Guanine Deaminase in Human Epidermal Keratinocytes Contributes to Skin Pigmentation
Abstract
:1. Introduction
2. Results
2.1. Hyperpigmented Skin Lesions of RM are Associated with Increased GDA Expression
2.2. GDA is Highly Expressed in Cultured Human KCs and Upregulated when Treated with an Inflammatory Cytokine Mixture
2.3. Representative Melanogenic Stimuli, UVB Irradiation and SCF/ET-1, are Associated with Increased Expression Level of GDA
2.4. siGDA in KCs Downregulates Melanogenesis While GDA Overexpression Promotes Melanogenesis in the Coculture
2.5. KC GDA Expression is Involved in the Melanogenic Property of UV Treated KC-Conditioned Media
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. Materials
4.3. Next Generation Sequencing (NGS)
4.4. Expression Analysis by qRT-PCR
4.5. Immunofluorescence Staining and Serum Analysis
4.6. Cell Culture and Melanin Content Assay
4.7. Knockdown and Ectopic Expression of GDA
4.8. UVB Radiation and Preparation of KC-Conditioned Media
4.9. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Yuan, X.H.; Jin, Z.H. Paracrine regulation of melanogenesis. Br. J. Dermatol. 2018, 178, 632–639. [Google Scholar] [CrossRef] [PubMed]
- Imokawa, G.; Yada, Y.; Miyagishi, M. Endothelins secreted from human keratinocytes are intrinsic mitogens for human melanocytes. J. Biol. Chem. 1992, 267, 24675–24680. [Google Scholar]
- Hachiya, A.; Kobayashi, A.; Ohuchi, A.; Takema, Y.; Imokawa, G. The paracrine role of stem cell factor/c-kit signaling in the activation of human melanocytes in ultraviolet-B-induced pigmentation. J. Investig. Dermatol. 2001, 116, 578–586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duval, C.; Cohen, C.; Chagnoleau, C.; Flouret, V.; Bourreau, E.; Bernerd, F. Key regulatory role of dermal fibroblasts in pigmentation as demonstrated using a reconstructed skin model: Impact of photo-aging. PLoS ONE 2014, 9, e114182. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Viennet, C.; Robin, S.; Berthon, J.Y.; He, L.; Humbert, P. Precise role of dermal fibroblasts on melanocyte pigmentation. J. Dermatol. Sci. 2017, 88, 159–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salducci, M.; Andre, N.; Guere, C.; Martin, M.; Fitoussi, R.; Vie, K.; Cario-Andre, M. Factors secreted by irradiated aged fibroblasts induce solar lentigo in pigmented reconstructed epidermis. Pigment Cell Melanoma Res. 2014, 27, 502–504. [Google Scholar] [CrossRef]
- Rousseau, K.; Kauser, S.; Pritchard, L.E.; Warhurst, A.; Oliver, R.L.; Slominski, A.; Wei, E.T.; Thody, A.J.; Tobin, D.J.; White, A. Proopiomelanocortin (POMC), the ACTH/melanocortin precursor, is secreted by human epidermal keratinocytes and melanocytes and stimulates melanogenesis. FASEB J. 2007, 21, 1844–1856. [Google Scholar] [CrossRef] [Green Version]
- Busca, R.; Ballotti, R. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res. 2000, 13, 60–69. [Google Scholar] [CrossRef]
- Vachtenheim, J.; Borovanský, J. “Transcription physiology” of pigment formation in melanocytes: Central role of MITF. Exp. Dermatol. 2010, 19, 617–627. [Google Scholar] [CrossRef] [PubMed]
- Del Marmol, V.; Beermann, F. Tyrosinase and related proteins in mammalian pigmentation. FEBS Lett. 1996, 381, 165–168. [Google Scholar] [CrossRef]
- Hattori, H.; Kawashima, M.; Ichikawa, Y.; Imokawa, G. The epidermal stem cell factor is over-expressed in lentigo senilis: Implication for the mechanism of hyperpigmentation. J. Investig. Dermatol. 2004, 122, 1256–1265. [Google Scholar] [CrossRef] [Green Version]
- Imokawa, G.; Kobayashi, T.; Miyagishi, M.; Higashi, K.; Yada, Y. The role of endothelin-1 in epidermal hyperpigmentation and signaling mechanisms of mitogenesis and melanogenesis. Pigment Cell Res. 1997, 10, 218–228. [Google Scholar] [CrossRef] [PubMed]
- Kasamatsu, S.; Hachiya, A.; Higuchi, K.; Ohuchi, A.; Kitahara, T.; Boissy, R.E. Production of the soluble form of KIT, s-KIT, abolishes stem cell factor-induced melanogenesis in human melanocytes. J. Investig. Dermatol. 2008, 128, 1763–1772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noh, T.K.; Choi, S.J.; Chung, B.Y.; Kang, J.S.; Lee, J.H.; Lee, M.W.; Chang, S.E. Inflammatory features of melasma lesions in Asian skin. J. Dermatol. 2014, 41, 788–794. [Google Scholar] [CrossRef] [PubMed]
- Chung, B.Y.; Kim, J.E.; Ko, J.Y.; Chang, S.E. A pilot study of a novel dual--pulsed 1064 nm Q-switched Nd: YAG laser to treat Riehl’s melanosis. J. Cosmet. Laser Ther. 2014, 16, 290–292. [Google Scholar] [CrossRef] [PubMed]
- Moon, I.J.; Bang, S.H.; Song, Y.; Chang, S.E. Transient receptor potential vanilloid 1 (TRPV1) inhibition is related to the suppression of inflammation-associated hypermelanosis. J. Dermatol. Sci. 2020, 98, 65–68. [Google Scholar] [CrossRef]
- Chung, B.Y.; Noh, T.K.; Yang, S.H.; Kim, I.H.; Lee, M.W.; Yoon, T.J.; Chang, S.E. Gene expression profiling in melasma in Korean women. Dermatology 2014, 229, 333–342. [Google Scholar] [CrossRef]
- Cheong, K.A.; Ai-Young, L. Guanine Deaminase Stimulates Ultraviolet-induced Keratinocyte Senescence in Seborrhoeic Keratosis via Guanine Metabolites. Acta Derm. Venereol. 2020, 100, 1–10. [Google Scholar] [CrossRef]
- Firestein, B.L.; Firestein, B.L.; Brenman, J.E.; Aoki, C.; Sanchez-Perez, A.M.; El-Husseini, A.E.; Bredt, D.S. Cypin: A cytosolic regulator of PSD-95 postsynaptic targeting. Neuron 1999, 24, 659–672. [Google Scholar] [CrossRef] [Green Version]
- Paletzki, R.F. Cloning and characterization of guanine deaminase from mouse and rat brain. Neuroscience 2002, 109, 15–26. [Google Scholar] [CrossRef]
- Gupta, N.K.; Glantz, M.D. Isolation and characterization of human liver guanine deaminase. Arch. Biochem. Biophys. 1985, 236, 266–276. [Google Scholar] [CrossRef]
- Durak, I.; Beduk, Y.; Kavutcu, M.; Suzer, O.; Yaman, O.; Ozturk, H.S.; Canbolat, O.; Ulutepe, S. Activity of the enzymes participating in purine metabolism of cancerous and noncancerous human kidney tissues. Cancer Investig. 1997, 15, 212–216. [Google Scholar] [CrossRef] [PubMed]
- Mohamedali, K.A.; Guicherit, O.M.; Kellems, R.E.; Rudolph, F.B. The highest levels of purine catabolic enzymes in mice are present in the proximal small intestine. J. Biol. Chem. 1993, 268, 23728–23733. [Google Scholar] [PubMed]
- Mansoor, M.; Kalyankar, G.D.; Talwar, G.P. Brain guanine deaminase: Purification, properties and regional distribution. Biochim. Biophys. Acta 1963, 77, 307–317. [Google Scholar] [CrossRef]
- Ito, S.; Xu, Y.H.; Keyser, A.J.; Peters, R.L. Histochemical-demonstration of guanase in human-liver with guanine in bicine buffer as substrate. Histochem. J. 1984, 16, 489–499. [Google Scholar] [CrossRef]
- Akum, B.F.; Chen, M.; Gunderson, S.I.; Riefler, G.M.; Scerri-Hansen, M.M.; Firestein, B.L. Cypin regulates dendrite patterning in hippocampal neurons by promoting microtubule assembly. Nat. Neurosci. 2004, 7, 145–152. [Google Scholar] [CrossRef]
- Chen, M.; Lucas, K.G.; Akum, B.F.; Balasingam, G.; Stawicki, T.M.; Provost, J.M.; Riefler, G.M.; Jornsten, R.J.; Firestein, B.L. A novel role for snapin in dendrite patterning: Interaction with cypin. Mol. Biol. Cell 2005, 16, 5103–5114. [Google Scholar] [CrossRef]
- Chen, H.; Firestein, B.L. RhoA regulates dendrite branching in hippocampal neurons by decreasing cypin protein levels. J. Neurosci. 2007, 27, 8378–8386. [Google Scholar] [CrossRef] [Green Version]
- Opdecamp, K.; Nakayama, A.; Nguyen, M.T.; Hodgkinson, C.A.; Pavan, W.J.; Arnheiter, H. Melanocyte development in vivo and in neural crest cell cultures: Crucial dependence on the Mitf basic-helix-loop-helix-zipper transcription factor. Development 1997, 124, 2377–2386. [Google Scholar]
- Kizaki, H.; Matsuo, I.; Sakurada, T. Xanthine oxidase and guanase activities in normal and psoriatic epidermis. Clin. Chim. Acta 1977, 75, 1–4. [Google Scholar] [CrossRef]
- Schretlen, D.J.; Harris, J.C.; Park, K.S.; Jinnah, H.A.; del Pozo, N.O. Neurocognitive functioning in Lesch-Nyhan disease and partial hypoxanthine-guanine phosphoribosyltransferase deficiency. J. Int. Neuropsychol. Soc. 2001, 7, 805–812. [Google Scholar] [CrossRef] [PubMed]
- Alonso-Gonzalez, J.; Hernandez-Martin, A.; Garcia-Penas, J.J.; Colmenero, I.; Torrelo, A. Reticulated pigmentary changes in a patient with a variant form of Lesch-Nyhan disease. Clin. Exp. Dermatol. 2012, 37, 569–570. [Google Scholar] [CrossRef] [PubMed]
- Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [Green Version]
- Ghosh, S.; Hayden, M.S. New regulators of NF-κB in inflammation. Nat. Rev. Immunol. 2008, 8, 837–848. [Google Scholar] [CrossRef]
- Kulms, D.; Schwarz, T. NF-κB and Cytokines. Vitam. Horm. 2006, 74, 283–300. [Google Scholar]
- Enomoto, A.; Yoshihisa, Y.; Yamakoshi, T.; Rehman, M.U.; Norisugi, O.; Hara, H.; Matsunaga, K.; Makino, T.; Nishihira, J.; Shimizu, T. UV-B radiation induces macrophage migration inhibitory factor-mediated melanogenesis through activation of protease-activated receptor-2 and stem cell factor in keratinocytes. Am. J. Pathol. 2011, 178, 679–687. [Google Scholar] [CrossRef]
- Halaban, R.; Langdon, R.; Birchall, N.; Cuono, C.; Baird, A.; Scott, G.; Moellmann, G.; Mcguire, J. Basic fibroblast growth-factor from human keratinocytes is a natural mitogen for melanocytes. J. Cell Biol. 1988, 107, 1611–1619. [Google Scholar] [CrossRef]
- Tagashira, H.; Miyamoto, A.; Kitamura, S.; Tsubata, M.; Yamaguchi, K.; Takagaki, K.; Imokawa, G. UVB stimulates the expression of endothelin B receptor in human melanocytes via a sequential activation of the p38/MSK1/CREB/MITF pathway which can be interrupted by a french maritime pine bark extract through a direct inactivation of MSK1. PLoS ONE 2015, 10, e0128678. [Google Scholar] [CrossRef] [Green Version]
- Scott, G.; Jacobs, S.; Leopardi, S.; Anthony, F.A.; Learn, D.; Malaviya, R.; Pentland, A. Effects of PGF2alpha on human melanocytes and regulation of the FP receptor by ultraviolet radiation. Exp. Cell Res. 2005, 304, 407–416. [Google Scholar] [CrossRef]
- Hachiya, A.; Kobayashi, A.; Yoshida, Y.; Kitahara, T.; Takema, Y.; Imokawa, G. Biphasic expression of two paracrine melanogenic cytokines, stem cell factor and endothelin-1, in ultraviolet B-induced human melanogenesis. Am. J. Pathol. 2004, 165, 2099–2109. [Google Scholar] [CrossRef] [Green Version]
- Kadono, S.; Manaka, I.; Kawashima, M.; Kobayashi, T.; Imokawa, G. The role of the epidermal endothelin cascade in the hyperpigmentation mechanism of lentigo senilis. J. Investig. Dermatol. 2001, 116, 571–577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dissanayake, N.S.; Mason, R.S. Modulation of skin cell functions by transforming growth factor-beta1 and ACTH after ultraviolet irradiation. J. Endocrinol. 1998, 159, 153–163. [Google Scholar] [CrossRef] [Green Version]
- Romero-Graillet, C.; Aberdam, E.; Clement, M.; Ortonne, J.P.; Ballotti, R. Nitric oxide produced by ultraviolet-irradiated keratinocytes stimulates melanogenesis. J. Clin. Investig. 1997, 99, 635–642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bonamonte, D.; Foti, C.; Vestita, M.; Angelini, G. Noneczematous contact dermatitis. ISRN Allergy 2013, 2013, 361746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Sample Availability: Samples of the compounds are available from the authors. |
Patient | Sex | Age | Normalized GDA Gene Expression in Non-Lesion | Normalized GDA Gene Expression in Lesion | Fold Change | p-Value |
---|---|---|---|---|---|---|
1 | Female | 59 | 0.001 | 1.283 | 1283.4 | <0.001 |
2 | Female | 72 | 0.432 | 1.616 | 3.7 | 0.109 |
3 | Female | 59 | 0.325 | 8.577 | 26.4 | 0.002 |
Name | Forward (5′ to 3′) | Reverse (5′ to 3′) |
---|---|---|
GDA | GCAACAATTCACACTGACTCATC | GTGTCACTATGGGCTTCACTC |
RELA | ATGTGGAGATCATTGAGCAGC | CCTGGTCCTGTGTAGCCATT |
SCF | AATCCTCTCGTCAAAACTGAAGG | CCATCTCGCTTATCCAACAATGA |
ET-1 | AAGGCAACAGACCGTGAAAAT | CGACCTGGTTTGTCTTAGGTG |
RPLP0 | GGCGACCTGGAAGTCCAACT | CCATCAGCACCACAGCCTTC |
Day | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
---|---|---|---|---|---|---|---|---|
Protocol | MCs seeding | KCs seeding | siRNA transfection for 24 h | Media change | Media change | Harvest |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jung, J.M.; Noh, T.K.; Jo, S.Y.; Kim, S.Y.; Song, Y.; Kim, Y.-H.; Chang, S.E. Guanine Deaminase in Human Epidermal Keratinocytes Contributes to Skin Pigmentation. Molecules 2020, 25, 2637. https://doi.org/10.3390/molecules25112637
Jung JM, Noh TK, Jo SY, Kim SY, Song Y, Kim Y-H, Chang SE. Guanine Deaminase in Human Epidermal Keratinocytes Contributes to Skin Pigmentation. Molecules. 2020; 25(11):2637. https://doi.org/10.3390/molecules25112637
Chicago/Turabian StyleJung, Joon Min, Tai Kyung Noh, Soo Youn Jo, Su Yeon Kim, Youngsup Song, Young-Hoon Kim, and Sung Eun Chang. 2020. "Guanine Deaminase in Human Epidermal Keratinocytes Contributes to Skin Pigmentation" Molecules 25, no. 11: 2637. https://doi.org/10.3390/molecules25112637