Genome Mining Reveals Two Missing CrtP and AldH Enzymes in the C30 Carotenoid Biosynthesis Pathway in Planococcus faecalis AJ003T
Abstract
1. Introduction
2. Results and Discussion
2.1. Identification of crtP Encoding 4,4-diaponeurosporene Oxidase
2.2. Identification of aldH Encoding Aldehyde Dehydrogenase
3. Materials and Methods
3.1. Bacterial Strains Culture Condition and Plasmids
3.2. Genome Mining
3.3. Cloning and Construction of Expression Modules of Carotenoid Pathway Genes
3.4. Isolation of Carotenoids
3.5. Analysis of Carotenoids
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Johnson, E.T.; Schmidt-Dannert, C. Light-energy conversion in engineered microorganisms. Trends Biotechnol. 2008, 26, 682–689. [Google Scholar] [CrossRef] [PubMed]
- Lee, P.C.; Holtzapple, E.; Schmidt-Dannert, C. Novel Activity of Rhodobacter sphaeroides Spheroidene Monooxygenase CrtA Expressed in Escherichia coli. Appl. Environ. Microbiol. 2010, 76, 7328–7331. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Nishino, H.; Murakoshi, M.; Tokuda, H.; Satomi, Y. Cancer prevention by carotenoids. Arch. Biochem. Biophys. 2009, 483, 165–168. [Google Scholar] [CrossRef] [PubMed]
- Engelhardt, M.; Daly, K.; Swannell, R.; Head, I.M. Isolation and characterization of a novel hydrocarbon-degrading, Gram-positive bacterium, isolated from intertidal beach sediment, and description of Planococcus alkanoclasticus sp. nov. J. Appl. Microbiol. 2001, 90, 237–247. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Kim, M.S.; Lee, B.Y.; Lee, P.C. Generation of structurally novel short carotenoids and study of their biological activity. Sci. Rep. 2016, 6, 21987. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Kang, H.J.; Yu, B.J.; Kim, S.C.; Lee, P.C. Planococcus faecalis sp. nov., a carotenoid-producing species isolated from stools of Antarctic penguins. Int. J. Syst. Evol. Microbiol. 2015, 65, 3373–3378. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.W.; Choi, B.H.; Kang, H.-J.; Ryu, H.; Lee, P.C.; Kim, J.H. Complete genome sequence of Planococcus faecalis AJ003 T, the type species of the genus Planococcus and a microbial C30 carotenoid producer. J. Biotechnol. 2018, 266, 72–76. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Lee, P.C. Functional Expression and Extension of Staphylococcal Staphyloxanthin Biosynthetic Pathway in Escherichia coli. J. Biol. Chem. 2012, 287, 21575–21583. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Park, Y.H.; Schmidt-Dannert, C.; Lee, P.C. Redesign, Reconstruction, and Directed Extension of the Brevibacterium linens C40 Carotenoid Pathway in Escherichia coli. Appl. Environ. Microbiol. 2010, 76, 5199–5206. [Google Scholar] [CrossRef] [PubMed]
- Song, G.H.; Kim, S.H.; Choi, B.H.; Han, S.J.; Lee, P.C. Heterologous Carotenoid-Biosynthetic Enzymes: Functional Complementation and Effects on Carotenoid Profiles in Escherichia coli. Appl. Environ. Microbiol. 2013, 79, 610–618. [Google Scholar] [CrossRef] [PubMed]
- Heo, J.; Kim, S.H.; Lee, P.C. New Insight into the Cleavage Reaction of Nostoc sp. Strain PCC 7120 Carotenoid Cleavage Dioxygenase in Natural and Nonnatural Carotenoids. Appl. Environ. Microbiol. 2013, 79, 3336–3345. [Google Scholar] [CrossRef] [PubMed]
- Lee, P.C.; Momen, A.Z.R.; Mijts, B.N.; Schmidt-Dannert, C. Biosynthesis of Structurally Novel Carotenoids in Escherichia coli. Chem. Biol. 2003, 10, 453–462. [Google Scholar] [CrossRef]
- Kim, S.H.; Kim, J.H.; Lee, B.Y.; Lee, P.C. The astaxanthin dideoxyglycoside biosynthesis pathway in Sphingomonas sp. PB304. Appl. Microbiol. Biotechnol. 2014, 98, 9993–10003. [Google Scholar] [CrossRef] [PubMed]
- Mijts, B.N.; Lee, P.C.; Schmidt-Dannert, C. Engineering Carotenoid Biosynthetic Pathways. In Methods in Enzymology; Elsevier BV: Amsterdam, the Netherlands, 2004; Volume 388, pp. 315–329. [Google Scholar]
- Ye, R.W.; Yao, H.; Stead, K.; Wang, T.; Tao, L.; Cheng, Q.; Sharpe, P.L.; Suh, W.; Nagel, E.; Arcilla, D.; et al. Construction of the astaxanthin biosynthetic pathway in a methanotrophic bacterium Methylomonas sp. strain 16a. J. Ind. Microbiol. Biotechnol. 2007, 34, 289–299. [Google Scholar] [CrossRef] [PubMed]
- Jang, H.-J.; Yoon, S.-H.; Ryu, H.-K.; Kim, J.-H.; Wang, C.; Kim, J.-Y.; Oh, D.-K.; Kim, S.-W. Retinoid production using metabolically engineered Escherichia coli with a two-phase culture system. Microb. Cell Factories 2011, 10, 59. [Google Scholar] [CrossRef] [PubMed]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.S.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed]



| Strains and Plasmids | Relevant Properties | Source or Reference |
|---|---|---|
| E.coli strains | ||
| TOP10 | F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG | Invitrogen |
| XL1-blue | endA1 gyrA96(nalR) thi-1 recA1 relA1 lac glnV44 F’[::Tn10 proAB+lacIq (ΔlacZ)M15] hsdR17(rK−mK+) | Stratagene |
| Other bacteria strains | ||
| P. faecalis AJ003T | Source for C30 carotenoid pathway genes | KCTC 32457 |
| Plasmids | ||
| pUCM | Cloning vector modified from pUC19. Constitutive lac promoter, AmpR | [9] |
| pACM | Expression vector modified form pACYC184; deleted lacZ fragment and lac promoter, Cm | [9] |
| pACM_crtMSA-crtNSA | Constitutively expressing crtM and crtN genes from S. aureus | [8] |
| pACM_crtMSA-crtNSA-crtPSA | Constitutively expressing crtM, crtN and crtP genes from S. aureus | [7] |
| pUCM_aldHSA | Constitutively expressing aldH gene from S. aureus | [8] |
| pUCM_crtP1PF | Constitutively expressing crtP1 gene from P. faecalis | [7] |
| pUCM_crtP2PF | Constitutively expressing crtP2 gene from P. faecalis | This study |
| pUCM_aldH420PF | Constitutively expressing aldH420 gene from P. faecalis | This study |
| pUCM_aldH905PF | Constitutively expressing aldH905 gene from P. faecalis | This study |
| pUCM_aldH1759PF | Constitutively expressing aldH1759 gene from P. faecalis | This study |
| pUCM_aldH2454PF | Constitutively expressing aldH2454 gene from P. faecalis | This study |
| pACM_crtMPF-crtNPF | Constitutively expressing crtM and crtN genes from P. faecalis | [7] |
| pACM_crtMPF-crtNPF-crtP2PF | Constitutively expressing crtM, crtN and crtP genes from P. faecalis | This study |
| Gene | Sequence (5′ to 3′) a | Enzyme Site |
|---|---|---|
| crtP2 | F: GCTCTAGAAGGAGGATTACAAAATGAATCATTCACAAAAATCG | XbaI |
| R: CGGAATTCCTATTTCTTCTCTGCTTGAT | EcoRI | |
| aldH420 | F: GCTCTAGAAGGAGGATTACAAAATGCAACAGCATAAAATATATA | XbaI |
| R: ATAAGAATGCGGCCGCTTATTTACTATTTTTATACTGCAT | NotI | |
| aldH905 | F: GCTCTAGAAGGAGGATTACAAAATGAAAAAACAGCAAATGTATG | XbaI |
| R: ATAAGAATGCGGCCGCTTAATATTTGAGCGCTACATT | NotI | |
| aldH1759 | F: GCTCTAGAAGGAGGATTACAAATGAAAACCGATTTTTCAAAAAT | XbaI |
| R: ATAAGAATGCGGCCGCTTATTTTTTGGTGTTAGTAACA | NotI | |
| aldH2454 | F: GCTCTAGAAGGAGGATTACAAAATGAATTTTACAGCAACTGAT | XbaI |
| R: ATAAGAATGCGGCCGCTTATTTCAGTACTGTCTTGAT-3′ | NotI |
Sample Availability: Samples of the compounds are not available from the authors. |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.H.; Kim, J.W.; Lee, P.C. Genome Mining Reveals Two Missing CrtP and AldH Enzymes in the C30 Carotenoid Biosynthesis Pathway in Planococcus faecalis AJ003T. Molecules 2020, 25, 5892. https://doi.org/10.3390/molecules25245892
Lee JH, Kim JW, Lee PC. Genome Mining Reveals Two Missing CrtP and AldH Enzymes in the C30 Carotenoid Biosynthesis Pathway in Planococcus faecalis AJ003T. Molecules. 2020; 25(24):5892. https://doi.org/10.3390/molecules25245892
Chicago/Turabian StyleLee, Jun Ho, Jin Won Kim, and Pyung Cheon Lee. 2020. "Genome Mining Reveals Two Missing CrtP and AldH Enzymes in the C30 Carotenoid Biosynthesis Pathway in Planococcus faecalis AJ003T" Molecules 25, no. 24: 5892. https://doi.org/10.3390/molecules25245892
APA StyleLee, J. H., Kim, J. W., & Lee, P. C. (2020). Genome Mining Reveals Two Missing CrtP and AldH Enzymes in the C30 Carotenoid Biosynthesis Pathway in Planococcus faecalis AJ003T. Molecules, 25(24), 5892. https://doi.org/10.3390/molecules25245892

