Study of the Antioxidant and Anti-Inflammatory Properties of the Biological Extracts of Psophocarpus tetragonolobus Using Two Extraction Methods
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Collection and Powder Preparation
2.2. Apparatus and Chemicals
2.3. Extraction Methods (Maceration and Ultrasound)
2.4. Phytochemical Screening
2.5. Cell Culture
2.6. RNA Extraction and Quantitative Real-Time PCR
2.7. Western Blot
2.8. DPPH Radical Scavenging Assay
2.9. Statistical Analysis
3. Results
3.1. Phytochemical Screening Antioxidant Effect
3.2. Antioxidant Effect
3.3. In Vitro Anti-Inflammatory Activity
3.3.1. Effect of P. tetragonolobus Crude Extracts on LPS-Induced Expression of TNF-α, IL-6, and IL-1β mRNA
3.3.2. Effects of P. tetragonolobus Crude Extracts on LPS-Induced Expression of iNOS and COX-2 Protein Levels
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Newton, K.; Dixit, V.M. Signaling in innate immunity and inflammation. Cold Spring Harb. Perspect. Biol. 2012, 4. [Google Scholar] [CrossRef] [Scilit]
- Taniguchi, K.; Karin, M. NF-κB, inflammation, immunity and cancer: Coming of age. Nat. Rev. Immunol. 2018, 18, 309–324. [Google Scholar] [CrossRef] [Scilit]
- Mogensen, T.H. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin. Microbiol. Rev. 2009, 22, 240–273. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.M.; An, J. Cytokines, inflammation, and pain. Int. Anesthesiol. Clin. 2007, 45, 27–37. [Google Scholar] [CrossRef] [Scilit]
- Rimarachin, J.A.; Jacobson, J.A.; Szabo, P.; Maclouf, J.; Creminon, C.; Weksler, B.B. Regulation of cyclooxygenase-2 expression in aortic smooth muscle cells. Arterioscler. Thromb. J. Vasc. Biol. 1994, 14, 1021–1031. [Google Scholar] [CrossRef] [Scilit]
- Lima, I.V.D.A.; Bastos, L.F.S.; Limborço-Filho, M.; Fiebich, B.L.; de Oliveira, A.C.P. Role of Prostaglandins in Neuroinflammatory and Neurodegenerative Diseases. Mediat. Inflamm. 2012, 2012, 946813. [Google Scholar] [CrossRef] [Scilit]
- Brown, G.C. Mechanisms of inflammatory neurodegeneration: iNOS and NADPH oxidase. Biochem. Soc. Trans. 2007, 35, 1119–1121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Esbona, K.; Yi, Y.; Saha, S.; Yu, M.; Van Doorn, R.R.; Conklin, M.W.; Graham, D.S.; Wisinski, K.B.; Ponik, S.M.; Eliceiri, K.W.; et al. The Presence of Cyclooxygenase 2, Tumor-Associated Macrophages, and Collagen Alignment as Prognostic Markers for Invasive Breast Carcinoma Patients. Am. J. Pathol. 2018, 188, 559–573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, W.; Ye, T.; Liu, H. Prognostic Value of Inducible Nitric Oxide Synthase (iNOS) in Human Cancer: A Systematic Review and Meta-Analysis. BioMed Res. Int. 2019, 2019, 6304851. [Google Scholar] [CrossRef] [Scilit]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox Signal. 2014, 20, 1126–1167. [Google Scholar] [CrossRef] [Scilit]
- Fransen, M.; Nordgren, M.; Wang, B.; Apanasets, O. Role of peroxisomes in ROS/RNS-metabolism: Implications for human disease. Biochim. Biophys. Acta 2012, 1822, 1363–1373. [Google Scholar] [CrossRef] [Scilit]
- Wongrakpanich, S.; Wongrakpanich, A.; Melhado, K.; Rangaswami, J. A Comprehensive Review of Non-Steroidal Anti-Inflammatory Drug Use in The Elderly. Aging Dis. 2018, 9, 143–150. [Google Scholar] [CrossRef] [Scilit]
- Ravipati, A.S.; Zhang, L.; Koyyalamudi, S.R.; Jeong, S.C.; Reddy, N.; Bartlett, J.; Smith, P.T.; Shanmugam, K.; Münch, G.; Wu, M.J.; et al. Antioxidant and anti-inflammatory activities of selected Chinese medicinal plants and their relation with antioxidant content. BMC Complementary Altern. Med. 2012, 12, 173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, Q.N.; Tanzi, A.S.; Ho, W.K.; Malla, S.; Blythe, M.; Karunaratne, A.; Massawe, F.; Mayes, S. Development of Gene-Based SSR Markers in Winged Bean (Psophocarpus tetragonolobus (L.) DC.) for Diversity Assessment. Genes 2017, 8, 100. [Google Scholar] [CrossRef] [Scilit]
- Farnsworth, N.R.; Akerele, O.; Bingel, A.S.; Soejarto, D.D.; Guo, Z. Medicinal plants in therapy. Bull. World Health Organ. 1985, 63, 965–981. [Google Scholar] [CrossRef] [Scilit]
- Singh, M.; Dubey, R.K.; Koley, T.K.; Maurya, A.; Singh, P.M.; Singh, B. Valorization of winged bean (Psophocarpus tetragonolobus (L) DC) by evaluation of its antioxidant activity through chemometric analysis. S. Afr. J. Bot. 2019, 121, 114–120. [Google Scholar] [CrossRef] [Scilit]
- Sasidharan, S.; Zuraini, Z.; Yoga Latha, L.; Sangetha, S.; Suryani, S. Antimicrobial activities of Psophocarpus tetragonolobus (L.) DC extracts. Foodborne Pathog. Dis. 2008, 5, 303–309. [Google Scholar] [CrossRef] [Scilit]
- Manosroi, A.; Akazawa, H.; Akihisa, T.; Jantrawut, P.; Kitdamrongtham, W.; Manosroi, W.; Manosroi, J. In vitro anti-proliferative activity on colon cancer cell line (HT-29) of Thai medicinal plants selected from Thai/Lanna medicinal plant recipe database “MANOSROI III”. J. Ethnopharmacol. 2015, 161, 11–17. [Google Scholar] [CrossRef] [Scilit]
- Sasidharan, S.; Zakaria, Z.; Lachimanan, Y.; Suryani, S. Fungicidal Effect and Oral Acute Toxicity of Psophocarpus tetragonolobus. Root Extract. Pharm. Biol. 2008, 46, 261–265. [Google Scholar] [CrossRef] [Scilit]
- Colvin, D. A Review on Comparison of the Extraction Methods Used in Licorice Root: Their Principle, Strength and Limitation. Med. Aromat. Plants 2018, 7. [Google Scholar] [CrossRef]
- Silva, A.M.R.; Ferreira, N.L.O.; Oliveira, A.E.; Borges, L.L.; Conceição, E.C. Comparison of Ultrasound-assisted Extraction and Dynamic Maceration Over Content of Tagitinin C obtained from Tithonia diversifolia (Hemsl.) A. Gray Leaves Using Factorial Design. Pharmacogn. Mag. 2017, 13, 270–274. [Google Scholar] [CrossRef] [Scilit]
- Toma, M.; Vinatoru, M.; Paniwnyk, L.; Mason, T.J. Investigation of the effects of ultrasound on vegetal tissues during solvent extraction. Ultrason. Sonochem. 2001, 8, 137–142. [Google Scholar] [CrossRef] [Scilit]
- de Morais Rodrigues, M.C.; Borges, L.L.; Martins, F.S.; Mourão, R.H.; da Conceição, E.C. Optimization of Ultrasound-assisted Extraction of Phenolic Compounds from Myrcia amazonica DC. (Myrtaceae) Leaves. Pharmacogn. Mag. 2016, 12, 9–12. [Google Scholar] [CrossRef] [Scilit]
- Kallassy, H.; Fayyad-Kazan, M.; Makki, R.; El-Makhour, Y.; Hamade, E.; Rammal, H.; Leger, D.Y.; Sol, V.; Fayyad-Kazan, H.; Liagre, B.; et al. Chemical Composition, Antioxidant, Anti-Inflammatory, and Antiproliferative Activities of the Plant Lebanese Crataegus Azarolus L. Med. Sci. Monit. Basic Res. 2017, 23, 270–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, J.J.; Bao, J.L.; Chen, X.P.; Huang, M.; Wang, Y.T. Alkaloids isolated from natural herbs as the anticancer agents. Evid. Based Complementary Altern. Med. Ecam 2012, 2012, 485042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mir, M.A.; Sawhney, S.S.; Jassal, M.M.S. Qualitative and quantitative analysis of phytochemicals of Taraxacum officinale. J. Pharm. Pharmocol. 2013, 2, 001–005. [Google Scholar]
- Gul, R.; Jan, S.U.; Faridullah, S.; Sherani, S.; Jahan, N. Preliminary Phytochemical Screening, Quantitative Analysis of Alkaloids, and Antioxidant Activity of Crude Plant Extracts from Ephedra intermedia Indigenous to Balochistan. Sci. World J. 2017, 2017, 5873648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Odeja, O.; Ogwuche, C.E.; Elemike, E.E.; Obi, G. Phytochemical screening, antioxidant and antimicrobial activities of Acalypha ciliata plant. Clin. Phytosci. 2016, 2, 12. [Google Scholar] [CrossRef] [Scilit]
- Bhuyan, D.J.; Basu, A. Phenolic Compounds: Potential Health Benefits and Toxicity; Taylor and Francis, CRC Press: Abingdon, UK, 2017; pp. 27–59. [Google Scholar]
- Article, R.; Keo, S.; Meng, C.; Oeung, S.; Nov, V.; Lon, S.; Vichet, T.; Va, T.; Sourn, M.; Chea, S. Preliminary phytochemical screening of selected Medicinal Plants of Cambodia. Asian J. Pharmacogn. 2017, 1, 16–23. [Google Scholar]
- Basiru, A.; Ibukun, E.; Edobor, G.; Ojo, O.; Onikanni, S. Qualitative and quantitative analysis of phytochemicals in senecio biafrae leaf. Int. J. Invent. Pharm. Sci. 2013, 1, 428–432. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lourenço, S.C.; Moldão-Martins, M.; Alves, V.D. Antioxidants of Natural Plant Origins: From Sources to Food Industry Applications. Molecules 2019, 24, 4132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vilahur, G.; Ben-Aicha, S.; Diaz-Riera, E.; Badimon, L.; Padró, T. Phytosterols and Inflammation. Curr. Med. Chem. 2019, 26, 6724–6734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Desai, S.; Desai, D.G.; Kaur, H. Saponins and their biological activities. Pharma Times 2009, 41, 13–16. [Google Scholar]



| Metabolites | Added Reagent | Expected Result |
|---|---|---|
| Alkaloids | Dragendorff’s reagent | Red or orange precipitate |
| Resins | Acetone + water | Turbidity |
| Saponins | Agitation | Formation of foam |
| Quinones | Hydrochloric acid (HCl) concentrated | Red coloration |
| Phenols | FeCl3 (1%) + K3(Fe(CN)6) (1%) | Green-blue coloration |
| Flavonoids | Potassium Hydroxide (KOH) (50%) | Yellow coloration |
| Flavanones | H2SO4 concentrated | Bluish-red coloration |
| Carbohydrates | α-naphtol + H2SO4 | Purple ring |
| Diterpenes | Copper acetate | Green coloration |
| Reducing sugars | Fehling’s solution (A + B) | Brownish-red precipitate |
| Sterols and steroids | Chloroform + H2SO4 concentrated | Red color (surface) + fluorescence Greenish-yellow |
| Cardiac glycosides | Glacial acetic acid + FeCl3 (5%) + H2SO4 conc | Ring |
| Anthraquinones | HCl concentrated (10%) + chloroform + Ammonia (10%) | Pink coloration |
| Proteins and amino acids | Ninhydrin 0.25% | Blue coloration |
| Lignins | Safranine | Pink coloration |
| Phlabotannins | HCl (1%) | Blue coloration |
| Anthocyanins | Sodium Hydroxide (NaOH) (10%) | Blue coloration |
| Fixed oils and fats | Spot Test | Oil stain |
| Gene | Forward Sequence (5′–3′) | Reverse Sequence (5′–3′) |
|---|---|---|
| 18s rRNA | GCAATTATTCCCCATGAACG | GGCCTCACTAAACCATCCAA |
| TNF-α | GTAGCCCACGTCGTAGCAAACCAC | GGTACAACCCATCGGCTGGCAC |
| IL-6 | CCTCTCTGCAAGAGACTTCCATCCA | TCCTCTGTGAAGTCTCCTCTCCGG |
| IL-1β | TGGACCTTCCAGGATGAGGACA | GTTCATCTCGGAGCCTGTAGTG |
| Metabolite | Maceration | Ultrasound |
|---|---|---|
| Alkaloids | + | + |
| Tannins | + | + |
| Resins | + | + |
| Saponins | + | − |
| Phenols | + | + |
| Flavonoids | + | + |
| Flavanones | − | − |
| Reducing sugars | − | − |
| Quinones | − | − |
| Sterols and steroids | − | + |
| Cardiac glycosides | − | − |
| Diterpenes | + | + |
| Anthraquinones | − | − |
| Proteins and amino acids | + | + |
| Lignins | + | + |
| Phlabotannins | − | − |
| Anthocyanins | − | − |
| Fixed oils and fats | + | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bassal, H.; Hijazi, A.; Farhan, H.; Trabolsi, C.; Ahmad, B.S.; Khalil, A.; Maresca, M.; El Omar, F. Study of the Antioxidant and Anti-Inflammatory Properties of the Biological Extracts of Psophocarpus tetragonolobus Using Two Extraction Methods. Molecules 2021, 26, 4435. https://doi.org/10.3390/molecules26154435
Bassal H, Hijazi A, Farhan H, Trabolsi C, Ahmad BS, Khalil A, Maresca M, El Omar F. Study of the Antioxidant and Anti-Inflammatory Properties of the Biological Extracts of Psophocarpus tetragonolobus Using Two Extraction Methods. Molecules. 2021; 26(15):4435. https://doi.org/10.3390/molecules26154435
Chicago/Turabian StyleBassal, Hussein, Akram Hijazi, Hussein Farhan, Christine Trabolsi, Bouchra Sayed Ahmad, Alia Khalil, Marc Maresca, and Fawaz El Omar. 2021. "Study of the Antioxidant and Anti-Inflammatory Properties of the Biological Extracts of Psophocarpus tetragonolobus Using Two Extraction Methods" Molecules 26, no. 15: 4435. https://doi.org/10.3390/molecules26154435
APA StyleBassal, H., Hijazi, A., Farhan, H., Trabolsi, C., Ahmad, B. S., Khalil, A., Maresca, M., & El Omar, F. (2021). Study of the Antioxidant and Anti-Inflammatory Properties of the Biological Extracts of Psophocarpus tetragonolobus Using Two Extraction Methods. Molecules, 26(15), 4435. https://doi.org/10.3390/molecules26154435

