Effect of Potassium Concentration on Triplex Stability under Molecular Crowding Conditions
Abstract
1. Introduction
2. Results
2.1. The Structure and Stability of Intramolecular and Intermolecular Triplexes
2.2. The Effects of K+ on the Stability of Triplexes in the Absence of PEG 200
2.3. The Effect of K+ on the Stability of Triplexes in the Presence of PEG 200
3. Discussion
4. Materials and Methods
4.1. Chemicals and Materials
4.2. CD Measurement
4.3. UV Melting Assay
4.4. Molecular Mechanics Studies
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zhao, J.; Bacolla, A.; Wang, G.; Vasquez, K.M. Non-B DNA Structure-Induced Genetic Instability and Evolution. Cell. Mol. Life Sci. 2010, 67, 43–62. [Google Scholar] [CrossRef] [PubMed]
- Bacolla, A.; Wojciechowska, M.; Kosmider, B.; Larson, J.E.; Wells, R.D. The Involvement of non-B DNA Structures in Gross Chromosomal Rearrangements. DNA Repair 2006, 5, 1161–1170. [Google Scholar] [CrossRef] [PubMed]
- Wells, R.D. Non-B DNA Conformations, Mutagenesis and Disease. Trends Biochem. Sci. 2007, 32, 271–278. [Google Scholar] [CrossRef] [PubMed]
- Tateishi-Karimata, H.; Isono, N.; Sugimoto, N. New Insights into Transcription Fidelity: Thermal Stability of Non-Canonical Structures in Template DNA Regulates Transcriptional Arrest, Pause, and Slippage. PLoS ONE 2014, 9, e90580. [Google Scholar] [CrossRef]
- Cooney, M.; Czernuszewicz, G.; Postel, E.H.; Flint, S.J.; Hogan, M.E. Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in Vitro. Science 1988, 241, 456–459. [Google Scholar] [CrossRef]
- Nakano, S.; Miyoshi, D.; Sugimoto, N. Effects of Molecular Crowding on the Structures, Interactions, and Functions of Nucleic Acids. Chem. Rev. 2014, 114, 2733–2758. [Google Scholar] [CrossRef]
- Goobes, R.; Minsky, A. Thermodynamic Aspects of Triplex DNA Formation in Crowded Environments. J. Am. Chem. Soc. 2001, 123, 12692–12693. [Google Scholar] [CrossRef]
- Avino, A.; Mazzini, S.; Gargallo, R.; Eritja, R. The Effect of Small Cosolutes that Mimic Molecular Crowding Conditions on the Stability of Triplexes Involving Duplex DNA. Int. J. Mol. Sci. 2016, 17, 211. [Google Scholar] [CrossRef]
- Miyoshi, D.; Nakamura, K.; Tateishi-Karimata, H.; Ohmichi, T.; Sugimoto, N. Hydration of Watson–Crick Base Pairs and Dehydration of Hoogsteen Base Pairs Inducing Structural Polymorphism under Molecular Crowding Conditions. J. Am. Chem. Soc. 2009, 131, 3522–3531. [Google Scholar] [CrossRef]
- Pohl, H.R.; Wheeler, J.S.; Murray, H.E. Sodium and Potassium in Health and Disease. Met. Ions Life Sci. 2013, 13, 29–47. [Google Scholar]
- Lane, A.N.; Chaires, J.B.; Gray, R.D.; Trent, J.O. Stability and Kinetics of G-Quadruplex Structures. Nucleic Acids Res. 2008, 36, 5482–5515. [Google Scholar] [CrossRef] [PubMed]
- Malkov, V.A.; Voloshin, O.N.; Soyfer, V.N.; Frank-Kamenetskii, M.D. Cation and Sequence Effects on Stability of Intermolecular pyrimidine-purine-purine triplex. Nucleic Acids Res. 1993, 21, 585–591. [Google Scholar] [CrossRef] [PubMed]
- Tateishi-Karimata, H.; Nakano, M.; Sugimoto, N. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate. Sci. Rep. 2014, 4, 3593. [Google Scholar] [CrossRef] [PubMed]
- Kypr, J.; Kejnovska, I.; Renciuk, D.; Vorlickova, M. Circular Dichroism and Conformational Polymorphism of DNA. Nucleic Acids Res. 2009, 37, 1713–1725. [Google Scholar] [CrossRef]
- Belotserkovskii, B.P.; De Silva, E.; Tornaletti, S.; Wang, G.; Vasquez, K.M.; Hanawalt, P.C. A Triplex-Forming Sequence from the Human c-MYC Promoter Interferes with DNA Transcription. J. Biol. Chem. 2007, 282, 32433–32441. [Google Scholar] [CrossRef]
- Teng, Y.; Tateishi-Karimata, H.; Sugimoto, N. C-Rich Sequence in a Non-Template DNA Strand Regulates Structure Change of G-Quadruplex in a Template Strand during Transcription. Bull. Chem. Soc. Jpn. 2019, 92, 572–577. [Google Scholar] [CrossRef]
- Discovery Studio; Dassault Systèmes BIOVIA: San Diego, CA, USA, 2016.
- Maier, J.A.; Martinez, C.; Kasavajhala, K.; Wickstrom, L.; Hauser, K.E.; Simmerling, C. Ff14SB: Improving the Accuracy of Protein Side Chain and Backbone Parameters from ff99SB. J. Chem. Theory Comput. 2015, 11, 3696–3713. [Google Scholar] [CrossRef]
- Jorgensen, W.L.; Chandrasekhar, J.; Madura, J.D.; Impey, R.W.; Klein, M.L. Comparison of Simple Potential Functions for Simulating Liquid Water. J. Chem. Phys. 1983, 79, 926–935. [Google Scholar] [CrossRef]
- Wang, J.; Wang, W.; Kollman, P.A.; Case, D.A. Automatic Atom Type and Bond Type Perception in Molecular Mechanical Calculations. J. Mol. Graph. Model. 2006, 25, 247–260. [Google Scholar] [CrossRef]
- Case, D.A.; Berryman, J.T.; Betz, R.M.; Cerutti, D.S.; Cheatham, T.E.; Darden, T.A.; Duke, R.E.; Giese, T.J.; Gohlke, H.; Goetz, A.W.; et al. The Amber Biomolecular Simulation Programs; University of California: San Francisco, CA, USA, 2015. [Google Scholar]
- Frisch, M.J.; Trucks, G.W.; Schlegel, H.B.; Scuseria, G.E.; Robb, M.A.; Cheeseman, J.R.; Scalmani, G.; Barone, V.; Mennucci, B.; Petersson, G.A.; et al. Gaussian 09, Revision D.01, Gaussian, Inc.: Wallingford, CT, USA, 2013.
- Sousa da Silva, A.W.; Vranken, W.F. ACPYPE—AnteChamber PYthon parser interfacE. BMC Res. Notes 2012, 5, 367. [Google Scholar] [CrossRef]
- Abraham, M.J.; Murtola, T.; Schulz, R.; Páll, S.; Smith, J.C.; Hess, B.; Lindahl, E. GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX 2015, 1–2, 19–25. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |
Name | Sequences (5′-3′) |
---|---|
Intra-CG2 | TCTTCTTTTTTTTTTTTTTTTTTCTTCTTTTTAGAAGAAAAAAA |
Intra-CG4 | TCTTCTCTTTCTTTTTTCTTTCTCTTCTTTTTAGAAGAGAAAGA |
Intra-CG6 | TCCTCTCTTTCCTTTTCCTTTCTCTCCTTTTTAGGAGAGAAAGG |
Hp-CG2 | TTTTTTTCTTCTTTTTAGAAGAAAAAAA |
T-CG2 | TCTTCTTTTTTT |
Hp-CG4 | TCTTTCTCTTCTTTTTAGAAGAGAAAGA |
T-CG4 | TCTTCTCTTTCT |
Hp-CG6 | CCTTTCTCTCCTTTTTAGGAGAGAAAGG |
T-CG6 | TCCTCTCTTTCC |
Tm (°C) | KCl (M) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
0 | 0.1 | 0.5 | 1.0 | 1.5 | ||||||
H 1 | WC 2 | H 1 | WC 2 | H 1 | WC 2 | H 1 | WC 2 | H 1 | WC 2 | |
Intra-CG2 | 31.5 | 45.9 | 46.5 | 59.5 | 67.5 | 71.1 | 72.1 | |||
Intra-CG4 | 53.1 | 64.1 | 72.0 | 75.1 | 75.0 | |||||
Intra-CG6 | 62.1 | 70.2 | 76.0 | 76.9 | 76.6 | |||||
Hp-CG2+T-CG2 | 14.2 | 59.6 | 20.5 | 65.5 | 30.5 | 72.0 | 36.5 | 74.5 | 40.1 | 74.0 |
Hp-CG4+T-CG4 | 29.7 | 65.2 | 34.0 | 71.5 | 39.5 | 75.5 | 43.0 | 77.1 | 44.1 | 76.3 |
Hp-CG6+T-CG6 | 32.1 | 71.7 | 33.5 | 76.3 | 33.0 | 79.8 | 33.5 | 81.3 | 33.4 | 80.5 |
Tm (°C) | KCl (M) | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
0 | 0.1 | 0.5 | 1.0 | 1.5 | ||||||
H 1 | WC 2 | H 1 | WC 2 | H 1 | WC 2 | H 1 | WC 2 | H 1 | WC 2 | |
Intra-CG2 | 36.7 | 47.3 | 54.7 | 56.2 | 55.5 | |||||
Intra-CG4 | 50.2 | 58.0 | 61.3 | 60.6 | 58.1 | |||||
Intra-CG6 | 60.1 | 65.3 | 66.3 | 64.4 | 60.9 | |||||
Hp-CG2+T-CG2 | 25.5 | 45.6 | 31.8 | 49.3 | 46.7 | 46.8 | 44.5 | |||
Hp-CG4+T-CG4 | 47.8 | 50.0 | 50.6 | 49.1 | 45.2 | |||||
Hp-CG6+T-CG6 | 53.3 | 55.0 | 54.5 | 52.7 | 49.2 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Teng, Y.; Tateishi-Karimata, H.; Ohyama, T.; Sugimoto, N. Effect of Potassium Concentration on Triplex Stability under Molecular Crowding Conditions. Molecules 2020, 25, 387. https://doi.org/10.3390/molecules25020387
Teng Y, Tateishi-Karimata H, Ohyama T, Sugimoto N. Effect of Potassium Concentration on Triplex Stability under Molecular Crowding Conditions. Molecules. 2020; 25(2):387. https://doi.org/10.3390/molecules25020387
Chicago/Turabian StyleTeng, Ye, Hisae Tateishi-Karimata, Tatsuya Ohyama, and Naoki Sugimoto. 2020. "Effect of Potassium Concentration on Triplex Stability under Molecular Crowding Conditions" Molecules 25, no. 2: 387. https://doi.org/10.3390/molecules25020387
APA StyleTeng, Y., Tateishi-Karimata, H., Ohyama, T., & Sugimoto, N. (2020). Effect of Potassium Concentration on Triplex Stability under Molecular Crowding Conditions. Molecules, 25(2), 387. https://doi.org/10.3390/molecules25020387