; Pokhrel, N.K.; Lee, J.H.; Lee, H.-J.; Kim, J.-Y.; Lee, Y. 6-Shogaol, an active ingredient of ginger, inhibits osteoclastogenesis and alveolar bone resorption in ligature-induced periodontitis in mice. J. Periodontol. 2020, 91, 809–818. [Google Scholar] [CrossRef]
- Wang, D.; Jiang, Y.; Yang, X.; Wei, Q.; Wang, H. 6-Shogaol reduces progression of experimental endometriosis in vivo and in vitro via regulation of VGEF and inhibition of COX-2 and PGE2-mediated inflammatory responses. Korean J. Physiol. Pharmacol. 2018, 22, 627–636. [Google Scholar] [CrossRef] [Green Version]
- Fajrin, F.A.; Nugroho, A.E.; Nurrochmad, A.; Rina, S. Ginger extract and its compound, 6-shogaol, attenuates painful diabetic neuropathy in mice via reducing TRPV1 and NMDAR2B expressions in the spinal cord. J. Ethnopharmacol. 2020, 249, 112396. [Google Scholar] [CrossRef]
- Sapkota, A.; Park, S.J.; Choi, J.W. Neuroprotective Effects of 6-Shogaol and Its Metabolite, 6-Paradol, in a Mouse Model of Multiple Sclerosis. Biomol. Ther. 2019, 27, 152–159. [Google Scholar] [CrossRef]
- Park, G.; Kim, H.G.; Ju, M.S.; Ha, S.K.; Park, Y.; Kim, S.Y.; Oh, M.S. 6-Shogaol, an active compound of ginger, protects dopaminergic neurons in Parkinson’s disease models via anti-neuroinflammation. Acta Pharmacol. Sin. 2013, 34, 1131–1139. [Google Scholar] [CrossRef]
- Yocum, G.; Hwang, J.J.; Mikami, M.; Danelsson, J.; Kuforiji, A.S.; Emala, C.W. Ginger and its bioactive component 6-shogaol mitigate lung inflammation in a murine asthma model. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2020, 318, L296–L303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, G.; Oh, D.-S.; Lee, M.G.; Lee, C.E.; Kim, Y.-U. 6-Shogaol, an active compound of ginger, alleviates allergic dermatitis-like skin lesions via cytokine inhibition by activating the Nrf2 pathway. Toxicol. Appl. Pharmacol. 2016, 310, 51–59. [Google Scholar] [CrossRef]
- Han, S.J.; Kim, M.; D’Agati, V.D.; Lee, H.T. 6-Shogaol protects against ischemic acute kidney injury by modulating NF-κB and heme oxygenase-1 pathways. Am. J. Physiol.-Renal Physiol. 2019, 317, F743–F756. [Google Scholar] [CrossRef]
- Pefanis, A.; Ierino, F.L.; Murphy, J.M.; Cowan, P.J. Regulated necrosis in kidney ischemia-reperfusion injury. Kidney Int. 2019, 96, 291–301. [Google Scholar] [CrossRef]
- Xu, Y.; Bai, L.; Chen, X.; Li, Y.; Qin, Y.; Meng, X.; Zhang, Q. 6-Shogaol ameliorates diabetic nephropathy through anti-inflammatory, hyperlipidemic, anti-oxidative activity in db/db mice. Biomed. Pharmacother. 2018, 97, 633–641. [Google Scholar] [CrossRef]
- Al Malki, W.H.; Abdel-Raheem, I.T.; Dawound, M.Z.; Abdou, R.F. 6-shogaol protects against diabetic nephropathy and cardiomyopathy via modulation of oxidative stress/NF-κB pathway. Pak. J. Pharm. Sci. 2018, 31, 2109–2117. [Google Scholar] [PubMed]
- Gómez-Sierra, T.; Eugenio-Pérez, D.; Sánchez-Chinchillas, A.; Pedraza-Chaverri, J. Role of food-derived antioxidants against cisplatin induced-nephrotoxicity. Food Chem. Toxicol. 2018, 120, 230–242. [Google Scholar] [CrossRef]
- Dugasani, S.; Pichika, M.R.; Nadarajah, V.D.; Balijepalli, M.K.; Tandra, S.; Korlakunta, J.N. Comparative antioxidant and anti-inflammatory effects of [6]-gingerol, [8]-gingerol, [10]-gingerol and [6]-shogaol. J. Ethnopharmacol. 2010, 127, 515–520. [Google Scholar] [CrossRef] [PubMed]
- Gómez-Sierra, T.; Medina-Campos, O.N.; Solano, J.D.; Ibarra-Rubio, M.E.; Pedraza-Chaverri, J. Isoliquiritigenin Pretreatment Induces Endoplasmic Reticulum Stress-Mediated Hormesis and Attenuates Cisplatin-Induced Oxidative Stress and Damage in LLC-PK1 Cells. Molecules 2020, 25, 4442. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Leem, J.; Park, K.-K. Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules 2020, 25, 5717. [Google Scholar] [CrossRef]
- Na, J.-Y.; Song, K.; Lee, J.-W.; Kim, S.; Kwon, J. Pretreatment of 6-shogaol attenuates oxidative stress and inflammation in middle cerebral artery occlusion-induced mice. Eur. J. Pharmacol. 2016, 788, 241–247. [Google Scholar] [CrossRef]
- Gyurászová, M.; Gurecká, R.; Bábíčková, J.; Tóthová, Ľ. Oxidative Stress in the Pathophysiology of Kidney Disease: Implications for Noninvasive Monitoring and Identification of Biomarkers. Oxid. Med. Cell. Longev. 2020, 2020, 5478708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nezu, M.; Suzuki, N. Roles of Nrf2 in Protecting the Kidney from Oxidative Damage. Int. J. Mol. Sci. 2020, 21, 2951. [Google Scholar] [CrossRef] [PubMed]
- Peng, S.; Yao, J.; Liu, Y.; Duan, D.; Zhang, X.; Fang, J. Activation of Nrf2 target enzymes conferring protection against oxidative stress in PC12 cells by ginger principal constituent 6-shogaol. Food Func. 2015, 6, 2813–2823. [Google Scholar] [CrossRef]
- Jiang, M.; Wei, Q.; Pabla, N.; Dong, G.; Wang, C.Y.; Wang, T.; Smith, S.B.; Dong, Z. Effects of hydroxyl radical scavenging on cisplatin-induced p53 activation, tubular cell apoptosis and nephrotoxicity. Biochem. Pharmacol. 2007, 73, 1499–1510. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ning, Y.; Shi, Y.; Chen, J.; Song, N.; Cai, J.; Fang, Y.; Yu, X.; Ji, J.; Ding, X. Necrostatin-1 Attenuates Cisplatin-Induced Nephrotoxicity Through Suppression of Apoptosis and Oxidative Stress and Retains Klotho Expression. Front. Pharmacol. 2018, 9, 384. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.N.; Liu, M.M.; Wang, F.; Wei, B.; Yang, Q.; Cai, Y.T.; Chen, X.; Liu, X.Q.; Jiang, L.; Li, C.; et al. RIPK1 inhibitor Cpd-71 attenuates renal dysfunction in cisplatin-treated mice via attenuating necroptosis, inflammation and oxidative stress. Clin. Sci. 2019, 133, 1609–1627. [Google Scholar] [CrossRef]
- Wu, W.-F.; Wang, J.-N.; Li, Z.; Wei, B.; Jin, J.; Gao, L.; Li, H.-D.; Li, J.; Chen, H.-Y.; Meng, X.-M. 7-Hydroxycoumarin protects against cisplatin-induced acute kidney injury by inhibiting necroptosis and promoting Sox9-mediated tubular epithelial cell proliferation. Phytomedicine 2020, 69, 153202. [Google Scholar] [CrossRef] [PubMed]
- Ye, L.; Pang, W.; Huang, Y.; Wu, H.; Huang, X.; Liu, J.; Wang, S.; Yang, C.; Pan, Q.; Liu, H. Lansoprazole promotes cisplatin-induced acute kidney injury via enhancing tubular necroptosis. J. Cell. Mol. Med. 2021, 25, 2703–2713. [Google Scholar] [CrossRef]
- Ramesh, G.; Reeves, W.B. TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J. Clin. Investig. 2002, 110, 835–842. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Ramesh, G.; Norbury, C.C.; Reeves, W.B. Cisplatin-induced nephrotoxicity is mediated by tumor necrosis factor-alpha produced by renal parenchymal cells. Kidney Int. 2007, 72, 37–44. [Google Scholar] [CrossRef] [Green Version]
- Chang, T.-T.; Chen, J.-W. The Role of Chemokines and Chemokine Receptors in Diabetic Nephropathy. Int. J. Mol. Sci. 2020, 21, 3172. [Google Scholar] [CrossRef]
- Newton, K.; Manning, G. Necroptosis and Inflammation. Annu. Rev. Biochem. 2016, 85, 743–763. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Park, J.-H.; Kim, K.; Jo, J.; Leem, J.; Park, K.-K. Pharmacological Inhibition of Caspase-1 Ameliorates Cisplatin-Induced Nephrotoxicity through Suppression of Apoptosis, Oxidative Stress, and Inflammation in Mice. Mediat. Inflamm. 2018, 2018, 6571676. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Lee, S.-J.; Maeng, Y.-I.; Leem, J.; Park, K.-K. Protective Effects of Bee Venom against Endotoxemia-Related Acute Kidney Injury in Mice. Biology 2020, 9, 154. [Google Scholar] [CrossRef] [PubMed]
- Dorcheh, S.N.; Rahgozar, S.; Talei, D. 6-Shogaol induces apoptosis in acute lymphoblastic leukaemia cells by targeting p53 signalling pathway and generation of reactive oxygen species. J. Cell. Mol. Med. 2021, 25, 6148–6160. [Google Scholar] [CrossRef] [PubMed]
- Bawadood, A.S.; Al-Abbasi, F.A.; Anwar, F.; El-Halawany, A.M.; Al-Abd, A.M. 6-Shogaol suppresses the growth of breast cancer cells by inducing apoptosis and suppressing autophagy via targeting notch signaling pathway. Biomed. Pharmacother. 2020, 128, 110302. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′→3′) | Accession No. |
---|---|---|
iNOS 1 | Forward: CGAAACGCTTCACTTCCAA Reverse: TGAGCCTATATTGCTGTGGCT | NM_010927 |
COX-2 2 | Forward: AACCGCATTGCCTCTGAAT Reverse: CATGTTCCAGGAGGATGGAG | NM_011198 |
5-LOX 3 | Forward: ATTGTTCCCATTGCCATCCAGCTCA Reverse: TCGTTCTCATAGTAGATGCTCACCA | NM_009662 |
NOX4 4 | Forward: GAACCCAAGTTCCAAGCTCATT Reverse: GGCACAAAGGTCCAGAAATCC | NM_015760 |
Catalase | Forward: CAAGTACAACGCTGAGAAGCCTAAG Reverse: CCCTTCGCAGCCATGTG | NM_009804 |
MnSOD 5 | Forward: AACTCAGGTCGCTCTTCAGC Reverse: CTCCAGCAACTCTCCTTTGG | NM_013671 |
TNF-α 6 | Forward: GACGTGGAACTGGCAGAAGAG Reverse: CCGCCTGGAGTTCTGGAA | NM_013693 |
IL-6 7 | Forward: CCAGAGATACAAAGAAATGATGG Reverse: ACTCCAGAAGACCAGAGGAAAT | NM_031168 |
MCP-1 8 | Forward: TAAAAACCTGGATCGGAACCAA Reverse: GCATTAGCTTCAGATTTACGGGT | NM_011333 |
CCL5 9 | Forward: ATATGGCTCGGACACCACTC Reverse: TCTTCTCTGGGTTGGCACACA | NM_013653 |
GAPDH 10 | Forward: ACTCCACTCACGGCAAATTC Reverse: TCTCCATGGTGGTGAAGACA | NM_001289726 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gwon, M.-G.; Gu, H.; Leem, J.; Park, K.-K. Protective Effects of 6-Shogaol, an Active Compound of Ginger, in a Murine Model of Cisplatin-Induced Acute Kidney Injury. Molecules 2021, 26, 5931. https://doi.org/10.3390/molecules26195931
Gwon M-G, Gu H, Leem J, Park K-K. Protective Effects of 6-Shogaol, an Active Compound of Ginger, in a Murine Model of Cisplatin-Induced Acute Kidney Injury. Molecules. 2021; 26(19):5931. https://doi.org/10.3390/molecules26195931
Chicago/Turabian StyleGwon, Mi-Gyeong, Hyemin Gu, Jaechan Leem, and Kwan-Kyu Park. 2021. "Protective Effects of 6-Shogaol, an Active Compound of Ginger, in a Murine Model of Cisplatin-Induced Acute Kidney Injury" Molecules 26, no. 19: 5931. https://doi.org/10.3390/molecules26195931
APA StyleGwon, M.-G., Gu, H., Leem, J., & Park, K.-K. (2021). Protective Effects of 6-Shogaol, an Active Compound of Ginger, in a Murine Model of Cisplatin-Induced Acute Kidney Injury. Molecules, 26(19), 5931. https://doi.org/10.3390/molecules26195931