Maternal Melatonin Therapy Attenuated Maternal High-Fructose Combined with Post-Weaning High-Salt Diets-Induced Hypertension in Adult Male Rat Offspring
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Animal Models
4.2. High-Performance Liquid Chromatography (HPLC)
4.3. Quantitative Real-Time Polymerase Chain Reaction (PCR)
4.4. Western Blot
4.5. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Reiter, R.J.; Mayo, J.C.; Tan, D.X.; Sainz, R.M.; Alatorre-Jimenez, M.; Qin, L. Melatonin as an antioxidant: Under promises but over delivers. J. Pineal Res. 2016, 61, 253–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.C.; Sheen, J.M.; Tiao, M.M.; Tain, Y.L.; Huang, L.T. Roles of melatonin in fetal programming in compromised pregnancies. Int. J. Mol. Sci. 2013, 14, 5380–5401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lardone, P.J.; Alvarez-Sanchez, S.N.; Guerrero, J.M.; Carrillo-Vico, A. Melatonin and glucose metabolism: Clinical relevance. Curr. Pharm. Des. 2014, 20, 4841–4853. [Google Scholar] [PubMed]
- Tain, Y.L.; Huang, L.T.; Chan, J.Y. Transcriptional regulation of programmed hypertension by melatonin: An epigenetic perspective. Int. J. Mol. Sci. 2014, 15, 18484–18495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reiter, R.J.; Tan, D.X.; Rosales-Corral, S.; Galano, A.; Zhou, X.J.; Xu, B. Mitochondria: Central organelles for melatonin’s antioxidant and anti-aging actions. Molecules 2018, 23, 509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scheer, F.A. Potential use of melatonin as adjunct antihypertensive therapy. Am. J. Hypertens. 2005, 18, 1619–1620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, H.; Gusdon, A.M.; Qu, S. Effects of melatonin on cardiovascular diseases: Progress in the past year. Curr. Opin. Lipidol. 2016, 27, 408–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanson, M. The birth and future health of DOHaD. J. Dev. Orig. Health Dis. 2015, 6, 434–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Joles, J.A. Reprogramming: A preventive strategy in hypertension focusing on the kidney. Int. J. Mol. Sci. 2016, 17, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Huang, L.T.; Hsu, C.N. Developmental programming of adult disease: Reprogramming by melatonin? Int. J. Mol. Sci. 2017, 18, 426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Preuss, H.G.; Clouatre, D.; Swaroop, A.; Bagchi, M.; Bagchi, D.; Kaats, G.R. Blood pressure regulation: Reviewing evidence for interplay between common dietary sugars and table salt. J. Am. Coll. Nutr. 2017, 36, 677–684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, R.J.; Segal, M.S.; Sautin, Y.; Nakagawa, T.; Feig, D.I.; Kang, D.H.; Gersch, M.S.; Benner, S.; Sánchez-Lozada, L.G. Potential role of sugar (fructose) in the epidemic of hypertension, obesity and the metabolic syndrome, diabetes, kidney disease, and cardiovascular disease. Am. J. Clin. Nutr. 2007, 86, 899–906. [Google Scholar] [PubMed]
- Tain, Y.L.; Chan, J.Y.; Hsu, C.N. Maternal fructose intake affects transcriptome changes and programmed hypertension in offspring in later life. Nutrients 2016, 8, 757. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Lee, W.C.; Leu, S.; Wu, K.; Chan, J. High salt exacerbates programmed hypertension in maternal fructose-fed male offspring. Nutr. Metab. Cardiovasc. Dis. 2015, 25, 1146–1151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jansson, T.; Powell, T.L. Role of placental nutrient sensing in developmental programming. Clin. Obstet. Gynecol. 2013, 56, 591–601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Interplay between oxidative stress and nutrient sensing signaling in the developmental origins of cardiovascular disease. Int. J. Mol. Sci. 2017, 18, 481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Targeting on asymmetric dimethylarginine-related nitric oxide-reactive oxygen species imbalance to reprogram the development of hypertension. Int. J. Mol. Sci. 2016, 17, 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Chan, S.H.H.; Chan, J.Y.H. Biochemical basis for pharmacological intervention as a reprogramming strategy against hypertension and kidney disease of developmental origin. Biochem. Pharmacol. 2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Efeyan, A.; Comb, W.C.; Sabatini, D.M. Nutrient-sensing mechanisms and pathways. Nature 2015, 517, 302–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, Y.C.; Guan, K.L. mTOR: A pharmacologic target for autophagy regulation. J. Clin. Investig. 2015, 125, 25–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tebay, L.E.; Robertson, H.; Durant, S.T.; Vitale, S.R.; Penning, T.M.; Dinkova-Kostova, A.T.; Hayes, J.D. Mechanisms of activation of the transcription factor Nrf2 by redox stressors, nutrient cues, and energy status and the pathways through which it attenuates degenerative disease. Free Radic. Biol. Med. 2015, 88, 108–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Leu, S.; Wu, K.L.; Lee, W.C.; Chan, J.Y. Melatonin prevents maternal fructose intake-induced programmed hypertension in the offspring: Roles of nitric oxide and arachidonic acid metabolites. J. Pineal Res. 2014, 57, 80–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lineker, C.; Kerr, P.M.; Nguyen, P.; Bloor, I.; Astbury, S.; Patel, N.; Budge, H.; Hemmings, D.G.; Plane, F.; Symonds, M.E.; et al. High fructose consumption in pregnancy alters the perinatal environment without increasing metabolic disease in the offspring. Reprod. Fertil. Dev. 2016, 28, 2007–2015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, S.; McNeill, J.H. Fructose-induced hypertension in rats is concentration- and duration-dependent. J. Pharmacol. Toxicol. Methods 1995, 33, 101–107. [Google Scholar] [CrossRef] [Scilit]
- Alzamendi, A.; Castrogiovanni, D.; Gaillard, R.C.; Spinedi, E.; Giovambattista, A. Increased male offspring’s risk of metabolic-neuroendocrine dysfunction and overweight after fructose-rich diet intake by the lactating mother. Endocrinology 2010, 151, 4214–4223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Lin, I.C.; Yu, H.R.; Huang, L.T.; Hsu, C.N. Resveratrol prevents the combined maternal plus postweaning high-fat-diets-induced hypertension in male offspring. J. Nutr. Biochem. 2017, 48, 120–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayo, J.C.; Sainz, R.M.; González Menéndez, P.; Cepas, V.; Tan, D.X.; Reiter, R.J. Melatonin and sirtuins: A “not-so unexpected” relationship. J. Pineal Res. 2017, 62, e12391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N.; Chan, J.Y. PPARs link early life nutritional insults to later programmed hypertension and metabolic syndrome. Int. J. Mol. Sci. 2016, 17, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamblin, M.; Chang, L.; Zhang, J.; Chen, Y.E. The role of peroxisome proliferator-activated receptor in blood pressure regulation. Curr. Hypertens. Rep. 2009, 11, 239–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koh, P.O. Melatonin prevents ischemic brain injury through activation of the mTOR/p70S6 kinase signaling pathway. Neurosci. Lett. 2008, 444, 74–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, Q.; Xing, W.; Su, F.; Liang, X.; Tian, F.; Gao, F.; Wang, S.; Zhang, H. Tetrahydroxystilbene glycoside improves microvascular endothelial dysfunction and ameliorates obesity-associated hypertension in obese zdf rats via inhibition of endothelial autophagy. Cell Physiol. Biochem. 2017, 43, 293–307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mei, Y.; Thompson, M.D.; Cohen, R.A.; Tong, X. Autophagy and oxidative stress in cardiovascular diseases. Biochim. Biophys. Acta 2015, 1852, 243–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koeners, M.P.; van Faassen, E.E.; Wesseling, S.; de Sain-van der Velden, M.; Koomans, H.A.; Braam, B.; Joles, J.A. Maternal supplementation with citrulline increases renal nitric oxide in young spontaneously hypertensive rats and has long-term antihypertensive effects. Hypertension 2007, 50, 1077–1084. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.J.; Hsu, C.N.; Lo, M.H.; Huang, C.F.; Chien, S.J.; Tain, Y.L. High citrulline-to-arginine ratio associated with blood pressure abnormalities in children with early chronic kidney disease. Circ. J. 2013, 77, 181–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Toxic dimethylarginines: Asymmetric dimethylarginine (ADMA) and symmetric dimethylarginine (SDMA). Toxins 2017, 9, 92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Huang, L.T.; Lin, I.C.; Lau, Y.T.; Lin, C.Y. Melatonin prevents hypertension and increased asymmetric dimethylarginine in young spontaneous hypertensive rats. J. Pineal Res. 2010, 49, 390–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.L.; Lin, I.C.; Yu, H.R.; Sheen, J.M.; Huang, L.T.; Tain, Y.L. Early postweaning treatment with dimethyl fumarate prevents prenatal dexamethasone and postnatal high fat diet induced programmed hypertension in male rat offspring. Oxid. Med. Cell Longev. 2018, 2018. [Google Scholar] [CrossRef] [Scilit]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Chen, C.C.; Sheen, J.M.; Yu, H.R.; Tiao, M.M.; Kuo, H.C.; Huang, L.T. Melatonin attenuates prenatal dexamethasone-induced blood pressure increase in a rat model. J. Am. Soc. Hypertens. 2014, 8, 216–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |



| Groups | ND/ND | HF/ND | ND/HS | HF/HS | HF/HS+M |
|---|---|---|---|---|---|
| Mortality | 0% | 0% | 0% | 0% | 0% |
| BW (g) | 432 ± 15 | 432 ± 20 | 492 ± 8 a,b | 479 ± 13 a,b | 435 ± 15 c,d |
| Left kidney weight (g) | 1.67 ± 0.11 | 1.75 ± 0.08 | 2.14 ± 0.05 a,b | 2.19 ± 0.08 a,b | 1.81 ± 0.09 c,d |
| Left kidney weight/100 g BW | 0.39 ± 0.02 | 0.41 ± 0.01 | 0.44 ± 0.01 | 0.46 ± 0.01 | 0.42 ± 0.01 |
| Systolic blood pressure (mm Hg) | 135 ± 2 | 154 ± 3 a | 162 ± 1 a | 174 ± 2 a,b | 152 ± 1 b,c,d |
| Diastolic blood pressure (mm Hg) | 82 ± 2 | 80 ± 2 | 85 ± 2 | 97 ± 6 a,b,c | 72 ± 3 a,b,c,d |
| Mean arterial pressure (mm Hg) | 100 ± 1 | 105 ± 1 a | 111 ± 2 a | 122 ± 4 a,b,c | 99 ± 2 b,c,d |
| Groups | ND/ND | HF/ND | ND/HS | HF/HS | HF/HS+M |
|---|---|---|---|---|---|
| l-citrulline | 57.2 ± 1.1 | 49.1 ± 1.6 | 95.2 ± 2.8 a,b | 85.8 ± 1.8 a,b | 45 ± 1.6 c,d |
| l-arginine | 288.3 ± 6.7 | 208 ± 5.8 a | 285.2 ± 3.0 b | 287.4 ± 5.8 b | 221.9 ± 2.7 a,c,d |
| ADMA | 1.01 ± 0.03 | 1.05 ± 0.05 | 2.34 ± 0.04 a,b | 2.3 ± 0.09 a,b | 1.48 ± 0.09 c,d |
| SDMA | 0.61 ± 0.01 | 0.59 ± 0.01 | 3.12 ± 0.12 a,b | 2.84 ± 0.08 a,b | 0.55 ± 0.04 c,d |
| l-arginine-to-ADMA ratio | 226.2 ± 3.0 | 201.9 ± 11.3 | 123.1 ± 2.6 a,b | 128.9 ± 3.8 a,b | 191 ± 24 c,d |
| Gene | Forward | Reverse |
|---|---|---|
| Sirt1 | 5 tggagcaggttgcaggaatcca 3 | 5 tggcttcatgatggcaagtggc 3 |
| Sirt4 | 5 ccctttggaccatgaaaaga 3 | 5 cggatgaaatcaatgtgctg 3 |
| Prkaa2 | 5 agctcgcagtggcttatcat 3 | 5 ggggctgtctgctatgagag3 |
| Prkab2 | 5 cagggccttatggtcaagaa 3 | 5 cagcgcatagagatggttca 3 |
| Prkag2 | 5 gtgtgggagaagctctgagg 3 | 5 agaccacacccagaagatgc 3 |
| Ppara | 5 agaagttgcaggaggggatt 3 | 5 ttcttgatgacctgcacgag 3 |
| Pparrb | 5 gatcagcgtgcatgtgttct 3 | 5 cagcagtccgtctttgttga 3 |
| Pparg | 5 ctttatggagcctaagtttgagt 3 | 5 gttgtcttggatgtcctcg 3 |
| Ppargc1a | 5 cccattgagggctgtgatct 3 | 5 tcagtgaaatgccggagtca 3 |
| Nrf2 | 5 cccattgagggctgtgatct 3 | 5 tcagtgaaatgccggagtca 3 |
| Rn18s | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Leu, S.; Lee, W.-C.; Wu, K.L.H.; Chan, J.Y.H. Maternal Melatonin Therapy Attenuated Maternal High-Fructose Combined with Post-Weaning High-Salt Diets-Induced Hypertension in Adult Male Rat Offspring. Molecules 2018, 23, 886. https://doi.org/10.3390/molecules23040886
Tain Y-L, Leu S, Lee W-C, Wu KLH, Chan JYH. Maternal Melatonin Therapy Attenuated Maternal High-Fructose Combined with Post-Weaning High-Salt Diets-Induced Hypertension in Adult Male Rat Offspring. Molecules. 2018; 23(4):886. https://doi.org/10.3390/molecules23040886
Chicago/Turabian StyleTain, You-Lin, Steve Leu, Wei-Chia Lee, Kay L. H. Wu, and Julie Y. H. Chan. 2018. "Maternal Melatonin Therapy Attenuated Maternal High-Fructose Combined with Post-Weaning High-Salt Diets-Induced Hypertension in Adult Male Rat Offspring" Molecules 23, no. 4: 886. https://doi.org/10.3390/molecules23040886
APA StyleTain, Y.-L., Leu, S., Lee, W.-C., Wu, K. L. H., & Chan, J. Y. H. (2018). Maternal Melatonin Therapy Attenuated Maternal High-Fructose Combined with Post-Weaning High-Salt Diets-Induced Hypertension in Adult Male Rat Offspring. Molecules, 23(4), 886. https://doi.org/10.3390/molecules23040886

