Determination of Chlortetracycline Residues, Antimicrobial Activity and Presence of Resistance Genes in Droppings of Experimentally Treated Broiler Chickens
Abstract
:1. Introduction
2. Results
2.1. In-House Validation of the Analytical Methodology
2.2. Depletion of CTC and 4-epi-CTC in Droppings from Broiler Chickens Treated with Tetracyclines
2.3. Evaluation of Antimicrobial Activity of CTC Residues Present in Chicken Broiler Droppings
2.4. Detection of Resistance Genes
2.5. Phenotypic Susceptibility to Tetracyclines
3. Discussion
4. Materials and Methods
4.1. Experimental Animals
4.2. Collection of Samples
4.3. Quantification of CTC and 4-epi-CTC in Droppings
4.3.1. Reagents and Equipment
4.3.2. Sample Preparation, Extraction and Clean-Up
4.3.3. Instrumental Analysis
4.4. Determination of Antimicrobial Activity
4.4.1. Preparation of Culture Media
4.4.2. Extraction of Antimicrobials from Samples and Preparation of Plates for Growth Inhibition Assessment
4.5. Detection of Genes Conferring Resistance to Tetracyclines
4.6. Determination of Susceptibility to Tetracyclines in Isolates of E. coli Bacteria
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Tasho, R.P.; Cho, J.Y. Veterinary antibiotics in animal waste, its distribution in soil and uptake by plants: A review. Sci. Total Environ. 2016, 563–564, 366–376. [Google Scholar] [CrossRef] [PubMed]
- European Parliament and the Council of the European Union No 1831/2003 of the European Parliament and of the Council of 22 September 2003 on additives for use in animal nutrition. Off. J. Eur. Union 2003, 268, 29–43.
- Jeong, J.; Song, W.; Cooper, W.J.; Jung, J.; Greaves, J. Degradation of tetracycline antibiotics: Mechanisms and kinetic studies for advanced oxidation/reduction processes. Chemosphere 2010, 78, 533–540. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.-R.; Owens, G.; Kwon, S.-I.; So, K.-H.; Lee, D.-B.; Ok, Y.S. Occurrence and environmental fate of veterinary antibiotics in the terrestrial environment. Water Air Soil Pollut. 2011, 214, 163–174. [Google Scholar] [CrossRef]
- Del Castillo, J.R.E. Tetracyclines. In Antimicrobial Therapy in Veterinary Medicine; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2013; pp. 257–268. ISBN 978-1-118-67501-4. [Google Scholar]
- Fairchild, A.S.; Smith, J.L.; Idris, U.; Lu, J.; Sanchez, S.; Purvis, L.B.; Hofacre, C.; Lee, M.D. Effects of Orally Administered Tetracycline on the Intestinal Community Structure of Chickens and on tet Determinant Carriage by Commensal Bacteria and Campylobacter jejuni. Appl. Environ. Microbiol. 2005, 71, 5865–5872. [Google Scholar] [CrossRef] [PubMed]
- Jacob, J. Antibiotics Approved for Use in Conventional Poultry Production. Available online: http://articles.extension.org/pages/66981/antibiotics-approved-for-use-in-conventional-poultry-production (accessed on 9 March 2018).
- Landoni, M.; Albarellos, G. The use of antimicrobial agents in broiler chickens. Vet. J. 2015, 205, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Massé, D.I.; Saady, N.M.C.; Gilbert, Y. Potential of biological processes to eliminate antibiotics in livestock manure: An overview. Animals 2014, 4, 146–163. [Google Scholar] [CrossRef] [PubMed]
- Daghrir, R.; Drogui, P. Tetracycline antibiotics in the environment: A review. Environ. Chem. Lett. 2013, 11, 209–227. [Google Scholar] [CrossRef]
- Martínez-Carballo, E.; González-Barreiro, C.; Scharf, S.; Gans, O. Environmental monitoring study of selected veterinary antibiotics in animal manure and soils in Austria. Environ. Pollut. 2007, 148, 570–579. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, X.; Li, W.; Lu, X.; Liu, B.; Wang, J. The residues and environmental risks of multiple veterinary antibiotics in animal faeces. Environ. Monit. Assess. 2013, 185, 2211–2220. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Wan, W.; Mao, D.; Wang, C.; Mu, Q.; Qin, S.; Luo, Y. Occurrence and distribution of sulfonamides, tetracyclines, quinolones, macrolides, and nitrofurans in livestock manure and amended soils of Northern China. Environ. Sci. Pollut. Res. 2015, 22, 4545–4554. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Luo, Y.; Wu, L.; Huang, Y.; Christie, P. Residues and potential ecological risks of veterinary antibiotics in manures and composts associated with protected vegetable farming. Environ. Sci. Pollut. Res. 2015, 22, 5908–5918. [Google Scholar] [CrossRef] [PubMed]
- Carballo, M.; Aguayo, S.; González, M.; Esperon, F.; de la Torre, A. Environmental Assessment of Tetracycline’s Residues Detected in Pig Slurry and Poultry Manure. J. Environ. Prot. 2016, 7, 82–92. [Google Scholar] [CrossRef]
- Van Epps, A.; Blaney, L. Antibiotic Residues in Animal Waste: Occurrence and Degradation in Conventional Agricultural Waste Management Practices. Curr. Pollut. Rep. 2016, 2, 135–155. [Google Scholar] [CrossRef]
- Eisner, H.; Wulf, R. The metabolic fate of chlortetracycline and some comparisons with other tetracyclines. J. Pharmacol. Exp. Ther. 1963, 142, 122–131. [Google Scholar] [PubMed]
- Sarmah, A.K.; Meyer, M.T.; Boxall, A.B. A global perspective on the use, sales, exposure pathways, occurrence, fate and effects of veterinary antibiotics (VAs) in the environment. Chemosphere 2006, 65, 725–759. [Google Scholar] [CrossRef] [PubMed]
- Chan, K.; Van Zwieten, L.; Meszaros, I.; Downie, A.; Joseph, S. Using poultry litter biochars as soil amendments. Aust. J. Soil Res. 2008, 46, 437–444. [Google Scholar] [CrossRef]
- Furtula, V.; Farrell, E.G.; Diarrassouba, F.; Rempel, H.; Pritchard, J.; Diarra, M.S. Veterinary pharmaceuticals and antibiotic resistance of Escherichia coli isolates in poultry litter from commercial farms and controlled feeding trials. Poult. Sci. 2010, 89, 180–188. [Google Scholar] [CrossRef] [PubMed]
- Leal, R.M.P.; Figueira, R.F.; Tornisielo, V.L.; Regitano, J.B. Occurrence and sorption of fluoroquinolones in poultry litters and soils from São Paulo State, Brazil. Sci. Total Environ. 2012, 432, 344–349. [Google Scholar] [CrossRef] [PubMed]
- SAG. Diagnosis of the Environmental Problems Caused by Poultry and Dairy Livestock in Chile, and Training on Assessment of Animal Farms; Servicio Agrícola y Ganadero: Santiago, Chile, 2006. [Google Scholar]
- Sanchuki, C.E.; Soccol, C.R.; de Carvalho, J.C.; Soccol, V.T.; do Nascimento, C.; Woiciechowski, A.L. Evaluation of poultry litter traditional composting process. Braz. Arch. Biol. Technol. 2011, 54, 1053–1058. [Google Scholar] [CrossRef]
- Yang, Q.; Zhang, H.; Guo, Y.; Tian, T. Influence of Chicken Manure Fertilization on Antibiotic-Resistant Bacteria in Soil and the Endophytic Bacteria of Pakchoi. Int. J. Environ. Res. Public Health 2016, 13, 662. [Google Scholar] [CrossRef] [PubMed]
- Pan, M.; Chu, L. Fate of antibiotics in soil and their uptake by edible crops. Sci. Total Environ. 2017, 599, 500–512. [Google Scholar] [CrossRef] [PubMed]
- Kwon, S.; Owens, G.; Ok, Y.; Lee, D.; Jeon, W.-T.; Kim, J.; Kim, K.-R. Applicability of the Charm II system for monitoring antibiotic residues in manure-based composts. Waste Manag. 2011, 31, 39–44. [Google Scholar] [CrossRef] [PubMed]
- Nõlvak, H.; Truu, M.; Kanger, K.; Tampere, M.; Espenberg, M.; Loit, E.; Raave, H.; Truu, J. Inorganic and organic fertilizers impact the abundance and proportion of antibiotic resistance and integron-integrase genes in agricultural grassland soil. Sci. Total Environ. 2016, 562, 678–689. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Jiang, X. Microbiological safety of chicken litter or chicken litter-based organic fertilizers: A review. Agriculture 2014, 4, 1–29. [Google Scholar] [CrossRef]
- Hu, X.; Zhou, Q.; Luo, Y. Occurrence and source analysis of typical veterinary antibiotics in manure, soil, vegetables and groundwater from organic vegetable bases, northern China. Environ. Pollut. 2010, 158, 2992–2998. [Google Scholar] [CrossRef] [PubMed]
- Bassil, R.J.; Bashour, I.I.; Sleiman, F.T.; Abou-Jawdeh, Y.A. Antibiotic uptake by plants from manure-amended soils. J. Environ. Sci. Health Part B 2013, 48, 570–574. [Google Scholar] [CrossRef] [PubMed]
- Chung, H.S.; Lee, Y.-J.; Rahman, M.M.; Abd El-Aty, A.M.; Lee, H.S.; Kabir, M.H.; Kim, S.W.; Park, B.-J.; Kim, J.-E.; Hacımüftüoğlu, F.; et al. Uptake of the veterinary antibiotics chlortetracycline, enrofloxacin, and sulphathiazole from soil by radish. Sci. Total Environ. 2017, 605–606, 322–331. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.; Ying, G.-G.; Tao, R.; Zhao, J.-L.; Yang, J.-F.; Zhao, L.-F. Effects of six selected antibiotics on plant growth and soil microbial and enzymatic activities. Environ. Pollut. 2009, 157, 1636–1642. [Google Scholar] [CrossRef] [PubMed]
- Hillis, D.G.; Fletcher, J.; Solomon, K.R.; Sibley, P.K. Effects of ten antibiotics on seed germination and root elongation in three plant species. Arch. Environ. Contam. Toxicol. 2011, 60, 220–232. [Google Scholar] [CrossRef] [PubMed]
- Minden, V.; Deloy, A.; Volkert, A.M.; Leonhardt, S.D.; Pufal, G. Antibiotics impact plant traits, even at small concentrations. AoB Plants 2017, 9. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Choi, K. Hazard assessment of commonly used agricultural antibiotics on aquatic ecosystems. Ecotoxicology 2008, 17, 526–538. [Google Scholar] [CrossRef] [PubMed]
- Ji, K.; Kim, S.; Han, S.; Seo, J.; Lee, S.; Park, Y.; Choi, K.; Kho, Y.-L.; Kim, P.-G.; Park, J.; et al. Risk assessment of chlortetracycline, oxytetracycline, sulfamethazine, sulfathiazole, and erythromycin in aquatic environment: Are the current environmental concentrations safe? Ecotoxicology 2012, 21, 2031–2050. [Google Scholar] [CrossRef] [PubMed]
- Kołodziejska, M.; Maszkowska, J.; Białk-Bielińska, A.; Steudte, S.; Kumirska, J.; Stepnowski, P.; Stolte, S. Aquatic toxicity of four veterinary drugs commonly applied in fish farming and animal husbandry. Chemosphere 2013, 92, 1253–1259. [Google Scholar] [CrossRef] [PubMed]
- Havelkova, B.; Beklova, M.; Kovacova, V.; Hlavkova, D.; Pikula, J. Ecotoxicity of selected antibiotics for organisms of aquatic and terrestrial ecosystems. Neuroendocrinol. Lett. 2016, 37, 38–44. [Google Scholar] [PubMed]
- CVMP. Guideline on Approach towards Harmonisation of Withdrawal Periods; European Medicines Agency, Committee for Veterinary Medicinal Products: London, UK, 2016; p. 37. [Google Scholar]
- Berendsen, B.J.; Wegh, R.S.; Memelink, J.; Zuidema, T.; Stolker, L.A. The analysis of animal faeces as a tool to monitor antibiotic usage. Talanta 2015, 132, 258–268. [Google Scholar] [CrossRef] [PubMed]
- Sumano López, H.S.; Gutiérrez Olvera, L. Farmacología Clínica en aves Comerciales [Clinical Pharmacology in Poultry], 4th ed.; Interamericana Mc-Graw-Hill: Mexico Df, Mexico, 2010. [Google Scholar]
- Cornejo, J.; Pokrant, E.; Krogh, M.; Briceño, C.; Hidalgo, H.; Maddaleno, A.; Araya-Jordán, C.; Martín, B.S. Determination of oxytetracycline and 4-epi-oxytetracycline residues in feathers and edible tissues of broiler chickens using liquid chromatography coupled with tandem mass spectrometry. J. Food Prot. 2017, 80, 619–625. [Google Scholar] [CrossRef] [PubMed]
- Berendsen, B.J.; Bor, G.; Gerritsen, H.W.; Jansen, L.J.; Zuidema, T. The disposition of oxytetracycline to feathers after poultry treatment. Food Addit. Contam. Part A 2013, 30, 2102–2107. [Google Scholar] [CrossRef] [PubMed]
- Cornejo, J.; Pokrant, E.; Araya, D.; Briceño, C.; Hidalgo, H.; Maddaleno, A.; Araya-Jordán, C.; San Martin, B. Residue depletion of oxytetracycline (OTC) and 4-epi-oxytetracycline (4-epi-OTC) in broiler chicken’s claws by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Food Addit. Contam. Part A 2017, 34, 494–500. [Google Scholar] [CrossRef] [PubMed]
- Balouiri, M.; Sadiki, M.; Ibnsouda, S.K. Methods for in vitro evaluating antimicrobial activity: A review. J. Pharm. Anal. 2016, 6, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Przeniosło-Siwczyńska, M.; Kwiatek, K. Evaluation of multi-plate microbial assay for the screening of antibacterial substances in animal feedingstuffs. Bull. Vet. Inst. Pulawy 2007, 51, 599–602. [Google Scholar]
- Kirbiš, A. Microbiological screening method for detection of aminoglycosides, β-lactames, macrolides, Tetracyclines and quinolones in meat samples. Slov. Vet. Res. 2007, 44, 11–18. [Google Scholar]
- Pikkemaat, M.G.; Rapallini, M.L.; Oostra-van Dijk, S.; Elferink, J.A. Comparison of three microbial screening methods for antibiotics using routine monitoring samples. Anal. Chim. Acta 2009, 637, 298–304. [Google Scholar] [CrossRef] [PubMed]
- Montforts, M.H.; Kalf, D.F.; van Vlaardingen, P.L.; Linders, J.B. The exposure assessment for veterinary medicinal products. Sci. Total Environ. 1999, 225, 119–133. [Google Scholar] [CrossRef]
- Surette, M.D.; Wright, G.D. Lessons from the Environmental Antibiotic Resistome. Annu. Rev. Microbiol. 2017, 71, 309–329. [Google Scholar] [CrossRef] [PubMed]
- Tien, Y.-C.; Li, B.; Zhang, T.; Scott, A.; Murray, R.; Sabourin, L.; Marti, R.; Topp, E. Impact of dairy manure pre-application treatment on manure composition, soil dynamics of antibiotic resistance genes, and abundance of antibiotic-resistance genes on vegetables at harvest. Sci. Total Environ. 2017, 581–582, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Yang, X.; Jiao, S.; Zhang, J.; Ye, B.; Gao, S. Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China. PLoS ONE 2014, 9, e112626. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.-H.; Qiao, M.; Chen, Z.; Su, J.-Q.; Zhu, Y.-G. Antibiotic resistance genes in manure-amended soil and vegetables at harvest. J. Hazard. Mater. 2015, 299, 215–221. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Zhou, Q.; He, Z.; Bao, Y. Physiological and potential genetic toxicity of chlortetracycline as an emerging pollutant in wheat (Triticum aestivum L.). Environ. Toxicol. Chem. 2010, 29, 922–928. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Zhou, Q.; Bao, Q.; He, Z.; Bao, Y. Genotoxicity of tetracycline as an emerging pollutant on root meristem cells of wheat (Triticum aestivum L.). Environ. Toxicol. 2011, 26, 417–423. [Google Scholar] [CrossRef] [PubMed]
- European Parliament and the Council of the European Union Directive 2010/63/EU of 22 September 2010 of the European Parliament and of the Council on the protection of animals used for scientific purposes. Off. J. Eur. Union 2010, 276, 33–79.
- Pikkemaat, M.G.; Rapallini, M.L.; Zuidema, T.; Elferink, J.W.A.; Oostra-van Dijk, S.; Driessen-van Lankveld, W.D.M. Screening methods for the detection of antibiotic residues in slaughter animals: Comparison of the European Union Four-Plate Test, the Nouws Antibiotic Test and the Premi®Test (applied to muscle and kidney). Food Addit. Contam. Part A 2011, 28, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Gaudin, V.; Hedou, C.; Rault, A.; Verdon, E. Validation of a Five Plate Test, the STAR protocol, for the screening of antibiotic residues in muscle from different animal species according to European Decision 2002/657/EC. Food Addit. Contam. Part A 2010, 27, 935–952. [Google Scholar] [CrossRef] [PubMed]
- Ng, L.-K.; Mulvey, M.R.; Martin, I.; Peters, G.A.; Johnson, W. Genetic characterization of antimicrobial resistance in Canadian isolates of Salmonella serovar Typhimurium DT104. Antimicrob. Agents Chemother. 1999, 43, 3018–3021. [Google Scholar] [PubMed]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-Fifth Informational Supplement; Clinical Laboratory Standards Institute: Wayne, PA, USA, 2015; ISBN 1-56238-989-0. [Google Scholar]
Sample Availability: Samples of the compounds are not available from the authors |
Sampling Point | Days after Treatment | Chicken Age (in Days) | Antimicrobial Activity in Broiler Chicken Droppings | Concentrations of CTC and 4-epi-CTC (μg/kg) in Broiler Chicken Droppings | PCR | ||
---|---|---|---|---|---|---|---|
tet A | tet B | tet G | |||||
Sample 1 | 5 | 25 | p | 665.8 | + | + | - |
Control 1 | a | <LOD | - | - | - | ||
Sample 2 | 8 | 28 | p | 368.2 | + | + | - |
Control 2 | a | <LOD | - | - | - | ||
Sample 3 | 11 | 31 | p | 258.4 | + | + | - |
Control 3 | a | <LOD | - | - | - | ||
Sample 4 | 15 | 35 | p | 136.9 | + | + | - |
Control 4 | a | 0 | - | - | - | ||
Sample 5 | 18 | 38 | p | 106.5 | + | + | - |
Control 5 | a | <LOD | - | - | - | ||
Sample 6 | 21 | 41 | p | 112.0 | + | + | - |
Control 6 | a | <LOD | - | - | - | ||
Sample 7 | 25 | 45 | p | 179.5 | + | + | - |
Control 7 | a | <LOD | - | - | - |
Gene | PCR | Primer Sequence (5′-3′) | Product Size (bp) | Annealing Temperature (°C) | Resistance Phenotypes |
---|---|---|---|---|---|
tet(A) | F | gctacatcctgcttgccttc | 210 | 56.2 | TET |
R | catagatcgccgtgaagagg | 55.1 | |||
tet(B) | F | ttggttaggggcaagttttg | 659 | 53.5 | TET |
R | gtaatgggccaataacaccg | 53.9 | |||
tet(G) | F | gctcggtggtatctctgctc | 468 | 57.3 | TET |
R | agcaacagaatcgggaacac | 55.5 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cornejo, J.; Yevenes, K.; Avello, C.; Pokrant, E.; Maddaleno, A.; Martin, B.S.; Lapierre, L. Determination of Chlortetracycline Residues, Antimicrobial Activity and Presence of Resistance Genes in Droppings of Experimentally Treated Broiler Chickens. Molecules 2018, 23, 1264. https://doi.org/10.3390/molecules23061264
Cornejo J, Yevenes K, Avello C, Pokrant E, Maddaleno A, Martin BS, Lapierre L. Determination of Chlortetracycline Residues, Antimicrobial Activity and Presence of Resistance Genes in Droppings of Experimentally Treated Broiler Chickens. Molecules. 2018; 23(6):1264. https://doi.org/10.3390/molecules23061264
Chicago/Turabian StyleCornejo, Javiera, Karina Yevenes, Constanza Avello, Ekaterina Pokrant, Aldo Maddaleno, Betty San Martin, and Lisette Lapierre. 2018. "Determination of Chlortetracycline Residues, Antimicrobial Activity and Presence of Resistance Genes in Droppings of Experimentally Treated Broiler Chickens" Molecules 23, no. 6: 1264. https://doi.org/10.3390/molecules23061264