Next Article in Journal
Regularized Multi-View Subspace Clustering for Common Modules Across Cancer Stages
Previous Article in Journal
Comparison of Serum Metabolite Changes of Radiated Mice Administered with Panax quinquefolium from Different Cultivation Regions Using UPLC-Q/TOF-MS Based Metabolomic Approach
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Analysis of the Complete Chloroplast Genomes of Four Aconitum Medicinal Species

1
College of Horticulture and Landscape, Yunnan Agricultural University, Kunming 650201, China
2
Germplasm Bank of Wild Species, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, China
3
Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650201, China
*
Authors to whom correspondence should be addressed.
Molecules 2018, 23(5), 1015; https://doi.org/10.3390/molecules23051015
Submission received: 8 April 2018 / Revised: 23 April 2018 / Accepted: 24 April 2018 / Published: 26 April 2018
(This article belongs to the Section Molecular Diversity)

Abstract

:
Aconitum (Ranunculaceae) consists of approximately 400 species distributed in the temperate regions of the northern hemisphere. Many species are well-known herbs, mainly used for analgesia and anti-inflammatory purposes. This genus is well represented in China and has gained widespread attention for its toxicity and detoxification properties. In southwestern China, several Aconitum species, called ‘Dula’ in the Yi Nationality, were often used to control the poisonous effects of other Aconitum plants. In this study, the complete chloroplast (cp) genomes of these species were determined for the first time through Illumina paired-end sequencing. Our results indicate that their cp genomes ranged from 151,214 bp (A. episcopale) to 155,769 bp (A. delavayi) in length. A total of 111–112 unique genes were identified, including 85 protein-coding genes, 36–37 tRNA genes and eight ribosomal RNA genes (rRNA). We also analyzed codon usage, IR expansion or contraction and simple sequence repeats in the cp genomes. Eight variable regions were identified and these may potentially be useful as specific DNA barcodes for species identification of Aconitum. Phylogenetic analysis revealed that all five studied species formed a new clade and were resolved with 100% bootstrap support. This study will provide genomic resources and potential plastid markers for DNA barcoding, further taxonomy and germplasm exploration of Aconitum.

1. Introduction

Chloroplasts are an important semiautonomous organelle in plants, providing essential energy [1]. The chloroplast genome structure, gene content and gene order is often better conserved than the nucleus and the mitochondria genome. It contains about 130 genes, with a typical circular quadripartite structure comprising two identical copies of inverted repeats (IRs), separated by a large single-copy region (LSC) and a small single-copy region (SSC). The chloroplast genome sizes of almost all land plants range between 120–160 kb in length [2,3]. Generally, coding regions in the chloroplast genome show lower polymorphism than non-coding regions [4]. With the rapid development of next generation sequencing (NGS) technologies, an increasing number of studies have focused on plant chloroplast genomes. Sequencing and phylogenetic analysis on the complete cp genome is a highly efficient and relatively low-cost way for improving intrageneric classification and population analysis. Recently, comparative analysis of the complete chloroplast (cp) genomes of several closely related species has provided promising results for the study of phylogeny, species identification and evolution [3,5,6,7,8,9].
Aconitum (Ranunculaceae) is a perennial or pseudoannual genus with an erect or twining stem and blue, purple or yellow flowers. It is comprised of about 400 species distributed in the temperate regions of the northern hemisphere and there are 211 species in China [10]. The genus is one of the most important medicinal and poisonous plants in the world [10]. Aconitum species have been noted for their toxicity from as early as mid-7 BC in Guoyu [11]. At present, many species are well-known herbs and mainly used for analgesia and anti-inflammatory purposes [12]. To date, the cp genomes of 17 Aconitum species have been reported [13,14].
In southwestern China, some Aconitum species, which are called ‘Dula,’ are often used to control the poisonous effects of other Aconitum plants; they are A. episcopale, A. vilmorinianum, A. contortum and A. delavayi [15,16,17,18,19]. The first two species are twining, belonging to Aconitum subgen. Aconitum ser. Volubilia; the last two species are erect and a member of ser. Stylosa and ser. Ambigua respectively [20]. The major medicinal and toxic compounds aconitine, hypaconitine and mesaconitine are not contained in these species. However, the use of morphological and molecular markers for the identification of Aconitum species is controversial or limited due to unmanageable phenotypic characteristics or morphological similarity among species [21,22,23,24]. The coexistence of toxic species and species with antidote properties in Aconitum may result in misuse during practical application. Therefore, providing more genomic information is imperative for the understanding of these species and the safe and effective utilization of ‘Dula.’
In this study, we used an Illumina Miseq Platform to assemble the cp genomes of five herbal plants in Aconitum, four ‘Dula’ (A. episcopale, A. contortum, A. vilmorinianum, A. delavayi) and one, A. hemsleyanum (ser. Volubilia), which is also twining and morphologically similar to A. vilmorinianum and clustered with ‘Dula’ in previous analyses [23,24,25]. The aims of our study were: (1) to deepen understanding of the structural patterns of Aconitum cp genomes; (2) to provide knowledge for species identification of ‘Dula’; (3) and to reconstruct phylogenetic relationships among the Aconitum species using the cp genome sequences.

2. Results and Discussion

2.1. Chloroplast Genome Features

We obtained cleaned reads of 8,783,602 bp to 24,899,740 bp from the five Aconitum species, using the Illumina Miseq platform. Out of 1161–2540 de-novo assembled contigs, only 3–4 contigs were used in the final cp genome assemblies (Table 1). The five Aconitum cp genomes ranged from 151,214 bp (A. episcopale) to 155,769 bp (A. delavayi) in length and 56.4× to 159.9× coverage. They had a typical quadripartite structure that was similar to the majority of cp genomes of land plants, consisting of a pair of IRs (26,209 bp–26,240 bp), separated by the LSC (83,182 bp–86,394 bp) and SSC (of 15,598 bp–16,949 bp) regions (Table 1 and Figure 1). Compared with other Aconitum species, we discovered that the size of the cp genome in A. episcopale is the smallest [13,14]. These five plastomes are highly conserved in gene content, gene order and intron number. The cp genomes of A. vilmorinianum, A. delavayi, A. hemsleyanum and A. contortum had the same GC content of 38.1%, A. episcopale showed a subtle difference (38.3%) compared with the others. The GC contents of the LSC and SSC regions of the five species were lower than that of the IR regions due to the reduction of AT nucleotides in the four duplicate rRNA genes [6,26].
The cp genomes of four species contained 112 unique genes, including 78 protein-coding genes (PCGs), 30 transfer RNA genes (tRNA) and four ribosomal RNA genes (rRNA). A. episcopale did not contain the trnG-UCC tRNA gene. The LSC region contained 60 PCGs and 21–22 tRNA genes, while the SSC region contained eleven PCGs and one tRNA gene. Seven PCGs (rpl2, rpl23, ycf2, ycf15, ndhB, rps7 and rps12), seven tRNA (trnI-CAU, trnL-CAA, trnV-GAC, trnI-GAU, trnA-UGC, trnR-ACG and trnN-GUU) and all four rRNA (rrna16, rrna23, rrna4.5 and rrna5) genes were duplicated and all were located in IR regions (Table 1 and Table 2 and Figure 1). Compared with A. sinomontanum, A. barbatum var. puberulum and A. barbatum var. hispidum, the rps16 gene was missing in these five species [13,26]. Two pseudogenes ψrps19 and ψycf1 were found in A. contortum, A. episcopale, A. vilmorinianum and A. hemsleyanum, while only one pseudogene ψycf1 was found in A. delavayi.
Introns are non-coding fragments of genes that are under less functional constrains and thus accumulated mutations more rapidly. However, introns can have an integral in regulating gene expression [27]. In four Aconitum species, with the exception of A. episcopale, 15 intron-containing genes were investigated: 12 genes (atpF, rpoC1, ndhB, petB, rpl2, ndhA, trnA-UGC, trnI-GAU, trnK-UUU, trnL-UAA, trnG-GCC and trnV-UAC) had only one intron, while three genes (clpP, ycf3 and rps12) had two introns. In A. episcopale, there are also 15 intron-containing genes; the petB gene does not contain an intron, the other intron-containing genes are similar to the other four Aconitum species (Table S1). The rps12 gene was a trans-spliced gene with 5’ end located in the LSC region and the duplicated 3’ end in IR regions, which was similar to other land plants [6,9]. The trnK-UUU gene had the largest intron and ranged from 2236 bp–2538 bp. It also contained the matK gene.

2.2. Codon Usage

We further analyzed the codon usage frequency and relative synonymous codon usage (RSCU) based on sequences of 85 PCGs in the five Aconitum species cp genomes. Among these, leucine was the most abundant amino acid, with 2325 (10.32%), 2316 (10.32%), 1852 (8.77%), 2320 (10.32%) and 2324 (10.33%) of codons in A. vilmorinianum, A. delavayi, A. episcopale, A. hemsleyanum and A. contortum, respectively, while cysteine was the least abundant amino acid, with 256 (1.14%), 256 (1.14%), 382 (1.81%), 256 (1.14%) and 256 (1.14%) codons in each species, respectively (Figure 2 and Table S2). Codon usage was biased towards A and T at the third codon position in the five species, which agrees with previous reports for the angiosperm chloroplast genome [28,29,30]. Furthermore, the usage of start codons AUG and UGG, encoding methionine and tryptophan, had no bias (RSCU = 1) (Table S2).

2.3. Repeat and SSR Analyses

Repeat regions are considered to play an important role in the generation of substitutions and indels [29,31,32]. A total of 151 repeats were identified in the five Aconitum chloroplast genomes, including 42 forward repeats, 59 palindromic repeats, 15 reverse repeats and 35 tandem repeats. Aconitum hemsleyanum possessed the highest number of repeats (37), while A. episcopale possessed the fewest (24) (Figure 3A and Table S3). The majority of repeats ranged in size from 20 to 39 bp (Figure 3B). Most of them were distributed in intergenic (52.32%) or gene regions (43.71%) and only 3.97% were located in intron regions, such as clpP and rpoC1 (Figure 3C and Table S3). Repeats located in identical regions with the same lengths were identified as shared repeats. Using this criterion, 18 repeats were found to be shared by all five Aconitum species (Table 3), providing a useful resource for phylogeny and population studies.
SSRs are tandemly repeated DNA sequences with 1–6 bp and are distributed throughout the genome. They are widely used for the screening of effective molecular markers for detecting intraspecific and interspecific polymorphisms [33,34] and population genetics [35]. In total, 1375 SSRs were identified in the cp genome of the five Aconitum species, ranging from 259 SSRs in A. episcopale to 282 SSRs in A. vilmorinianum and A. contortum; more than half of the SSRs were composed of A or T (Figure 4A,C and Table S4). The majority of SSRs were mononucleotide repeats, followed by trinucleotide repeats; no hexanucleotide repeats were found. Most of the SSR repeats were located in intergenic spacer regions (IGS) (57.75%), while the regions situated in coding DNA sequence (CDS) or tRNA introns, ψrps19 or ψycf1 and rRNA or tRNA accounted for 32.36%, 6.84%, 1.24% and 1.82% of SSR repeats, respectively (Figure 4B). Among these mononucleotide repeats, there were generally polyadenine (polyA, 47.33–51.09%) and polythymine (polyT, 45.99–49.58%) repeats (Table S4) and rarely tandem guanine (G) or cytosine (C) repeats, which agrees with previous chloroplast SSRs reports [36]. The longest polyA (17 bp) and the most abundant mononucleotide (51.09%) were found in A. contortum.

2.4. Comparative Chloroplast Genomic Analysis

Sequence identity plots of the five Aconitum species were generated, with the annotation of A. vilmorinianum cp genome as a reference (Figure 5). LSC and SSC regions were more divergent than IRs regions. Whereas, the coding regions were more conserved than the non-coding regions, the highly divergent non-coding regions among the five chloroplast genomes appeared in IGS, such as trnH-psbA, trnK-trnQ, atpF-atpH, trnC-petN, ycf4-cemA, trnP-psaJ and rpl16-rps3. Among coding regions, ndhA, ndhH, rps15 and ycf1 genes were relatively divergent. On the other hand, all the rRNA genes were highly conserved and are similar to other plants’ chloroplast genomes [37]. For further understanding of the nucleotide variability (Pi), we also calculated the DNA polymorphism among these five Aconitum species (Figure 6). The results are the same as previous reports: the IR regions more conserved than LSC and SSC regions [13,14]. There were eight variable regions that showed high Pi values (≥0.005), including psbA and ycf1 genes, the intron of trnV-UAC and intergenic regions (trnK-UUU-trnQ-UUG, trnE-UUC-trnT-GGU, trnT-GGU-psbD, trnT-UGU-trnL-UAA and rpl20-rps12) in the chloroplast genomes. These hotspot regions could be developed as molecular markers and barcoding for future phylogenetic analyses and species identification of Aconitum.

2.5. IR Expansion and Contraction

IRs are the most conserved regions of the chloroplast genome. However, the contraction and expansion of IR borders are common evolutionary events and are the major reason for size differences between chloroplast genomes [37]. Chloroplast genome structure and the junction positions between IR regions were well conserved among the five Aconitum species but structure variation was still found in the IRs/SC borders (Figure 7). There were 3 bp protrusion of rps19 gene into IRa regions, with the corresponding pseudogene fragment ψrps19, located in the IRa/LSC border for A. vilmorinianum, A. hemsleyanum and A. contortum. This agrees with most Aconitum subgen. Aconitum species. However, the length of this protrusion was 107 bp in A. episcopale [13]. Moreover, no pseudogene fragment ψrps19 was found in A. delavayi and there were 127 bp between rps19 and the IRa/LSC border. Long ψycf1 fragments with 1259–1291 bp were created at the IRa regions due to the border between SSC and IRb located in the ycf1 genes. In addition, the trnH-GUG genes for four of the five species were all located in the LSC region, with the distance between trnH-GUG and the IRb/LSC border varying from 54 to 55 bp. The exception to this was A. episcopale, in which the trnH-GUG gene overlapped with the ψrps19 by 49 bp.

2.6. Phylogenetic Analyses

Relationships within Aconitum species are fairly well resolved in previously published studies but the positions of the twining species of Aconitum still remain somewhat uncertain and there is a possibility that they might have evolved independently in various groups [13,23]. The phylogenetic analysis of these five species mostly used the chloroplast fragment trnH-psbA and the nuclear fragment ITS [21,23,24]. In the present study, we chose two datasets (the whole cp genomes and 77–79 PCGs) from the five Aconitum species and 20 published plastomes to perform the phylogenetic analysis. A phylogenetic tree based on the same dataset, using ML and BI, had an almost identical topological structure but different support values (Figure 8).
There were no obvious conflicts between the phylogenetic trees built by different datasets but the support values of the branches based on the whole cp genomes dataset were higher than those based on the PCG dataset, except for the clade of A. delavayi and A. episcopale. All of the 22 Aconitum taxa formed a monophyletic clade with 100% bootstrap value or the Bayesian posterior probability. The five species formed a monophyletic clade with 100% bootstrap value or the Bayesian posterior probability within Aconitum subgen. Aconitum, among which three twining species belonging to ser. Volubilia (A. episcopale, A. vilmorinianum and A. hemsleyanum) were clustered with the species from ser. Stylosa (A. contortum) and ser. Ambigua (A. delavayi). Furthermore, A. delavayi and A. episcopale formed a monophyletic group with very high support value and sister to the clade that was clustered by A. vilmorinianum and A. hemsleyanum (Figure 8), a finding consistent with the previous result that the ser. Volubilia was not a monophyly [23]. Aconitum vilmorinianum had a closer phylogenetic relationship to A. hemsleyanum than to the other three species. At the same time, the phylogenetic relationship constructed using the whole cp genomes dataset showed that A. ciliare and A. japonicum subsp. napiforme formed a clade with a high support value of 98.4/1.00, sister to A. kusnezoffii (Figure 8); however, their monopyly was not resolved with the PCGs (Figure S1). The current phylogenetic tree showed the deep-level relationships of Aconitum species, raising the possibility that the cp genome sequences may be useful for elucidating the phylogeny of Aconitum species in the future.

3. Materials and Methods

3.1. Plant Material, DNA Extraction and Sequencing

Fresh leaves of five Aconitum species were collected from Yunnan province and dried with silica gel. Voucher specimens were deposited in the herbarium of the Kunming Institute of Botany (KUN), Chinese Academy of Sciences. Total genomic DNA was extracted with the modified cetyltrimethyl ammonium bromide (CTAB) method [38]. The extracted DNA was sequenced using the Illumina Miseq platform (Illumina, San Diego, CA, USA). The chloroplast sequence generated in this study was submitted to GenBank (Table 1).

3.2. Chloroplast Genome Assembly and Annotation

For each Aconitum species, reads of the cp genome were assembled using CLC Genomic Workbench v10 (CLC Bio., Aarhus, Denmark). All the contigs were checked against the reference genome of A. chiisanense (KT820665), using BLAST (https://blast.ncbi.nlm.nih.gov/) and aligned contigs were oriented according to the reference genome. The complete cp genomes were then constructed using Geneious v4.8.5 (Biomatters Ltd., Auckland, New Zealand).
The annotation of cp genome sequence was performed using DOGMA (http://dogma.ccbb.utexas.edu/) [39] and start/stop codons and intron/exon boundaries were adjusted in Geneious v4.8.5. The tRNA was identified through tRNAscan-SE v2.0 [40]. The circular genome map was generated in OGDRAW (http://ogdraw.mpimp-golm.mpg.de/) [41].

3.3. Structure of Genome and Genome Comparison

All protein-coding genes were used for determining the codon usage. Avoiding the influence of the amino acid composition, we examined the RSCU using MEGA v7.0 [42]. We identified the repeat sequences, including palindromic, reverse and forward repeats, in REPuter Online software, with the following settings: Hamming distance of 3 and minimum repeat size of 30 bp [43]. Tandem Repeats Finder v4.07 was used to analyze tandem repeats using default settings [44]. Simple sequence repeats (SSRs) were detected by Phobos v3.3.12 [45] and SSR Hunter v1.3 [46]. The threshold value of the repeat number was set as: ≥8 for mononucleotide repeats, ≥4 for dinucleotide repeats and ≥3 for trinucleotide repeats, tetranucleotide repeats, pentanucleotide repeats and hexanucleotide repeats. The mVISTA was used to compare the cp genomes of the five Aconitum species in Shuffle-LAGAN mode, with annotation of A. vilmorinianum as a reference [47]. These cp genome sequences were aligned by CLC Genomic Workbench v10. Sliding window analysis was conducted to determine the nucleotide diversity of the cp genome using DnaSP v5, with 200 bp of step size and 600 bp window length [48].

3.4. Phylogenetic Analyses

In order to explore the phylogenic relationships of the five species among Aconitum, a total of 20 complete cp genomes of the family Ranunculaceae were obtained from GenBank, including 17 Aconitum taxa and another three species from different genera as outgroups (Table S5). For the phylogenetic analysis, 77–79 PCGs and the whole cp genomes were aligned by CLC Genomic Workbench with default parameters. A Maximum Likelihood (ML) tree was then performed in RAxML [49], with the nucleotide substitution model of GTR + Gamma and a bootstrap of 1000 replicates. Bayesian inference (BI) was estimated with MrBayes v3.2.6 [50]. The best-fitting substitution model was selected using jModelTest [51]. The general time-reversible (GTR) model was chosen with a gamma model for the rate of heterogeneity. The Markov chain Monte Carlo (MCMC) analysis was run for 10,000,000 generations. The trees were sampled every 1000 generations, with the first 25% discarded as burn-in.

4. Conclusions

The cp genomes of the four special Aconitum medicinal species ‘Dula’ and one species A. hemsleyanum were reported for the first time. The cp genomes all displayed a typical quadripartite structure, which was similar to that of most angiosperms. Aconitum episcopale was found to have the smallest size of cp genome (151,214 bp) presently known in Aconitum species. Except for A. delavayi, the other four species were found to have two pseudogenes (ψrps19 and ψycf1). Eight variable regions (psbA, ycf1, trnV, trnK-trnQ, trnE-trnT, trnT-psbD, trnT-trnL and rpl20-rps12) were identified and may potentially be useful as specific DNA barcodes for identifying Aconitum species. The result of phylogenetic analyses showed that the Aconitum subgen. Aconitum ser. Volubilia was not monophyletic. The resulting trees showed good construction of the deep-level relationships of Aconitum species, indicating that the whole cp genome sequences will have much better resolution in the phylogenetic study of Aconitum species in the future.

Supplementary Materials

Supplementary materials will be available online.

Acknowledgments

We appreciate the Germplasm Bank of Wild Species, Kunming Institute of Botany, Chinese Academy of Sciences for providing the experimental platform. This work was supported by the National Natural Science Foundation of China (No. 31100178), the Large-scale Scientific Facilities of the Chinese Academy of Sciences (No. 2017-LSF-GBOWS-02), Ministry of Science and Technology based on special projects (2013FY112600) and the Applied Fundamental Research Foundation of Yunnan Province (2014GA003).

Author Contributions

Jing Meng and Jun He conceived and revised the experiment; Xuepei Li, Jun He, Hongtao Li and Junbo Yang assembled sequences and analyzed the data; Jing Meng, Xuepei Li and Jun He wrote the manuscript; Jun He and Hong Wang collected the plant materials. All authors have read and approved the final version of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Daniell, H.; Lin, C.S.; Yu, M.; Chang, W.J. Chloroplast genomes: Diversity, evolution and applications in genetic engineering. Genome Biol. 2016, 17, 134. [Google Scholar] [CrossRef] [PubMed]
  2. Wicke, S.; Schneeweiss, G.M.; dePamphilis, C.W.; Muller, K.F.; Quandt, D. The evolution of the plastid chromosome in land plants: Gene content, gene order, gene function. Plant Mol. Biol. 2011, 76, 273–297. [Google Scholar] [CrossRef] [PubMed]
  3. Tonti-Filippini, J.; Nevill, P.G.; Dixon, K.; Small, I. What can we do with 1000 plastid genomes? Plant J. 2017, 90, 808–818. [Google Scholar] [CrossRef] [PubMed]
  4. Park, I.; Kim, W.J.; Yeo, S.M.; Choi, G.; Kang, Y.M.; Piao, R.; Moon, B.C. The complete chloroplast genome sequences of Fritillaria ussuriensis Maxim. and Fritillaria cirrhosa D. Don and comparative analysis with other Fritillaria species. Molecules 2017, 22, 982. [Google Scholar] [CrossRef] [PubMed]
  5. Wang, W.B.; Yu, H.; Wang, J.H.; Lei, W.J.; Gao, J.H.; Qiu, X.P.; Wang, J.S. The complete chloroplast genome sequences of the medicinal plant Forsythia suspensa (Oleaceae). Int. J. Mol. Sci. 2017, 18, 2288. [Google Scholar] [CrossRef] [PubMed]
  6. Zhou, J.G.; Chen, X.L.; Cui, Y.X.; Sun, W.; Li, Y.H.; Wang, Y.; Song, J.Y.; Yao, H. Molecular structure and phylogenetic analyses of complete chloroplast genomes of two Aristolochia medicinal species. Int. J. Mol. Sci. 2017, 18, 1839. [Google Scholar] [CrossRef] [PubMed]
  7. Yu, X.Q.; Drew, B.T.; Yang, J.B.; Gao, L.M.; Li, D.Z. Comparative chloroplast genomes of eleven Schima (Theaceae) species: Insights into DNA barcoding and phylogeny. PLoS ONE 2017, 12, e0178026. [Google Scholar] [CrossRef] [PubMed]
  8. Xu, C.; Dong, W.P.; Li, W.Q.; Lu, Y.Z.; Xie, X.M.; Jin, X.B.; Shi, J.P.; He, K.H.; Suo, Z.L. Comparative analysis of six Lagerstroemia complete chloroplast genomes. Front. Plant Sci. 2017, 8, 15. [Google Scholar] [CrossRef] [PubMed]
  9. Gu, C.H.; Tembrock, L.R.; Zheng, S.Y.; Wu, Z.Q. The complete chloroplast genome of Catha edulis: A comparative analysis of genome features with related species. Int. J. Mol. Sci. 2018, 19, 525. [Google Scholar] [CrossRef] [PubMed]
  10. Li, L.Q.; Kadota, Y. Aconitum; Science Press: Beijing, China; Missouri Botanical Garden Press: St. Louis, MI, USA, 2001; Volume 6, pp. 149–222. [Google Scholar]
  11. Cheng, Z.Y.; Jiang, Z.H. The medicinal plant resources of Chinese Aconitum and Delphinium. Acta Bot. Yunn. 1988, 10, 63–76. [Google Scholar]
  12. Wu, Z.Y.; Zhou, T.Y.; Xiao, P.G. Compendium of Xinhua Bentgrass (I); Shanghai Scientific & Technical Publishers: Shanghai, China, 1988. [Google Scholar]
  13. Kong, H.H.; Liu, W.Z.; Yao, G.; Gong, W. A comparison of chloroplast genome sequences in Aconitum (Ranunculaceae): A traditional herbal medicinal genus. PeerJ 2017, 5, e4018. [Google Scholar] [CrossRef] [PubMed]
  14. Park, I.; Kim, W.J.; Yang, S.; Yeo, S.M.; Li, H.L.; Moon, B.C. The complete chloroplast genome sequence of Aconitum coreanum and Aconitum carmichaelii and comparative analysis with other Aconitum species. PLoS ONE 2017, 12, e0184257. [Google Scholar] [CrossRef] [PubMed]
  15. Niitsu, K.; Ikeya, Y.; Mitsuhashi, H.; Cheng, S.Y.; Li, H.L. Studies on the Alkaloids from Aconitum contortum (I). Heterocycles 1990, 31, 1517–1524. [Google Scholar] [CrossRef]
  16. Yang, Q.E. A study on botanical origin of the Chinese herbal drug ‘Dula’. Acta Bot. Yunn. 1990, 12, 247–253. [Google Scholar]
  17. Xiao, P.G.; Wang, F.P.; Gao, F.; Yan, L.P.; Chen, D.L.; Liu, Y. A pharmacophylogenetic study of Aconitum L. (Ranunculaceae) from China. Acta Phytotaxon. Sin. 2006, 44, 1–46. [Google Scholar] [CrossRef]
  18. Liang, J.Y.; Yan, Z.Y.; Chen, X.; Wan, D.G.; Yang, X.C. Rearch on the anti-arrhythmic effect of Yi nationality herb ‘Dula’. Li Shi Zhen Med. Mater. Med. Res. 2008, 19, 2108–2109. [Google Scholar]
  19. Li, X.P.; He, J.; He, S.L.; Meng, J. Research progress of Aconitum vilmorinianum. J. West China Forest. Sci. 2017, 46, 1–7. [Google Scholar]
  20. Wang, W.T. Aconitum. In Flora Reipublicae Popularis Sinicae; Science Press: Beijing, China, 1979; Volume 27, pp. 113–326. [Google Scholar]
  21. Zhang, F.M.; Ge, S.; Chen, W.L. Phylogeny of the Aconitum delavayi complex (Ranunculaceae) based on evidence from nuclear ribosomal ITS sequences. Acta Phytotaxon. Sin. 2003, 41, 220–228. [Google Scholar]
  22. Zhang, F.M.; Chen, W.L.; Yang, Q.E.; Ge, S. Genetic differentiation and relationship of populations in the Aconitum delavayi complex (Ranunculaceae) and their taxonomic implications. Plant Syst. Evol. 2005, 254, 39–48. [Google Scholar] [CrossRef]
  23. Luo, Y.; Zhang, F.M.; Yang, Q.E. Phylogeny of Aconitum subgenus Aconitum (Ranunculaceae) inferred from ITS sequences. Plant Syst. Evol. 2005, 252, 11–25. [Google Scholar] [CrossRef]
  24. He, J.; Wong, K.L.; Shaw, P.C.; Wang, H.; Li, D.Z. Identification of the medicinal plants in Aconitum L. by DNA barcoding technique. Planta Med. 2010, 76, 1622–1628. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, Q.E. Taxonomic notes on some species of Aconitum L. (Ranunculaceae) from Yunnan, China. Acta Phytotaxon. Sin. 1999, 37, 545–590. [Google Scholar]
  26. Chen, X.C.; Li, Q.S.; Li, Y.; Qian, J.; Han, J.P. Chloroplast genome of Aconitum barbatum var. puberulum (Ranunculaceae) derived from CCS reads using the PacBio RS platform. Front. Plant Sci. 2015, 6, 42. [Google Scholar] [CrossRef] [PubMed]
  27. Xu, J.W.; Feng, D.J.; Song, G.S.; Wei, X.L.; Chen, L.; Wu, X.L.; Li, X.G.; Zhu, Z. The first intron of rice EPSP synthase enhances expression of foreign gene. Sci. China Ser. C 2003, 46, 561. [Google Scholar] [CrossRef] [PubMed]
  28. Morton, B.R. Selection on the codon bias of chloroplast and cyanelle genes in different plant and algal lineages. J. Mol. Evol. 1998, 46, 449–459. [Google Scholar] [CrossRef] [PubMed]
  29. Nie, X.J.; Lv, S.Z.; Zhang, Y.X.; Du, X.H.; Wang, L.; Biradar, S.S.; Tan, X.F.; Wan, F.H.; Song, W.N. Complete chloroplast genome sequence of a major invasive species, crofton weed (Ageratina adenophora). PLoS ONE 2012, 7, e36869. [Google Scholar] [CrossRef] [PubMed]
  30. Qian, J.; Song, J.Y.; Gao, H.H.; Zhu, Y.J.; Xu, J.; Pang, X.H.; Yao, H.; Sun, C.; Li, X.E.; Li, C.Y.; et al. The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza. PLoS ONE 2013, 8, e57607. [Google Scholar] [CrossRef] [PubMed]
  31. Cavalier-Smith, T. Chloroplast evolution: Secondary symbiogenesis and multiple losses. Curr. Biol. 2002, 12, 62–64. [Google Scholar] [CrossRef]
  32. Yi, X.; Gao, L.; Wang, B.; Su, Y.J.; Wang, T. The complete chloroplast genome sequence of Cephalotaxus oliveri (Cephalotaxaceae): Evolutionary comparison of Cephalotaxus chloroplast DNAs and insights into the loss of inverted repeat copies in Gymnosperms. Genome Biol. Evol. 2013, 5, 688–698. [Google Scholar] [CrossRef] [PubMed]
  33. Dong, W.P.; Xu, C.; Cheng, T.; Lin, K.; Zhou, S.L. Sequencing angiosperm plastid genomes made easy: A complete set of universal primers and a case study on the phylogeny of Saxifragales. Genome Biol. Evol. 2013, 5, 989–997. [Google Scholar] [CrossRef] [PubMed]
  34. Yang, Y.C.; Zhou, T.; Duan, D.; Yang, J.; Feng, L.; Zhao, G.F. Comparative analysis of the complete chloroplast genomes of Five Quercus species. Front. Plant Sci. 2016, 7, 959. [Google Scholar] [CrossRef] [PubMed]
  35. Perdereau, A.C.; Kelleher, C.T.; Douglas, G.C.; Hodkinson, T.R. High levels of gene flow and genetic diversity in Irish populations of Salix caprea L. inferred from chloroplast and nuclear SSR markers. BMC Plant Biol. 2014, 14, 202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Li, B.; Lin, F.R.; Huang, P.; Guo, W.Y.; Zheng, Y.Q. Complete chloroplast genome sequence of Decaisnea insignis: Genome organization, genomic resources and comparative analysis. Sci. Rep. 2017, 7, 10073. [Google Scholar] [CrossRef] [PubMed]
  37. Shen, X.F.; Wu, M.L.; Liao, B.S.; Liu, Z.X.; Bai, R.; Xiao, S.M.; Li, X.W.; Zhang, B.L.; Xu, J.; Chen, S.L. Complete chloroplast genome sequence and phylogenetic analysis of the medicinal plant Artemisia annua. Molecules 2017, 22, 1330. [Google Scholar] [CrossRef] [PubMed]
  38. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  39. Wyman, S.K.; Jansen, R.K.; Boore, J.L. Automatic annotation of organellar genomes with DOGMA. Bioinformatics 2004, 20, 3252–3255. [Google Scholar] [CrossRef] [PubMed]
  40. Lowe, T.M.; Chan, P.P. tRNAscan-SE On-line: Integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016, 44, W54–W57. [Google Scholar] [CrossRef] [PubMed]
  41. Lohse, M.; Drechsel, O.; Bock, R. OrganellarGenomeDRAW (OGDRAW): A tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr. Genet. 2007, 52, 267–274. [Google Scholar] [CrossRef] [PubMed]
  42. Kumar, S.; Nei, M.; Dudley, J.; Tamura, K. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008, 9, 299–306. [Google Scholar] [CrossRef] [PubMed]
  43. Kurtz, S.; Choudhuri, J.V.; Ohlebusch, E.; Schleiermacher, C.; Stoye, J.; Giegerich, R. REPuter: The manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 2001, 29, 4633–4642. [Google Scholar] [CrossRef] [PubMed]
  44. Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef] [PubMed]
  45. Leese, F.; Mayer, C.; Held, C. Isolation of microsatellites from unknown genomes using known genomes as enrichment templates. Limnol. Oceanogr. Methods 2008, 6, 412–426. [Google Scholar] [CrossRef]
  46. Li, Q.; Wan, J.M. SSRHunter: Development of a local searching software for SSR sites. Hereditas 2005, 27, 808–810. [Google Scholar] [PubMed]
  47. Frazer, K.A.; Pachter, L.; Poliakov, A.; Rubin, E.M.; Dubchak, I. VISTA: Computational tools for comparative genomics. Nucleic Acids Res. 2004, 32, W273–W279. [Google Scholar] [CrossRef] [PubMed]
  48. Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [PubMed]
  49. Stamatakis, A.; Hoover, P.; Rougemont, J. A rapid bootstrap algorithm for the RAxML Web servers. Syst. Biol. 2008, 57, 758–771. [Google Scholar] [CrossRef] [PubMed]
  50. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Hohna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
  51. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Sequence data of A. vilmorinianum, A. delavayi, A. episcopale, A. hemsleyanum and A. contortum have been deposited into GenBank and are available from the authors.
Figure 1. Chloroplast genome map of five Aconitum species. Genes lying outside the circle are transcribed in the counter clockwise direction, while those inside are transcribed in the clockwise direction. The colored bars indicate different functional groups. The darker gray area in the inner circle denotes GC content while the lighter gray corresponds to the AT content of the genome. LSC: large single copy, SSC: Small single copy, IR: inverted repeat.
Figure 1. Chloroplast genome map of five Aconitum species. Genes lying outside the circle are transcribed in the counter clockwise direction, while those inside are transcribed in the clockwise direction. The colored bars indicate different functional groups. The darker gray area in the inner circle denotes GC content while the lighter gray corresponds to the AT content of the genome. LSC: large single copy, SSC: Small single copy, IR: inverted repeat.
Molecules 23 01015 g001
Figure 2. Codon content for the 20 amino acids and stop codons in 85 protein-coding genes in the five Aconitum species chloroplast genomes. RSCU: relative synonymous codon usage; F: phenylalanine; L: leucine; I: isoleucine; M: methionine; V: valine; S: serine; P: proline; T: threonine; A: alanine; Y: tyrosine; *: stop; H: histidine; Q: glutamine; N: asparagine; K: lysine; D: aspartic acid; E: glutamic; C: cysteine; W: tryptophan; R: arginine; G: glycine.
Figure 2. Codon content for the 20 amino acids and stop codons in 85 protein-coding genes in the five Aconitum species chloroplast genomes. RSCU: relative synonymous codon usage; F: phenylalanine; L: leucine; I: isoleucine; M: methionine; V: valine; S: serine; P: proline; T: threonine; A: alanine; Y: tyrosine; *: stop; H: histidine; Q: glutamine; N: asparagine; K: lysine; D: aspartic acid; E: glutamic; C: cysteine; W: tryptophan; R: arginine; G: glycine.
Molecules 23 01015 g002
Figure 3. The type, length and distribution of repeats in the chloroplast genomes of five Aconitum species. (A) Number of different repeat types: F, forward; P, palindromic; R, reverse; T, tandem; (B) Number of different repeat lengths; (C) Proportion of repeats in LSC, SSC and IR regions.
Figure 3. The type, length and distribution of repeats in the chloroplast genomes of five Aconitum species. (A) Number of different repeat types: F, forward; P, palindromic; R, reverse; T, tandem; (B) Number of different repeat lengths; (C) Proportion of repeats in LSC, SSC and IR regions.
Molecules 23 01015 g003
Figure 4. The number and distribution of SSRs in the chloroplast genomes of five Aconitum species. (A) Total number of repeats; (B) Proportion of repeats in IGS, CDS, CDS or tRNA introns, ψrps19 or ψycf1 and rRNA or tRNA regions; (C) Number of repeats in LSC, SSC and IR.
Figure 4. The number and distribution of SSRs in the chloroplast genomes of five Aconitum species. (A) Total number of repeats; (B) Proportion of repeats in IGS, CDS, CDS or tRNA introns, ψrps19 or ψycf1 and rRNA or tRNA regions; (C) Number of repeats in LSC, SSC and IR.
Molecules 23 01015 g004
Figure 5. Comparison of five chloroplast genomes using A. vilmorinianum annotation as a reference. The vertical scale indicates the percentage of identity, ranging from 50 to 100%. The horizontal axis indicates the coordinates within the chloroplast genome. Genome regions are color-coded as exons, introns and conserved non-coding sequences (CNS).
Figure 5. Comparison of five chloroplast genomes using A. vilmorinianum annotation as a reference. The vertical scale indicates the percentage of identity, ranging from 50 to 100%. The horizontal axis indicates the coordinates within the chloroplast genome. Genome regions are color-coded as exons, introns and conserved non-coding sequences (CNS).
Molecules 23 01015 g005
Figure 6. Sliding-window analysis on the cp genomes for five Aconitum species. X-axis: position of the midpoint of a window; Y-axis: nucleotide diversity (Pi) of each window.
Figure 6. Sliding-window analysis on the cp genomes for five Aconitum species. X-axis: position of the midpoint of a window; Y-axis: nucleotide diversity (Pi) of each window.
Molecules 23 01015 g006
Figure 7. Comparisons of LSC, SSC and IR region borders among five Aconitum chloroplast genomes. ψ indicates a pseudogene. Genes are denoted by colored boxes. The number above the gene features shows the distance between the end of the gene and the borders sites. The slashes indicate the location of the distance. The arrows indicated the orientation (5’→3’) of the rps19, ndhF and ycf1 genes. This figure is not to scale.
Figure 7. Comparisons of LSC, SSC and IR region borders among five Aconitum chloroplast genomes. ψ indicates a pseudogene. Genes are denoted by colored boxes. The number above the gene features shows the distance between the end of the gene and the borders sites. The slashes indicate the location of the distance. The arrows indicated the orientation (5’→3’) of the rps19, ndhF and ycf1 genes. This figure is not to scale.
Molecules 23 01015 g007
Figure 8. Phylogenetic tree constructed using Maximum Likelihood (ML) and Bayesian Inference (BI) methods, based on the whole cp genomes from different species. The numbers above the branches represent ML bootstrap values/BI posterior probabilities. Triangle: twining species belonging to subgen. Aconitum.
Figure 8. Phylogenetic tree constructed using Maximum Likelihood (ML) and Bayesian Inference (BI) methods, based on the whole cp genomes from different species. The numbers above the branches represent ML bootstrap values/BI posterior probabilities. Triangle: twining species belonging to subgen. Aconitum.
Molecules 23 01015 g008
Table 1. The basic characteristics of chloroplast genomes of five Aconitum species.
Table 1. The basic characteristics of chloroplast genomes of five Aconitum species.
CharacteristicsA. vilA. delA. epiA. hemA. con
LocationWudingHeqingDaliQiaojiaDali
Voucher specimensLCF113951379QJ6895
GenBank numbersMG678799MG678802MG678801MG678800MG678803
Total clean reads8,783,60224,899,74022,334,86214,157,48219,869,478
Number of contigs25401468119011611749
Contigs used for constructing the cp genome43333
N50 of contigs (bp)1612369193919661953
Cp genome coverage (×)56.4159.9147.790.9127.7
Total cp DNA size (bp)155,761155,769151,214155,684155,653
LSC size (bp)86,39486,34083,18286,29286,267
IR size (bp)26,20926,24026,21726,23526,221
SSC size (bp)16,94916,94915,59816,92216,944
Total number of genes132131131132132
Number of different protein-coding genes7878787878
Number of different tRNA genes3030293030
Number of different rRNA genes44444
Number of duplicated genes2019202020
Total number of pseudogenes21222
GC content (%)38.138.138.338.138.1
GC content of LSC (%)36.236.236.436.236.2
GC content of IR (%)43.043.042.943.043.0
GC content of SSC (%)32.532.632.932.632.6
cpDNA: chloroplast genome DNA; LSC: large single copy; IR: inverted repeat; SSC: small single copy. A. vil: A. vilmorinianum Komarov, A. del: A. delavayi Franchet, A. epi: A. episcopale H. Léveillé, A. hem: A. hemsleyanum E. Pritzel, A. con: A. contortum Finet & Gagnepain.
Table 2. A list of genes found in the chloroplast genomes of five Aconitum species.
Table 2. A list of genes found in the chloroplast genomes of five Aconitum species.
CategoryGrope of GenesName of Genes
Transcription and translationRibosomal proteins (LSU)rpl2*(×2), rpl14, rpl16, rpl20, rpl22, rpl23(×2), rpl33, rpl36
Ribosomal proteins (SSU)rps2, rps3, rps4, rps7(×2), rps8, rps11, rps12**(×2), rps14, rps15, rps18, ψrps19
RNA polymeraserpoA, rpoB, rpoC1*, rpoC2
Translational initiation factorinfA
rRNA genesrrn16(×2), rrn23(×2), rrn4.5(×2), rrn5(×2)
tRNA genestrnA-UGC*(×2), trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnfM-CAU, trnG-GCC*, trnG-UCC, trnH-GUG, trnI-CAU(×2), trnI-GAU*(×2), trnK-UUU*, trnL-CAA(×2), trnL-UAA*, trnL-UAG, trnM-CAU, trnN-GUU(×2), trnP-UGG, trnQ-UUG, trnR-ACG(×2), trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU, trnT-UGU, trnV-GAC(×2), trnV-UAC*, trnW-CCA, trnY-GUA
PhotosynthesisPhotosystem IpsaA, psaB, psaC, psaI, psaJ
Photosystem IIpsbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ
NADH oxidoreductasendhA*, ndhB*(×2), ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK
Cytochrome b6/f complexpetA*, petB*, petD, petG, petL, petN
ATP synthaseatpA, atpB, atpE, atpF*, atpH, atpI
Rubisco large subunitrbcL
ATP-dependent protease subunit geneclpP**
Other genesMaturasematK
Envelop membrane proteincemA
Subunit Acetyl- CoA-CarboxylateaccD
c-type cytochrome synthesis geneccsA
UnknownConserved Open reading framesψycf1, ycf2(×2), ycf3**, ycf4, ycf15(×2)
* contains one intron, ** contains two introns, (×2) shows genes duplicated in the IR regions, ψ shows pseudogenes, A. delavayi did not contain ψrps19, A. episcopale not contanin trnG-UCC.
Table 3. The shared repeats of five Aconitum species.
Table 3. The shared repeats of five Aconitum species.
No.Size (bp)UnitsTypeLocation Region
130TAAAC(A)GGAA(G)AGAGAGGGATTCGAACCCTCGFIGS(psbI,trnS-GCU),
IGS(psbC,trnS-UGA)
252AGAAAAAGAATTGCAATAGCTAAATGG(A)TGA(G)TGA(C)GCAATATCGGTCAGCCATAFpsaB(CDS),psaA(CDS)
339CAGAACCGTACATGAGATTTTCACCTCATACGGCTCCTCFycf3(intron),
IGS(rps12,trnV-GAC)
431CC(G)ATATTGATGATAGTGAC(G)GATATT(C)GATGAFycf2(CDS)
542TGGTTGTTCGCCGTTCAAGAATTCTTGAACGGCGAACAACCAFycf15(CDS)
631ATCATCG(A)ATATCC(G)TCACTATCATCAATATC(G)GFycf2(CDS)
732GAGATTTTATTTCG(A)AATTTGAAATAAAATCTCPIGS(psbI,trnS-GCU)
830ACGGAAAGAGAGGGATTCGAACCCTCGGTAPIGS(psbI,trnS-GCU),
IGS(trnS-GGA,rps4)
930AA(C)GGAG(A)AGAGAGGGATTCGAACCCTCGA(G)TAPIGS(trnSUGA,psbZ),
IGS(trnS-GGA,rps4)
1039CAGAACCGTACATGAGATTTTCACCTCATACGGCTCCTCPycf3(intron),
IGS(trnV-GAC,rps12)
1172GTAAGAATAAGAACTCAATGGACCTTGCCCCTCG(A)AATTT(C)GAGGGGCAAGGTCCATTGAGTTCTTATTCTTACPIGS(petA,psbJ)
1248ATGTATCTAGGGACTAGTCGCTTC(G)C(G)AAGCGACTAGTCCCTAGATACATPIGS(petD,rpoA)
1331CCATATTGATGATAGTGACGATATTGATGATPycf2(CDS)
1431CGATATTGATGATAGTGAGGATATCGATGATPycf2(CDS)
1542TGGTTGTTCGCCGTTCAAGAATTCTTGAACGGCGAACAACCAPycf15(CDS)
1642TGGTTGTTCGCCGTTCAAGAATTCTTGAACGGCGAACAACCAPycf15(CDS)
1738TACACATGAAGTAAAGAAA×2TIGS(trnS-GCU,trnG-GCC)
1826TTTTATAGTTAAA×2TclpP(intron)
IGS: intergenic spacer regions; CDS: coding DNA sequence.

Share and Cite

MDPI and ACS Style

Meng, J.; Li, X.; Li, H.; Yang, J.; Wang, H.; He, J. Comparative Analysis of the Complete Chloroplast Genomes of Four Aconitum Medicinal Species. Molecules 2018, 23, 1015. https://doi.org/10.3390/molecules23051015

AMA Style

Meng J, Li X, Li H, Yang J, Wang H, He J. Comparative Analysis of the Complete Chloroplast Genomes of Four Aconitum Medicinal Species. Molecules. 2018; 23(5):1015. https://doi.org/10.3390/molecules23051015

Chicago/Turabian Style

Meng, Jing, Xuepei Li, Hongtao Li, Junbo Yang, Hong Wang, and Jun He. 2018. "Comparative Analysis of the Complete Chloroplast Genomes of Four Aconitum Medicinal Species" Molecules 23, no. 5: 1015. https://doi.org/10.3390/molecules23051015

Article Metrics

Back to TopTop