The Tryptophan Decarboxylase in Solanum lycopersicum
Abstract
1. Introduction
2. Results
2.1. The Tomato Genome Encoded Five SlTrpDC Genes
2.2. Sequence Analysis and Homology Modeling of the SlTrpDC Proteins
2.3. Phylogenetic Relationships and Structural Characteristics
2.4. Differential Expression Profiles of SlTrpDC Genes Based on RNA-seq and qRT-PCR
3. Discussion
4. Materials and Methods
4.1. Identification of the TrpDC Genes Family in Tomato
4.2. Sequence Features
4.3. Structural Characteristics and Phylogenetic Relationships
4.4. Expression Analysis of the SlTrpDC Genes Based on RNA-seq and Quantitative Real-Time PCR
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Manchester, L.C.; Tan, D.X.; Reiter, R.J.; Park, W.; Monis, K.; Qi, K. High levels of melatonin in the seeds of edible plants: Possible function in germ tissue protection. Life Sci. 2000, 67, 3023–3029. [Google Scholar] [CrossRef] [Scilit]
- Van Tassel, D.L.; Roberts, N.; Lewy, A.; O’Neill, S.D. Melatonin in plant organs. J. Pineal Res. 2001, 31, 8–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Islam, M.N.; Downey, F.; Ng, C.K.Y. Comparative analysis of bioactive phytochemicals from Scutellaria baicalensis, Scutellaria lateriflora, Scutellaria racemosa, Scutellaria tomentosa and Scutellaria wrightii by LC-DAD-MS. Metabolomics 2011, 7, 446–453. [Google Scholar] [CrossRef] [Scilit]
- Dubbels, R.; Reiter, R.J.; Klenke, E.; Goebel, A.; Schnoakenberg, E.; Ehlers, C.; Schiwara, H.W.; School, W. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hattoti, A.; Miqitaka, H.; Liqo, M.; Iton, M.; Yamamoto, K.; Ohtani-kaneko, R.; Hara, M.; Suzuki, K.; Reiter, R.J. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 1995, 35, 627–634. [Google Scholar]
- Pöggeler, B.; Balzer, I.; Hardeland, R.; Lerchl, A. Pineal hormone melatonin oscillates also in the dinoflagellate Gonyaulax polyedra. Naturwissenschaften 1991, 78, 268–269. [Google Scholar] [CrossRef] [Scilit]
- Machácčková, I.; Krekule, J. Sixty-five years of searching for the signals that trigger flowering. Russ. J. Plant Physiol. 2002, 49, 451–459. [Google Scholar] [CrossRef] [Scilit]
- Kolář, J.; Johnson, C.H.; Macháčková, I. Exogenously applied melatonin (N-acetyl-5-methoxytryptamine) affects flowering of the short-day plant Chenopodium rubrum. Physiol. Plant. 2003, 118, 605–612. [Google Scholar] [CrossRef] [Scilit]
- Tan, D.X.; Manchester, L.C.; Reiter, R.J.; Qi, W.B.; Karbownik, M.; Calvo, J.R. Significance of melatonin in antioxidative defense system: Reactions and products. Biol. Signals Recept. 2000, 9, 137–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Tassel, D.L.; O’Neill, S.D. Putative regulatory molecules in plants: Evaluating melatonin. J. Pineal Res. 2001, 31, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cano, A.; Alcaraz, O.; Arnao, M.B. Free radical-scavenging activity of indolic compounds in aqueous and ethanolic media. Anal. Bioanal. Chem. 2003, 376, 33–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, D.X.; Manchester, L.C.; Helton, P.; Reiter, R.J. Phytoremediative capacity of plants enriched with melatonin. Plant Signal. Behav. 2007, 2, 514–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.J.; Zhang, N.; Yang, R.C.; Wang, L.; Sun, Q.Q.; Li, D.B.; Cao, Y.Y.; Weeda, S.; Zhao, B.; Ren, S.; et al. Melatonin promotes seed germination under high salinity by regulating antioxidant systems, ABA and GA interaction in cucumber (Cucumis sativus L.). J. Pineal Res. 2014, 57, 269–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, H.T.; Tan, D.X.; Reiter, R.J.; Ye, T.T.; Yang, F.; Chan, Z.L. Melatonin induces class A1 heat-shock factors (HSFA1s) and their possible involvement of thermotolerance in Arabidopsis. J. Pineal Res. 2015, 58, 335–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.Y.; Byeon, Y.; Back, K. Melationin as a signal molecule triggering defense responses against pathogen attack in Arabidopsis and tobacco. J. Pineal Res. 2014, 57, 262–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, H.B.; Xu, L.F.; Su, T.; Jiang, Y.; Hu, L.Y.; Ma, F.W. Melatonin regulates carbohydrate metabolism and defenses against Pseudomonas syringae pv. tomato DC3000 infection in Arabidopsis thaliana. J. Pineal Res. 2015, 59, 109–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernández-Ruiz, J.; Cano, A.; Arnao, M.B. Melatonin: A growth-stimulating compound present in lupin tissues. Planta 2004, 220, 140–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernández-Ruiz, J.; Cano, A.; Arnao, M.B. Melatonin acts as a growth-stimulating compound in some monocot species. J. Pineal Res. 2005, 39, 137–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Melatonin promotes adventitious-and lateral root regeneration in etiolated hypocotyls of Lupinus albus L. J. Pineal Res. 2007, 42, 147–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Byeon, Y.; Back, K. An increase in melatonin in transgenic rice causes pleiotropic phenotypes, including enhanced seedling growth, delayed flowering, and low grain yield. J. Pineal Res. 2014, 56, 408–414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, W.; Li, Q.T.; Chu, Y.N.; Reiter, R.J.; Yu, X.M.; Zhu, D.H.; Zhang, W.K.; Ma, B.; Lin, Q.; Zhang, J.S.; et al. Melatonin enhances plants growth and abiotic stress tolerance in soybean plants. J. Exp. Bot. 2015, 66, 695–707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kolár, J.; Machácková, I. Melatonin in higher plants: Occurrence and possible functions. J. Pineal Res. 2005, 39, 333–341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Q.; Qi, W.B.; Reiter, R.J.; Wei, W.; Wang, B.M. Exogenously applied melatonin stimulates root growth and raises endogenous indoleacetic acid in roots of etiolated seedlings of Brassica juncea. J. Plant Physiol. 2009, 166, 324–328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, P.; Sun, X.; Li, C.; Wei, Z.; Liang, D.; Ma, F. Long-term exogenous application of melatonin delays drought-induced leaf senescence in apple. J. Pineal Res. 2013, 54, 292–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, L.; Wang, P.; Li, M.; Ke, X.; Li, C.; Liang, D.; Wu, S.; Ma, X.; Li, C.; Zou, Y.; et al. Exogenous melatonin improves Malus resistance to Marssonina apple blotch. J. Pineal Res. 2013, 54, 426–434. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Posmyk, M.M.; Janas, K.M. Melatonin in plants. Acta Physiol. Plant. 2009, 31, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Schröder, P.; Abele, C.; Gohr, P.; Stuhlfauth-Roisch, U.; Grosse, W. Latest on enzymology of serotonin biosynthesis in walnut seeds. Adv. Exp. Med. Biol. 1999, 467, 637–644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murch, S.; Krishnaraj, S.; Saxena, P.K. Tryptophan is a precursor for melatonin and serotonin biosynthesis in in vitro regenerated St. John’s wort (Hypericum perforatum L. cv. Anthos) plants. Plant Cell Rep. 2000, 19, 698–704. [Google Scholar] [CrossRef] [Scilit]
- Songstad, D.D.; De, L.V.; Brisson, N.; Kurz, W.G.; Nessler, C.L. High levels of tryptamine accumulation in transgenic tobacco expressing tryptophan decarboxylase. Plant Physiol. 1990, 94, 1410–1413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, S.; Kang, K.; Lee, K.; Back, K. Characterization of rice tryptophan decarboxylases and their direct involvement in serotonin biosynthesis in transgenic rice. Planta 2007, 227, 263–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, K.; Kang, S.; Lee, K.; Park, M.; Back, K. Enzymatic features of serotonin biosynthetic enzymes and serotonin biosynthesis in plants. Plant Signal. Behav. 2008, 3, 389–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okazaki, M.; Ezura, H. Profiling of melatonin in the model tomato (Solanum lycopersicum L.) cultivar Micro-Tom. J. Pineal Res. 2009, 46, 338–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Q.Q.; Zhang, N.; Wang, J.F.; Zhang, H.J.; Li, D.B.; Shi, J.; Li, R.; Weeda, S.; Zhao, B.; Ren, S.X.; et al. Melatonin promotes ripening and improves quality of tomato fruit during postharvest life. J. Exp. Bot. 2015, 66, 657–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Growth conditions influence the melatonin content of tomato plants. Food Chem. 2013, 138, 1212–1214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Cai, S.; Yin, L.; Shi, K.; Xia, X.; Zhou, Y.; Yu, J.; Zhou, J. Tomato HsfA1a plays a critical role in plant drought tolerance by activating ATG genes and inducing autophagy. Autophagy 2015, 11, 2033–2047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, W.; Cai, S.Y.; Zhang, Y.; Wang, Y.; Ahammed, G.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Yu, J.Q.; Reiter, R.J.; et al. Melatonin enhances thermotolerance by promoting cellular protein protection in tomato plants. J. Pineal Res. 2016, 61, 457–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hasan, M.K.; Ahammed, G.J.; Yin, L.; Shi, K.; Xia, X.; Zhou, Y.; Yu, J.; Zhou, J. Melatonin mitigates cadmium phytotoxicity through modulation of phytochelatins biosynthesis, vacuolar sequestration, and antioxidant potential in Solanum lycopersicum L. Front. Plant Sci. 2015, 6, 601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.Q.; Hasan, M.K.; Li, C.X.; Ahammed, G.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Reiter, R.J.; Yu, J.Q.; Xu, M.X.; et al. Melatonin mediates selenium-induced tolerance to cadmium stress in tomato plants. J. Pineal Res. 2016, 61, 291–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, S.Y.; Zhang, Y.; Xu, Y.P.; Qi, Z.Y.; Li, M.Q.; Ahammed, G.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Reiter, R.J.; et al. HsfA1a upregulates melatonin biosynthesis to confer cadmium tolerance in tomato plants. J. Pineal Res. 2017, 62, e12387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Kishino, H. Genomic background predicts the fate of duplicated genes: Evidence from the yeast genome. Genetics 2004, 166, 1995–1999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ozsolak, F.; Milos, P.M. RNA sequencing: Advances, challenges and opportunities. Nat. Rev. Genet. 2010, 12, 87–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saeed, A.I.; Sharov, V.; White, J.; Li, J.; Liang, W.; Bhagabati, N.; Braisted, J.; Klapa, M.; Currier, T.; Thiagarajan, M.; et al. TM4: A free, open-source system for microarray data management and analysis. Biotechniques 2003, 34, 374–378. [Google Scholar] [PubMed]
- Yamazaki, Y.; Sudo, H.; Yamazaki, M.; Aimi, N.; Saito, K. Camptothecin biosynthetic genes in hairy roots of Ophiorrhiza pumila: Cloning, characterization and differential expression in tissues and by stress compounds. Plant Cell Physiol. 2003, 44, 395–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mano, Y.; Nemoto, K. The pathway of auxin biosynthesis in plants. J. Exp. Bot. 2012, 63, 2853–2872. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Y.; Tan, D.X.; Lei, Q.; Chen, H.; Wang, L.; Li, Q.T.; Gao, Y.; Kong, J. Melatonin and its potential biological functions in the fruits of sweet cherry. J. Pineal Res. 2013, 55, 79–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guex, N.; Peitsch, M.C. SWISS-MODEL and the Swiss-Pdb Viewer: An environment for comparative protein modeling. Electrophoresis 1997, 18, 2714–2723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Expósito-Rodríguez, M.; Borges, A.A.; Borges-Pérez, A.; Pérez, J.A. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process. BMC Plant Biol. 2008, 8, 131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Sample Availability: Not available. |




| Gene Name | Gene ID | Location of Genes | Number of Exons | Gene Length (bp) | Protein Size (aa) | MW (kDa) | pI |
|---|---|---|---|---|---|---|---|
| SlTrpDC1 | Solyc07g054860.1.1 | Chr07:63043532-63045046 | 0 | 1515 | 504 | 56.54 | 6.28 |
| SlTrpDC2 | Solyc07g054280.1.1 | Chr07:62627192-62628707 | 0 | 1515 | 504 | 56.76 | 5.72 |
| SlTrpDC3 | Solyc09g064430.2.1 | Chr09:61653029-61660029 | 11 | 7579 | 487 | 54.47 | 5.73 |
| SlTrpDC4 | Solyc03g044120.1.1 | Chr03:8136445-8137928 | 1 | 1484 | 476 | 53.23 | 6.83 |
| SlTrpDC5 | Solyc03g045020.2.1 | Chr03:11305456-11307004 | 4 | 1514 | 374 | 41.73 | 5.81 |
| Name | SlTDC1 | SlTDC2 | SlTDC3 | SlTDC4 | SlTDC5 |
|---|---|---|---|---|---|
| SlTDC1 | 100% | ||||
| SlTDC2 | 98.8% | ||||
| SlTDC3 | 56.2% | 57.1% | |||
| SlTDC4 | 60.1% | 60.1% | 57.4% | ||
| SlTDC5 | 60.7% | 60.1% | 60.4% | 71.6% | 100% |
| Gene | Name | Primer Sequence (5′-3′) |
|---|---|---|
| Solyc07g054860.1.1 | SlTDC1 | F: GCTGCACGTGATCGTAAACT R: GCAGCAACATCAGCTTCAAT |
| Solyc07g054280.1.1 | SlTDC2 | F: TTTCCTCTGTGCTACCGTTG R: GTGGGCTTAGGCTTAACGAG |
| Solyc09g064430.2.1 | SlTDC3 | F: GGTCAAGGAGGTGGAGTGAT R: AGAGCATAATCCCTGGATGG |
| Solyc03g044120.1.1 | SlTDC4 | F: CCCTGCTGCTACTGAACTTG R: CATTTGATCTCTAGCCGCAA |
| Solyc03g045020.2.1 | SlTDC5 | F: GGTACATGTTGATGCAGCGT R: ACCACCTGTTGGGATTCACT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pang, X.; Wei, Y.; Cheng, Y.; Pan, L.; Ye, Q.; Wang, R.; Ruan, M.; Zhou, G.; Yao, Z.; Li, Z.; et al. The Tryptophan Decarboxylase in Solanum lycopersicum. Molecules 2018, 23, 998. https://doi.org/10.3390/molecules23050998
Pang X, Wei Y, Cheng Y, Pan L, Ye Q, Wang R, Ruan M, Zhou G, Yao Z, Li Z, et al. The Tryptophan Decarboxylase in Solanum lycopersicum. Molecules. 2018; 23(5):998. https://doi.org/10.3390/molecules23050998
Chicago/Turabian StylePang, Xin, Yanping Wei, Yuan Cheng, Luzhao Pan, Qingjing Ye, Rongqing Wang, Meiying Ruan, Guozhi Zhou, Zhuping Yao, Zhimiao Li, and et al. 2018. "The Tryptophan Decarboxylase in Solanum lycopersicum" Molecules 23, no. 5: 998. https://doi.org/10.3390/molecules23050998
APA StylePang, X., Wei, Y., Cheng, Y., Pan, L., Ye, Q., Wang, R., Ruan, M., Zhou, G., Yao, Z., Li, Z., Yang, Y., Liu, W., & Wan, H. (2018). The Tryptophan Decarboxylase in Solanum lycopersicum. Molecules, 23(5), 998. https://doi.org/10.3390/molecules23050998
