Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury
Abstract
:1. Introduction
2. Results
2.1. Apamin Ameliorated LPS-Induced Renal Dysfunction and Histological Injury
2.2. Apamin Suppressed LPS-Induced Oxidative Stress
2.3. Apamin Inhibted LPS-Induced Apoptosis
2.4. Apamin Suppressed LPS-Induced Inflammation
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Animals
4.3. Protocol of LPS-Induced AKI
4.4. Biochemical Analyses
4.5. Histological Analysis, Immunohistochemical Staining, and Immunofluorescent Staining
4.6. Immunoblot Analysis
4.7. Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
4.8. TUNEL Assay
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ronco, C.; Bellomo, R.; Kellum, J.A. Acute kidney injury. Lancet 2019, 394, 1949–1964. [Google Scholar] [CrossRef]
- Peerapornratana, S.; Manrique-Caballero, C.L.; Gómez, H.; Kellum, J.A. Acute kidney injury from sepsis: Current concepts, epidemiology, pathophysiology, prevention and treatment. Kidney Int. 2019, 96, 1083–1099. [Google Scholar] [CrossRef] [PubMed]
- Morrell, E.D.; Kellum, J.A.; Pastor-Soler, N.M.; Hallows, K.R. Septic acute kidney injury: Molecular mechanisms and the importance of stratification and targeting therapy. Crit. Care 2014, 18, 501. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, D.-Q.; Hu, H.-H.; Wang, Y.-N.; Feng, Y.-L.; Cao, G.; Zhao, Y.-Y. Natural products for the prevention and treatment of kidney disease. Phytomedicine 2018, 50, 50–60. [Google Scholar] [CrossRef]
- Rapa, S.F.; Di Iorio, B.R.; Campiglia, P.; Heidland, A.; Marzocco, S. Inflammation and Oxidative Stress in Chronic Kidney Disease—Potential Therapeutic Role of Minerals, Vitamins and Plant-Derived Metabolites. Int. J. Mol. Sci. 2020, 21, 263. [Google Scholar] [CrossRef] [Green Version]
- Mărgăoan, R.; Stranț, M.; Varadi, A.; Topal, E.; Yücel, B.; Cornea-Cipcigan, M.; Campos, M.G.; Vodnar, D.C. Bee Collected Pollen and Bee Bread: Bioactive Constituents and Health Benefits. Antioxidants 2019, 8, 568. [Google Scholar] [CrossRef] [Green Version]
- Kocot, J.; Kiełczykowska, M.; Luchowska-Kocot, D.; Kurzepa, J.; Musik, I. Antioxidant Potential of Propolis, Bee Pollen, and Royal Jelly: Possible Medical Application. Oxid. Med. Cell. Longev. 2018, 2018, 7074209. [Google Scholar] [CrossRef]
- Lee, W.-R.; Pak, S.C.; Park, K.-K. The Protective Effect of Bee Venom on Fibrosis Causing Inflammatory Diseases. Toxins 2015, 7, 4758–4772. [Google Scholar] [CrossRef] [Green Version]
- Gu, H.; An, H.-J.; Kim, J.-Y.; Kim, W.-H.; Gwon, M.-G.; Kim, H.-J.; Han, S.M.; Park, I.; Park, S.C.; Leem, J.; et al. Bee venom attenuates Porphyromonas gingivalis and RANKL-induced bone resorption with osteoclastogenic differentiation. Food Chem. Toxicol. 2019, 129, 344–353. [Google Scholar] [CrossRef]
- Wehbe, R.; Frangieh, J.; Rima, M.; El Obeid, D.; Sabatier, J.-M.; Fajloun, Z. Bee Venom: Overview of Main Compounds and Bioactivities for Therapeutic Interests. Molecules 2019, 24, 2997. [Google Scholar] [CrossRef] [Green Version]
- Lee, G.; Bae, H. Anti-Inflammatory Applications of Melittin, a Major Component of Bee Venom: Detailed Mechanism of Action and Adverse Effects. Molecules 2016, 21, 616. [Google Scholar] [CrossRef] [PubMed]
- Oršolić, N. Bee venom in cancer therapy. Cancer Metastasis Rev. 2012, 31, 173–194. [Google Scholar] [CrossRef] [PubMed]
- Gu, H.; Han, S.M.; Park, K.-K. Therapeutic Effects of Apamin as a Bee Venom Component for Non-Neoplastic Disease. Toxins 2020, 12, 195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, Y.M.; Cho, S.-N.; Son, E.; Song, C.-H.; Kim, D.-S. Apamin from bee venom suppresses inflammation in a murine model of gouty arthritis. J. Ethnopharmacol. 2020, 257, 112860. [Google Scholar] [CrossRef] [PubMed]
- Mohammadi-Rad, M.; Ghasemi, N.; Aliomrani, M. Evaluation of apamin effects on myelination process in C57BL/6 mice model of multiple sclerosis. Res. Pharm. Sci. 2019, 14, 424–431. [Google Scholar] [PubMed]
- Kim, J.-Y.; An, H.-J.; Kim, W.-H.; Park, Y.-Y.; Park, K.D.; Park, K.-K. Apamin suppresses biliary fibrosis and activation of hepatic stellate cells. Int. J. Mol. Med. 2017, 39, 1188–1194. [Google Scholar] [CrossRef]
- Bae, G.-S.; Heo, K.-H.; Park, K.-C.; Choi, S.B.; Jo, I.-J.; Seo, S.-H.; Kim, D.-G.; Shin, J.-Y.; Kang, D.-G.; Lee, H.-S.; et al. Apamin attenuated cerulein-induced acute pancreatitis by inhibition of JNK pathway in mice. Dig. Dis. Sci. 2013, 58, 2908–2917. [Google Scholar] [CrossRef]
- Kim, S.J.; Park, J.H.; Kim, K.H.; Lee, W.R.; Pak, S.C.; Han, S.M.; Park, K.K. The Protective Effect of Apamin on LPS/Fat-Induced Atherosclerotic Mice. Evid. Based Complement Alternat. Med. 2012, 2012, 305454. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Protective Effects of SPA0355, a Thiourea Analogue, Against Lipopolysaccharide-Induced Acute Kidney Injury in Mice. Antioxidants 2020, 9, 585. [Google Scholar] [CrossRef]
- Chen, Y.; Jin, S.; Teng, X.; Hu, Z.; Zhang, Z.; Qiu, X.; Tian, D.; Wu, Y. Hydrogen Sulfide Attenuates LPS-Induced Acute Kidney Injury by Inhibiting Inflammation and Oxidative Stress. Oxid. Med. Cell. Longev. 2018, 2018, 6717212. [Google Scholar] [CrossRef] [Green Version]
- Yoo, J.-Y.; Cha, D.R.; Kim, B.; An, E.J.; Lee, S.R.; Cha, J.J.; Kang, Y.S.; Ghee, J.Y.; Han, J.Y.; Bae, Y.S. LPS-Induced Acute Kidney Injury Is Mediated by Nox4-SH3YL1. Cell Rep. 2020, 33, 108245. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Mao, Z.; Zhang, Z.; Obata, F.; Yang, X.; Zhang, X.; Huang, Y.; Mitsui, T.; Fan, J.; Takeda, M.; et al. Connexin43 Contributes to Inflammasome Activation and Lipopolysaccharide-Initiated Acute Renal Injury via Modulation of Intracellular Oxidative Status. Antioxid. Redox Signal. 2019, 31, 1194–1212. [Google Scholar] [CrossRef] [PubMed]
- Tracz, M.J.; Juncos, J.P.; Grande, J.P.; Croatt, A.J.; Ackerman, A.W.; Rajagopalan, G.; Knutson, K.L.; Badley, A.D.; Griffin, M.D.; Alam, J.; et al. Renal hemodynamic, inflammatory, and apoptotic responses to lipopolysaccharide in HO-1-/- mice. Am. J. Pathol. 2007, 170, 1820–1830. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poole, B.; Wang, W.; Chen, Y.-C.; Zolty, E.; Falk, S.; Mitra, A.; Schrier, R. Role of heme oxygenase-1 in endotoxemic acute renal failure. Am. J. Physiol. Ren. Physiol. 2005, 289, F1382–F1385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Lee, S.-J.; Maeng, Y.-I.; Leem, J.; Park, K.-K. Protective Effects of Bee Venom against Endotoxemia-Related Acute Kidney Injury in Mice. Biology 2020, 9, 154. [Google Scholar] [CrossRef] [PubMed]
- Lerolle, N.; Nochy, D.; Guérot, E.; Bruneval, P.; Fagon, J.Y.; Diehl, J.L.; Hill, G. Histopathology of septic shock induced acute kidney injury: Apoptosis and leukocytic infiltration. Intensive Care Med. 2010, 36, 471–478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ying, J.; Wu, J.; Zhang, Y.; Han, Y.; Qian, X.; Yang, Q.; Chen, Y.; Chen, Y.; Zhu, H. Ligustrazine suppresses renal NMDAR1 and caspase-3 expressions in a mouse model of sepsis-associated acute kidney injury. Mol. Cell. Biochem. 2020, 464, 73–81. [Google Scholar] [CrossRef]
- Jia, Y.; Li, Z.; Feng, Y.; Cui, R.; Dong, Y.; Zhang, X.; Xiang, X.; Qu, K.; Liu, C.; Zhang, J. Methane-Rich Saline Ameliorates Sepsis-Induced Acute Kidney Injury through Anti-Inflammation, Antioxidative, and Antiapoptosis Effects by Regulating Endoplasmic Reticulum Stress. Oxid. Med. Cell. Longev. 2018, 2018, 4756846. [Google Scholar] [CrossRef] [Green Version]
- Du, J.; Jiang, S.; Hu, Z.; Tang, S.; Sun, Y.; He, J.; Li, Z.; Yi, B.; Wang, J.; Zhang, H.; et al. Vitamin D receptor activation protects against lipopolysaccharide-induced acute kidney injury through suppression of tubular cell apoptosis. Am. J. Physiol. Ren. Physiol. 2019, 316, F1068–F1077. [Google Scholar] [CrossRef]
- Su, Z.; Yu, P.; Sheng, L.; Ye, J.; Qin, Z. Fangjifuling Ameliorates Lipopolysaccharide-Induced Renal Injury via Inhibition of Inflammatory and Apoptotic Response in Mice. Cell. Physiol. Biochem. 2018, 49, 2124–2137. [Google Scholar] [CrossRef]
- Guo, R.; Wang, Y.; Minto, A.W.; Quigg, R.J.; Cunningham, P.N. Acute renal failure in endotoxemia is dependent on caspase activation. J. Am. Soc. Nephrol. 2004, 15, 3093–3102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa, N.A.; Gut, A.L.; Azevedo, P.S.; Tanni, S.E.; Cunha, N.B.; Fernandes, A.A.H.; Polegato, B.F.; Zornoff, L.A.M.; de Paiva, S.A.R.; Balbi, A.L.; et al. Protein carbonyl concentration as a biomarker for development and mortality in sepsis-induced acute kidney injury. Biosci. Rep. 2018, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.-J.; Park, J.-H.; Kim, K.-H.; Lee, W.-R.; An, H.-J.; Min, B.-K.; Han, S.-M.; Kim, K.-S.; Park, K.-K. Apamin inhibits THP-1-derived macrophage apoptosis via mitochondria-related apoptotic pathway. Exp. Mol. Pathol. 2012, 93, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Wu, F.-R.; Wang, J.-N.; Gao, L.; Jiang, L.; Li, H.-D.; Ma, Q.; Liu, X.-Q.; Wei, B.; Zhou, L.; et al. Nox4 in renal diseases: An update. Free Radic. Biol. Med. 2018, 124, 466–472. [Google Scholar] [CrossRef] [PubMed]
- Gu, L.; Liu, J.; Xu, D.; Lu, Y. Polydatin prevents LPS-induced acute kidney injury through inhibiting inflammatory and oxidative responses. Microb. Pathog. 2019, 137, 103688. [Google Scholar] [CrossRef]
- Mir, S.M.; Ravuri, H.G.; Pradhan, R.K.; Narra, S.; Kumar, J.M.; Kuncha, M.; Kanjilal, S.; Sistla, R. Ferulic acid protects lipopolysaccharide-induced acute kidney injury by suppressing inflammatory events and upregulating antioxidant defenses in Balb/c mice. Biomed. Pharmacother. 2018, 100, 304–315. [Google Scholar] [CrossRef]
- Wu, Q.; Liu, L.-T.; Wang, X.-Y.; Lang, Z.-F.; Meng, X.-H.; Guo, S.-F.; Yan, B.; Zhan, T.; Zheng, H.-Z.; Wang, H.-W. Lycium barbarum polysaccharides attenuate kidney injury in septic rats by regulating Keap1-Nrf2/ARE pathway. Life Sci. 2020, 242, 117240. [Google Scholar] [CrossRef]
- Zou, L.; Feng, Y.; Li, Y.; Zhang, M.; Chen, C.; Cai, J.; Gong, Y.; Wang, L.; Thurman, J.M.; Wu, X.; et al. Complement factor B is the downstream effector of TLRs and plays an important role in a mouse model of severe sepsis. J. Immunol. 2013, 191, 5625–5635. [Google Scholar] [CrossRef] [Green Version]
- Castoldi, A.; Braga, T.T.; Correa-Costa, M.; Aguiar, C.F.; Bassi, Ê.J.; Correa-Silva, R.; Elias, R.M.; Salvador, F.; Moraes-Vieira, P.M.; Cenedeze, M.A.; et al. TLR2, TLR4 and the MYD88 signaling pathway are crucial for neutrophil migration in acute kidney injury induced by sepsis. PLoS ONE 2012, 7, e37584. [Google Scholar] [CrossRef]
- Zhang, B.; Zeng, M.; Li, M.; Kan, Y.; Li, B.; Xu, R.; Wu, Y.; Wang, S.; Zheng, X.; Feng, W. Protopine Protects Mice against LPS-Induced Acute Kidney Injury by Inhibiting Apoptosis and Inflammation via the TLR4 Signaling Pathway. Molecules 2020, 25, 15. [Google Scholar] [CrossRef] [Green Version]
- Huynh, D.T.N.; Baek, N.; Sim, S.; Myung, C.-S.; Heo, K.-S. Minor Ginsenoside Rg2 and Rh1 Attenuates LPS-Induced Acute Liver and Kidney Damages via Downregulating Activation of TLR4-STAT1 and Inflammatory Cytokine Production in Macrophages. Int. J. Mol. Sci. 2020, 21, 6656. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Feng, Y.; Shen, X.; Pan, G.; Fan, G.; Gao, X.; Han, J.; Zhu, Y. Anti-sepsis protection of Xuebijing injection is mediated by differential regulation of pro- and anti-inflammatory Th17 and T regulatory cells in a murine model of polymicrobial sepsis. J. Ethnopharmacol. 2018, 211, 358–365. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Wang, C.; Wang, Y.; Zhang, J.; Wang, F.; Li, L.; Meng, X.; Li, G.; Li, Y.; Wang, L. Isoliquiritigenin attenuates LPS-induced AKI by suppression of inflammation involving NF-κB pathway. Am. J. Transl. Res. 2018, 10, 4141–4151. [Google Scholar] [PubMed]
- Park, J.; Jang, K.M.; Park, K.-K. Apamin Suppresses LPS-Induced Neuroinflammatory Responses by Regulating SK Channels and TLR4-Mediated Signaling Pathways. Int. J. Mol. Sci. 2020, 21, 4319. [Google Scholar] [CrossRef]
- Kim, W.H.; An, H.J.; Kim, J.Y.; Gwon, M.G.; Gu, H.; Lee, S.J.; Park, J.Y.; Park, K.D.; Han, S.M.; Kim, M.K.; et al. Apamin inhibits TNF-α- and IFN-γ-induced inflammatory cytokines and chemokines via suppressions of NF-κB signaling pathway and STAT in human keratinocytes. Pharmacol. Rep. 2017, 69, 1030–1035. [Google Scholar] [CrossRef]
- Shin, S.-H.; Ye, M.-K.; Choi, S.-Y.; Park, K.-K. The Effects of Melittin and Apamin on Airborne Fungi-Induced Chemical Mediator and Extracellular Matrix Production from Nasal Polyp Fibroblasts. Toxins 2017, 9, 348. [Google Scholar] [CrossRef] [Green Version]
- Harjunpää, H.; Asens, M.L.; Guenther, C.; Fagerholm, S.C. Cell Adhesion Molecules and Their Roles and Regulation in the Immune and Tumor Microenvironment. Front. Immunol. 2019, 10, 1078. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.-Y.; Leem, J.; Jeon, E.J. Protective Effects of Melatonin against Aristolochic Acid-Induced Nephropathy in Mice. Biomolecules 2020, 10, 11. [Google Scholar] [CrossRef] [Green Version]
Sample Availability: Not available. |
Gene | Primer Sequence (5′→3′) | Accession No. |
---|---|---|
NOX4 1 | Forward: GAACCCAAGTTCCAAGCTCATT Reverse: GGCACAAAGGTCCAGAAATCC | NM_015760 |
HO-1 2 | Forward: TGCAGGTGATGCTGACAGAGG Reverse: GGGATGAGCTAGTGCTGATCTGG | NM_010442 |
TNF-α 3 | Forward: GACGTGGAACTGGCAGAAGAG Reverse: CCGCCTGGAGTTCTGGAA | NM_013693 |
IL-6 4 | Forward: CCAGAGATACAAAGAAATGATGG Reverse: ACTCCAGAAGACCAGAGGAAAT | NM_031168 |
E-selectin | Forward: AGCTACCCATGGAACACGAC Reverse: ACGCAAGTTCTCCAGCTGTT | NM_011345 |
VCAM-1 5 | Forward: CCCAGGTGGAGGTCTACTCA Reverse: CAGGATTTTGGGAGCTGGTA | NM_011693 |
ICAM-1 6 | Forward: TTCACACTGAATGCCAGCTC Reverse: GTCTGCTGAGACCCCTCTTG | NM_010493 |
GAPDH 7 | Forward: ACTCCACTCACGGCAAATTC Reverse: TCTCCATGGTGGTGAAGACA | NM_001289726 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-Y.; Leem, J.; Park, K.-K. Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules 2020, 25, 5717. https://doi.org/10.3390/molecules25235717
Kim J-Y, Leem J, Park K-K. Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules. 2020; 25(23):5717. https://doi.org/10.3390/molecules25235717
Chicago/Turabian StyleKim, Jung-Yeon, Jaechan Leem, and Kwan-Kyu Park. 2020. "Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury" Molecules 25, no. 23: 5717. https://doi.org/10.3390/molecules25235717
APA StyleKim, J.-Y., Leem, J., & Park, K.-K. (2020). Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules, 25(23), 5717. https://doi.org/10.3390/molecules25235717