Dual Delivery of TGF-β3 and Ghrelin in Microsphere/Hydrogel Systems for Cartilage Regeneration
Abstract
1. Introduction
2. Results
2.1. Study Design
2.2. Fabrication and Characterization of PEG/PLGA Microspheres
2.3. Fabrication and Characterization of the Microsphere/Hydrogel System
2.4. Biocompatibility Test of the Microsphere/Hydrogel System
2.5. Study of the Controlled Release of TGF-β3 and Ghrelin in the Microsphere/Hydrogel System
2.6. Identification of Human Bone Marrow Mesenchymal Stem Cells (hMSCs)
2.7. Combination of Different Concentrations of TGF-β3 and Ghrelin on the Chondrogenic Differentiation of hMSCs
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Fabrication of PEG/PLGA Microspheres
4.3. Fabrication of the HAMA Hydrogel and Microsphere/Hydrogel System
4.4. Characterization of the Microsphere/Hydrogel System
4.5. Study of TGF-β3 and Ghrelin Release from the Microsphere/Hydrogel System
4.6. Biocompatibility of the Microsphere/Hydrogel System
4.7. Cell Isolation and Culture
4.8. Identification of hMSCs
4.9. Chondrogenic Differentiation of hMSCs with Different Concentrations of TGF-β3 and Ghrelin
4.10. Gene Expression Analysis
4.11. Quantification of Glycosaminoglycan (GAG)
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Solheim, E.; Krokeide, A.M.; Melteig, P.; Larsen, A.; Strand, T.; Brittberg, M. Symptoms and function in patients with articular cartilage lesions in 1000 knee arthroscopies. Knee Surg. Sports Traumatol. Arthrosc. 2016, 24, 1610–1616. [Google Scholar] [CrossRef] [Scilit]
- Yang, Z.; Zhao, T.; Gao, C.; Cao, F.; Li, H.; Liao, Z.; Fu, L.; Li, P.; Chen, W.; Sun, Z.; et al. 3D-Bioprinted Difunctional Scaffold for In Situ Cartilage Regeneration Based on Aptamer-Directed Cell Recruitment and Growth Factor-Enhanced Cell Chondrogenesis. ACS Appl. Mater. Interfaces 2021, 13, 23369–23383. [Google Scholar]
- Christensen, B.B. Autologous tissue transplantations for osteochondral repair. Dan. Med. J. 2016, 63, B5236. [Google Scholar]
- Wei, W.; Dai, H. Articular cartilage and osteochondral tissue engineering techniques: Recent advances and challenges. Bioact. Mater. 2021, 6, 4830–4855. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.J.; Chan, Y.C.; Su, Z.C.; Yeh, W.L.; Lai, P.L.; Chu, I.M. Growth factor-loaded microspheres in mPEG-polypeptide hydrogel system for articular cartilage repair. J. Biomed. Mater. Res. A 2021, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Li, Y.; Wang, B.; Yang, J.; Heng, B.C.; Yang, Z.; Ge, Z.; Lin, J. TGF-β1 affinity peptides incorporated within a chitosan sponge scaffold can significantly enhance cartilage regeneration. J. Mater. Chem. B 2018, 6, 675–687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Rigueur, D.; Lyons, K.M. TGFβ signaling in cartilage development and maintenance. Birth Defects Res. C Embryo Today Rev. 2014, 102, 37–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.H.; Cook, J.L.; Mendelson, A.; Moioli, E.K.; Yao, H.; Mao, J.J. Regeneration of the articular surface of the rabbit synovial joint by cell homing: A proof of concept study. Lancet 2010, 376, 440–448. [Google Scholar] [CrossRef] [Scilit]
- Blaney Davidson, E.N.; Vitters, E.L.; van der Kraan, P.M.; van den Berg, W.B. Expression of transforming growth factor-beta (TGFbeta) and the TGFbeta signalling molecule SMAD-2P in spontaneous and instability-induced osteoarthritis: Role in cartilage degradation, chondrogenesis and osteophyte formation. Ann. Rheum. Dis. 2006, 65, 1414–1421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, A.R.; Patel, J.M.; Locke, R.C.; Eby, M.R.; Saleh, K.S.; Davidson, M.D.; Sennett, M.L.; Zlotnick, H.M.; Chang, A.H.; Carey, J.L.; et al. Nanofibrous hyaluronic acid scaffolds delivering TGF-β3 and SDF-1α for articular cartilage repair in a large animal model. Acta Biomater. 2021, 126, 170–182. [Google Scholar] [CrossRef] [Scilit]
- Handorf, A.M.; Li, W.J. Induction of mesenchymal stem cell chondrogenesis through sequential administration of growth factors within specific temporal windows. J. Cell. Physiol. 2014, 229, 162–171. [Google Scholar] [CrossRef] [Scilit]
- Liang, Z.T.; Li, J.; Rong, R.; Wang, Y.J.; Xiao, L.G.; Yang, G.T.; Zhang, H.Q. Ghrelin up-regulates cartilage-specific genes via the ERK/STAT3 pathway in chondrocytes of patients with adolescent idiopathic scoliosis. Biochem. Biophys. Res. Commun. 2019, 518, 259–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, L.; Chen, J.; Tao, Y.; Heng, B.C.; Yu, J.; Yang, Z.; Ge, Z. Enhancement of the chondrogenic differentiation of mesenchymal stem cells and cartilage repair by ghrelin. J. Orthop. Res. 2019, 37, 1387–1397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bian, L.; Zhai, D.Y.; Tous, E.; Rai, R.; Mauck, R.L.; Burdick, J.A. Enhanced MSC chondrogenesis following delivery of TGF-β3 from alginate microspheres within hyaluronic acid hydrogels in vitro and in vivo. Biomaterials 2011, 32, 6425–6434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makris, E.A.; Gomoll, A.H.; Malizos, K.N.; Hu, J.C.; Athanasiou, K.A. Repair and tissue engineering techniques for articular cartilage. Nat. Rev. Rheumatol. 2015, 11, 21–34. [Google Scholar] [CrossRef] [Scilit]
- Brown, S.; Kumar, S.; Sharma, B. Intra-articular targeting of nanomaterials for the treatment of osteoarthritis. Acta Biomater. 2019, 93, 239–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Velasco-Rodriguez, B.; Diaz-Vidal, T.; Rosales-Rivera, L.C.; García-González, C.A.; Alvarez-Lorenzo, C.; Al-Modlej, A.; Domínguez-Arca, V.; Prieto, G.; Barbosa, S.; Soltero Martínez, J.; et al. Hybrid Methacrylated Gelatin and Hyaluronic Acid Hydrogel Scaffolds. Preparation and Systematic Characterization for Prospective Tissue Engineering Applications. Int. J. Mol. Sci. 2021, 22, 6758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ling, Y.; Zhang, W.; Wang, P.; Xie, W.; Yang, W.; Wang, D.A.; Fan, C. Three-dimensional (3D) hydrogel serves as a platform to identify potential markers of chondrocyte dedifferentiation by combining RNA sequencing. Bioact. Mater. 2021, 6, 2914–2926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Yang, J.; Wang, L.; Zhang, X.; Heng, B.C.; Wang, D.A.; Ge, Z. Modified hyaluronic acid hydrogels with chemical groups that facilitate adhesion to host tissues enhance cartilage regeneration. Bioact. Mater. 2021, 6, 1689–1698. [Google Scholar] [CrossRef] [Scilit]
- Zhang, K.; Tang, X.; Zhang, J.; Lu, W.; Lin, X.; Zhang, Y.; Tian, B.; Yang, H.; He, H. PEG-PLGA copolymers: Their structure and structure-influenced drug delivery applications. J. Control. Release 2014, 183, 77–86. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Li, C.; Ayeesha, M.; Jin, Z.; Ge, Z. Optimization and characterization of chemically modified polymer microspheres and their effect on cell behavior. Mater. Lett. 2015, 154, 68–72. [Google Scholar] [CrossRef] [Scilit]
- Smeds, K.A.; Pfister-Serres, A.; Miki, D.; Dastgheib, K.; Inoue, M.; Hatchell, D.L.; Grinstaff, M.W. Photocrosslinkable polysaccharides for in situ hydrogel formation. J. Biomed. Mater. Res. 2001, 54, 115–121. [Google Scholar] [CrossRef] [Scilit]
- Robert, L.; Karen, C.; Suzann, E.G.; Antonios, G. Microparticles of poly(dl-lactic-co-glycolic acid)/poly(ethylene glycol) blends for controlled drug delivery. J. Control. Release 1997, 48, 259–268. [Google Scholar]
- Li, K.; Ning, T.; Wang, H.; Jiang, Y.; Zhang, J.; Ge, Z. Nanosecond pulsed electric fields enhance mesenchymal stem cells differentiation via DNMT1-regulated OCT4/NANOG gene expression. Stem Cell Res. Ther. 2020, 11, 308. [Google Scholar] [CrossRef] [Scilit]
- Ning, T.; Guo, J.; Zhang, K.; Li, K.; Zhang, J.; Yang, Z.; Ge, Z. Nanosecond pulsed electric fields enhanced chondrogenic potential of mesenchymal stem cells via JNK/CREB-STAT3 signaling pathway. Stem Cell Res. Ther. 2019, 10, 45. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Primers | Primer Sequence |
|---|---|
| GAPDH | Forward: GGGCTGCTTTTAACTCTGGT |
| Reverse: GCAGGTTTTTCTAGACGG | |
| Aggrecan | Forward: CACTGTTACCGCCACTTCCC |
| Reverse: ACCAGCGGAAGTCCCCTTCG | |
| Sox 9 | Forward: AGCGAACGCACATCAAGAC |
| Reverse: CTGTAGGCGATCTGTTGGGG | |
| COL I | Forward: GACATGCTCAGCTTTGTGGA |
| Reverse: CTTTGTCCACGTGGTCCTCT | |
| COL II | Forward: CAGGTCAAGATGGTC |
| Reverse: TTCAGCACCTGTCTCACCA | |
| COL X | Forward: AGCCAGGGTTGCCAGGACCA |
| Reverse: TTTTCCCACTCCAGGAGGGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, J.; Wang, L.; Lin, J.; Liu, Q. Dual Delivery of TGF-β3 and Ghrelin in Microsphere/Hydrogel Systems for Cartilage Regeneration. Molecules 2021, 26, 5732. https://doi.org/10.3390/molecules26195732
Lin J, Wang L, Lin J, Liu Q. Dual Delivery of TGF-β3 and Ghrelin in Microsphere/Hydrogel Systems for Cartilage Regeneration. Molecules. 2021; 26(19):5732. https://doi.org/10.3390/molecules26195732
Chicago/Turabian StyleLin, Jianjing, Li Wang, Jianhao Lin, and Qiang Liu. 2021. "Dual Delivery of TGF-β3 and Ghrelin in Microsphere/Hydrogel Systems for Cartilage Regeneration" Molecules 26, no. 19: 5732. https://doi.org/10.3390/molecules26195732
APA StyleLin, J., Wang, L., Lin, J., & Liu, Q. (2021). Dual Delivery of TGF-β3 and Ghrelin in Microsphere/Hydrogel Systems for Cartilage Regeneration. Molecules, 26(19), 5732. https://doi.org/10.3390/molecules26195732

