In Vitro Anti-Inflammatory Effects of Phenolic Compounds from Moraiolo Virgin Olive Oil (MVOO) in Brain Cells via Regulating the TLR4/NLRP3 Axis
Abstract
:1. Introduction
2. Results
2.1. Phenolic Compounds from Moraiolo Olive Oil Protect Against LPS-Treated BV-2 Cells
2.2. MVOO-PE Abolished Proinflammatory Cytokine Release and Inhibited the Activation of Inflammatory Mediators Induced by LPS Treatment
2.3. MVOO-PE Attenuated the TLR4 and NLRP3 Signaling Activation in LPS-Stimulated Microglial Cells
2.4. MVOO-PE Prevented Neuronal Damage Induced by LPS Treatment
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Extraction of Virgin Olive Oil Phenolic Extracts (VOO-PE)
4.3. VOO-PE HPLC Analysis
4.4. Cell Cultures
4.5. Experimental Design
4.6. Preparation of Conditioned Media
4.7. Co-Culture of Neurons and Microglia
4.8. MTT Assay
4.9. Real-Time PCR (RT-PCR)
4.10. Western BLOT Analysis
4.11. Measurement of Cytokine Levels
4.12. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gage, F.H. Neurogenesis in the adult brain. J. Neurosci. 2002, 22, 612–613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kierdorf, K.; Prinz, P. Microglia in steady state. J. Clin. Invest. 2017, 127, 3201–3209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, Y.S.; Joh, T.H. Microglia, major player in the brain inflammation: Their roles in the pathogenesis of Parkinson’s disease. Exp. Mol. Med. 2006, 38, 333–347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nimmerjahn, A.; Kirchhoff, F.; Helmchen, F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 2005, 308, 1314–1318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dubbelaar, M.L.; Kracht, L.; Eggen, B.J.L.; Boddeke, E.W.G.M. The Kaleidoscope of Microglial Phenotypes. Front Immunol. 2018, 9, 1753. [Google Scholar] [CrossRef]
- Ransohoff, R.M. A polarizing question: Do M1 and M2 microglia exist? Nat. Neurosci. 2016, 19, 987–991. [Google Scholar] [CrossRef]
- Di Sabato, D.; Quan, N.; Godbout, J.P. Neuroinflammation: The Devil is in the Details. J Neurochem. 2016, 139, 136–153. [Google Scholar] [CrossRef] [Green Version]
- Dai, X.J.; Li, N.; Yu, L.; Chen, Z.Y.; Hua, R.; Qin, X.; Zhang, Y.M. Activation of BV2 microglia by lipopolysaccharide triggers an inflammatory reaction in PC12 cell apoptosis through a toll-like receptor 4-dependent pathway. Cell Stress Chaperones. 2015, 20, 321–331. [Google Scholar] [CrossRef] [Green Version]
- Schaefer, L. Complexity of Danger: The Diverse Nature of Damage-associated Molecular Patterns. J. Biol. Chem. 2014, 19, 35237–35245. [Google Scholar] [CrossRef] [Green Version]
- Gugliandolo, A.; Giacoppo, S.; Bramanti, P.; Mazzon, E. NLRP3 inflammasome activation in a transgenic amyotrophic lateral sclerosis model. Inflammation 2018, 41, 93–103. [Google Scholar] [CrossRef]
- Zhou, K.; Shi, L.; Wang, Y.; Chen, S.; Zhang, J. Recent advances of the NLRP3 inflammasome in central nervous system disorder. J. Immunol. Res. 2016, 9238290. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Callaway, J.B.; Ting, J.P.Y. Inflammasomes: Mechanism of Action, Role in Disease, and Therapeutics. Nat. Med. 2015, 21, 677–687. [Google Scholar] [CrossRef] [Green Version]
- Tresserra-Rimbau, A.; Rimm, E.B.; Medina-Remón, A.; Martínez-González, M.A.; de la Torre, R.; Corella, D.; Salas-Salvadó, J.; Gómez-Gracia, E.; Lapetra, J.; Arós, F.; et al. Inverse association between habitual polyphenol intake and incidence of cardiovascular events in the PREDIMED study. Nutr. Metab. Cardiovasc. Dis. 2014, 24, 639–647. [Google Scholar] [CrossRef] [PubMed]
- Tresserra-Rimbau, A.; Guasch-Ferré, M.; Salas-Salvadó, J.; Toledo, E.; Corella, D.; Castañer, O.; Guo, X.; Gómez-Gracia, E.; Lapetra, J.; Aròs, F.; et al. Intake of total polyphenols and some classes of polyphenols is inversely associated with diabetes in elderly people at high cardiovascular disease risk. J. Nutr. 2016, 146, 767–777. [Google Scholar] [CrossRef] [Green Version]
- Tangney, C.C.; Rasmussen, H.E. Polyphenols, inflammation, and cardiovascular disease. Curr. Atheroscler. Rep. 2013, 15, 324–340. [Google Scholar] [CrossRef] [PubMed]
- Granados-Pricipal, S.; Quiles, J.L.; Ramirez-Tortosa, C.L.; Sanchez-Rovira, P.; Ramirez-Tortosa, M.C. Hydroxytyrosol: From laboratory investigations to future clinical trials. Nutr. Rev. 2010, 68, 191–206. [Google Scholar] [CrossRef] [Green Version]
- Gong, D.; Geng, C.; Jiang, L.; Cao, J.; Yoshimura, H.; Zhong, L. Effects of hydroxytyrosol-20 on carrageenan-induced acute inflammation and hyperalgesia in rats. Phytother. Res. 2009, 23, 646–650. [Google Scholar] [CrossRef]
- Fabiani, R.; De Bartolomeo, A.; Rosignoli, P.; Servili, M.; Montedoro, G.F.; Morozzi, G. Cancer chemoprevention by hydroxytyrosol isolated from virgin olive oil through G1 cell cycle arrest and apoptosis. Eur. J. Cancer Prev. 2002, 11, 351–358. [Google Scholar] [CrossRef]
- Gárate, I.; García-Bueno, B.; Madrigal, J.L.; Caso, J.R.; Alou, L.; Gómez-Lus, M.L.; Leza, J.C. Toll-like 4 receptor inhibitor TAK-242 decreases neuroinflammation in rat brain frontal cortex after stress. J. Neuroinflamm. 2014, 11, 8. [Google Scholar] [CrossRef] [Green Version]
- Angeloni, C.; Malaguti, M.; Barbalace, M.C.; Hrelia, S. Bioactivity of Olive Oil Phenols in Neuroprotection. Int. J. Mol. Sci. 2017, 18, 2230. [Google Scholar] [CrossRef] [Green Version]
- Turner, R.; Etienne, N.; Alonso, M.; de Pascual-Teresa, S.; Minihane, A.M.; Weinberg, P.D.; Rimbach, G. Antioxidant and anti-atherogenic activities of olive oil phenolics. Int. J. Vitam. Nutr. Res. 2005, 75, 61–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Figueira, I.; Garcia, G.; Pimpão, R.C.; Terrasso, A.P.; Costa, I.; Almeida, A.F.; Tavares, L.; Pais, T.F.; Pinto, P.; Ventura, M.R.; et al. Polyphenols journey through blood-brain barrier towards neuronal protection. Sci. Rep. 2017, 7, 11456. [Google Scholar] [CrossRef] [PubMed]
- Vauzour, D. Dietary polyphenols as modulators of brain functions: Biological actions and molecular mechanisms underpinning their beneficial effects. Oxid. Med. Cell Longev. 2012, 2012, 914273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sarubbo, F.; Moranta, D.; Asensio, V.J.; Miralles, A.; Esteban, S. Effects of Resveratrol and Other Polyphenols on the Most Common Brain Age-Related Diseases. Curr. Med. Chem. 2017, 24, 4245–4266. [Google Scholar] [CrossRef]
- López de las Hazasa, M.C.; Godinho-Pereira, J.; Macià, A.; Almeida, A.F.; Ventura, M.R.; Motilva, M.J.; Santos, C.N. Brain uptake of hydroxytyrosol and its main circulating metabolites: Protective potential in neuronal cells. J. Funct. Foods 2018, 46, 110–117. [Google Scholar] [CrossRef]
- Amirante, P.; Clodoveo, M.L.; Tamborrino, A.; Leone, A.; Paice, A.G. Chapter 8—Influence of the Crushing System: Phenol Content in Virgin Olive Oil Produced from Whole and De-stoned Pastes. In Olives and Olive Oil in Health and Disease Prevention; Academic Press: New York, NY, USA, 2010; pp. 69–76. [Google Scholar]
- Beauchamp, G.K.; Keast, R.S.J.; Morel, D.; Lin, J.; Pika, J.; Han, Q.; Lee, C.-H.; Smith, A.B.; Breslin, P.A.S. Ibuprofen-like activity in extra-virgin olive oil. Nature 2005, 437. [Google Scholar] [CrossRef]
- Abuznait, A.H.; Qosa, H.; Busnena, B.A.; El Sayed, K.A.; Kaddoumi, A. Olive-oil-derived oleocanthal enhances -amyloid clearance as a potential neuroprotective mechanism against Alzheimer’s disease: In vitro and in vivo studies. ACS Chem. Neurosci. 2013, 4, 973–982. [Google Scholar] [CrossRef] [Green Version]
- Castañer, O.; Covas, M.I.; Khymenets, O.; Nyyssonen, K.; Konstantinidou, V.; Zunft, H.F.; de la Torre, R.; Muñoz-Aguayo, D.; Vila, J.; Fitó, M. Protection of LDL from oxidation by olive oil polyphenols is associated with a downregulation of CD40-ligand expression and its downstream products in vivo in humans. Am. J. Clin. Nutr. 2012, 95, 1238–1244. [Google Scholar] [CrossRef] [Green Version]
- Streit, W.J.; Graeber, M.B.; Kreutzberg, G.W. Functional plasticity of microglia: A review. Glia 1988, 1, 301–307. [Google Scholar] [CrossRef]
- Khare, S.; Dorfleutner, A.; Bryan, N.B.; Yun, C.; Radian, A.D.; de Almeida, L.; Rojanasakul, Y.; Stehlik, C. An NLRP7-containing inflammasome mediates recognition of microbial lipopeptides in human macrophages. Immunity 2012, 36, 464–476. [Google Scholar] [CrossRef] [Green Version]
- Montedoro, G.F.; Servili, M.; Baldioli, M.; Selvaggini, R.; Miniati, E.; Macchioni, A. Simple and hydrolyzable compounds in virgin olive oil. 3. Spectroscopic characterizations of the secoiridoid derivatives. J. Agric. Food Chem. 1993, 41, 2228–2234. [Google Scholar] [CrossRef]
- Servili, M.; Baldioli, M.; Selvaggini, R.; Macchioni, A.; Montedoro, G.F. Phenolic compounds of olive fruit: One- and two-dimensional nuclear magnetic resonance characterization of nüzhenide and its distribution in the constitutive parts of fruit. J. Agr. Food Chem. 1999, 47, 12–18. [Google Scholar] [CrossRef] [PubMed]
- Montedoro, G.F.; Servili, M.; Baldioli, M.; Miniati, E. Simple and hydrolyzable compounds in virgin olive oil. 1. Their extraction, separation and quantitative and semiquantitative evaluation by HPLC. J. Agric. Food Chem. 1992, 40, 1571–1576. [Google Scholar] [CrossRef]
- Selvaggini, R.; Servili, M.; Urbani, S.; Esposto, S.; Taticchi, A.; Montedoro, G.F. Evaluation of phenolic compounds in virgin olive oil by direct injection in high-performance liquid chromatography with fluorometric detection. J. Agr. Food Chem. 2006, 54, 2832–2838. [Google Scholar] [CrossRef] [PubMed]
- Baroni, T.; Bodo, M.; D’Alessandro, A.; Conte, C.; Calvitti, M.; Muzi, G.; Lumare, A.; Bellocchio, S.; Abbritti, G. Silica and its antagonistic effects on transforming growth factor-β in lung fibroblast extracellular matrix production. J. Investig. Med. 2001, 49, 146–156. [Google Scholar] [CrossRef] [PubMed]
- Minelli, A.; Conte, C.; Cacciatore, I.; Cornacchia, C.; Pinnen, F. Molecular mechanism underlying the cerebral effect of Gly-Pro-Glu tripeptide bound to L-dopa in a Parkinson’s animal model. Amino Acids. 2012, 43, 1359–1367. [Google Scholar] [CrossRef]
- Mariucci, G.; Pagiotti, R.; Galli, F.; Romani, L.; Conte, C. The Potential Role of Toll-Like Receptor 4 in Mediating Dopaminergic Cell Loss and Alpha-Synuclein Expression in the Acute MPTP Mouse Model of Parkinson’s Disease. J. Mol. Neurosci. 2018, 64, 611–618. [Google Scholar] [CrossRef]
- Conte, C.; Arcuri, A.; Cataldi, S.; Mecca, C.; Codini, M.; Ceccarini, M.R.; Patria, F.F.; Beccari, T.; Albi, E. Niemann-Pick Type A Disease: Behavior of Neutral Sphingomyelinase and Vitamin D Receptor. Int. J. Mol. Sci. 2019, 20, 2365. [Google Scholar] [CrossRef] [Green Version]
- Albi, E.; Cataldi, S.; Codini, M.; Mariucci, G.; Lazzarini, A.; Ceccarini, M.R.; Ferri, I.; Laurenti, M.E.; Arcuri, A.; Patria, F.; et al. Neutral sphingomyelinase increases and delocalizes in the absence of Toll-Like Receptor 4: A new insight for MPTP neurotoxicity. Prost. Other Lipid Mediat. 2019, 142, 46–52. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |
Phenolic Compounds (mg/g) | |
---|---|
3,4-DHPEA-EDA | 359.3 ± 11.3 |
3,4-DHPEA-EA | 189.0 ± 3.3 |
p-HPEA-EDA | 107.5 ± 0.4 |
(+)-1-Acetoxypinoresinol | 35.8 ± 0.1 |
Ligstroside aglycone | 17.7 ± 0.4 |
3,4-DHPEA | 15.2 ± 0.1 |
(+)-Pinoresinol | 8.7 ± 0.1 |
p-HPEA | 4.3 ± 0.001 |
Total polyphenols | 737.5 ± 11.8 |
Accession Number | Gene Symbol | Primer Sequences (F: Forward; R: Reverse) |
NM_007393 | β-act | F. AGA GGG AAA TCG TGC GTG AC R. CAA TAG TGA TGA CCT GGC CGT |
NM_019467 | Iba1 | F. GGATTTGCAGGGAGGAAAAG R. TGGGATCATCGAGGAATTG |
NM_008361 | IL-1β | F. AAGGAGAACCAAGCAACGACAAAA R. TGGGGAACTCTGCAGACTCAAACT |
NM_145827 | NLRP3 | F. AAAATGCCTTGGGAGACTCA R. AAGTAAGGCCGGAATTCACC |
NM_021297 | TLR4 | F. TTCACCTCTGCCTTCACTAC R. CACTACCACAATAACCTTCCG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Taticchi, A.; Urbani, S.; Albi, E.; Servili, M.; Codini, M.; Traina, G.; Balloni, S.; Patria, F.F.; Perioli, L.; Beccari, T.; et al. In Vitro Anti-Inflammatory Effects of Phenolic Compounds from Moraiolo Virgin Olive Oil (MVOO) in Brain Cells via Regulating the TLR4/NLRP3 Axis. Molecules 2019, 24, 4523. https://doi.org/10.3390/molecules24244523
Taticchi A, Urbani S, Albi E, Servili M, Codini M, Traina G, Balloni S, Patria FF, Perioli L, Beccari T, et al. In Vitro Anti-Inflammatory Effects of Phenolic Compounds from Moraiolo Virgin Olive Oil (MVOO) in Brain Cells via Regulating the TLR4/NLRP3 Axis. Molecules. 2019; 24(24):4523. https://doi.org/10.3390/molecules24244523
Chicago/Turabian StyleTaticchi, Agnese, Stefania Urbani, Elisabetta Albi, Maurizio Servili, Michela Codini, Giovanna Traina, Stefania Balloni, Federica Filomena Patria, Luana Perioli, Tommaso Beccari, and et al. 2019. "In Vitro Anti-Inflammatory Effects of Phenolic Compounds from Moraiolo Virgin Olive Oil (MVOO) in Brain Cells via Regulating the TLR4/NLRP3 Axis" Molecules 24, no. 24: 4523. https://doi.org/10.3390/molecules24244523
APA StyleTaticchi, A., Urbani, S., Albi, E., Servili, M., Codini, M., Traina, G., Balloni, S., Patria, F. F., Perioli, L., Beccari, T., & Conte, C. (2019). In Vitro Anti-Inflammatory Effects of Phenolic Compounds from Moraiolo Virgin Olive Oil (MVOO) in Brain Cells via Regulating the TLR4/NLRP3 Axis. Molecules, 24(24), 4523. https://doi.org/10.3390/molecules24244523