Mesenchymal Stem Cell-Conditioned Media Regulate Steroidogenesis and Inhibit Androgen Secretion in a PCOS Cell Model via BMP-2
Abstract
1. Introduction
2. Results
2.1. Effect of BMP-2 on H295R Cell Proliferation and Survival
2.2. Effect of BMP-2 on PCOS-Related Parameters in H295R Cells
2.3. Estimation of BMP-2 Secretion by BM-hMSCs
2.4. Effect of BM-hMSCs on Ovarian Tissue
3. Discussion
4. Materials and Methods
4.1. Human Mesenchymal Stem Cell Culture
4.2. Human Adrenocortical Carcinoma Cell Line (H295R) Culture
4.3. Collection of Secretome from BM-hMSCs
4.4. Treatment of H295R Cells with BMP-2
4.5. Effect of BMP-2 on H295R Cells
4.6. ELISA for BMP-2
4.7. Neutralization of BMP-2 in Conditioned Media
4.8. Knockdown of BMP-2 in Mesenchymal Stem Cells
4.9. Quantitative RT-PCR
4.10. Western Blot Analysis
4.11. PCOS Mouse Model and Intra-Ovarian Injection of BM-hMSC
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BM-hMSC | Bone marrow-derived human mesenchymal stem cell |
| PCOS | Polycystic ovary syndrome |
| BMP2 | Bone morphogenetic proteins 2 |
| ELISA | Enzyme-linked immunosorbent assay |
| qRT-PCR | Quantitative real-time polymerase chain reaction |
| IHC | Immunohistochemistry |
| IL-1β | Interleukin-1 beta |
| IL-6 | Interleukin-6 |
| MSC CM | Mesenchymal stem cell conditioned medium (secretome) |
| FBS | Fetal bovine serum |
| PBS | Phosphate-buffered saline |
| UIC ACC | University of Illinois at Chicago Animal Care Committee |
| LTZ | Letrozole |
| H & E | Hematoxylin–eosin |
References
- Dennett, C.C.; Simon, J. The role of polycystic ovary syndrome in reproductive and metabolic health: Overview and approaches for treatment. Diabetes Spectr. 2015, 28, 116–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosenfield, R.L.; Ehrmann, D.A. The Pathogenesis of Polycystic Ovary Syndrome (PCOS): The Hypothesis of PCOS as Functional Ovarian Hyperandrogenism Revisited. Endocr. Rev. 2016, 37, 467–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- González, F. Inflammation in Polycystic Ovary Syndrome: Underpinning of insulin resistance and ovarian dysfunction. Steroids 2012, 77, 300–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambineri, A.; Patton, L.; Altieri, P.; Pagotto, U.; Pizzi, C.; Manzoli, L.; Pasquali, R. Polycystic ovary syndrome is a risk factor for type 2 diabetes: Results from a long-term prospective study. Diabetes 2012, 61, 2369–2374. [Google Scholar] [CrossRef] [Scilit]
- Scicchitano, P.; Dentamaro, I.; Carbonara, R.; Bulzis, G.; Dachille, A.; Caputo, P.; Riccardi, R.; Locorotondo, M.; Mandurino, C.; Matteo Ciccone, M. Cardiovascular Risk in Women With PCOS. Int. J. Endocrinol. Metab. 2012, 10, 611–618. [Google Scholar] [CrossRef] [Scilit]
- Ding, D.C.; Chen, W.; Wang, J.H.; Lin, S.Z. Association between polycystic ovarian syndrome and endometrial, ovarian, and breast cancer: A population-based cohort study in Taiwan. Medicine (Baltimore) 2018, 97, e12608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Luca, C.; Olefsky, J.M. Inflammation and insulin resistance. FEBS Lett. 2008, 582, 97–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corbould, A. Effects of androgens on insulin action in women: Is androgen excess a component of female metabolic syndrome? Diabetes Metab. Res. Rev. 2008, 24, 520–532. [Google Scholar] [CrossRef] [Scilit]
- Fox, C.W.; Zhang, L.; Sohni, A.; Doblado, M.; Wilkinson, M.F.; Chang, R.J.; Duleba, A.J. Inflammatory Stimuli Trigger Increased Androgen Production and Shifts in Gene Expression in Theca-Interstitial Cells. Endocrinology 2019, 160, 2946–2958. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.Y.; Zhu, F.F.; Zhu, Y.J.; Hu, Y.J.; Chen, X. Effects of IL-18 on the proliferation and steroidogenesis of bovine theca cells: Possible roles in the pathogenesis of polycystic ovary syndrome. J. Cell. Mol. Med. 2021, 25, 1128–1139. [Google Scholar] [CrossRef] [Scilit]
- Rojas, J.; Chávez, M.; Olivar, L.; Rojas, M.; Morillo, J.; Mejías, J.; Calvo, M.; Bermúdez, V. Polycystic Ovary Syndrome, Insulin Resistance, and Obesity: Navigating the Pathophysiologic Labyrinth. Int. J. Reprod. Med. 2014, 2014, 719050. [Google Scholar] [CrossRef] [Scilit]
- Lang, Q.; Yidong, X.; Xueguang, Z.; Sixian, W.; Wenming, X.; Tao, Z. ETA-mediated anti-TNF-α therapy ameliorates the phenotype of PCOS model induced by letrozole. PLoS ONE 2019, 14, e0217495. [Google Scholar] [CrossRef] [Scilit]
- Momin, E.N.; Mohyeldin, A.; Zaidi, H.A.; Vela, G.; Quiñones-Hinojosa, A. Mesenchymal stem cells: New approaches for the treatment of neurological diseases. Curr. Stem Cell Res. Ther. 2010, 5, 326–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeong, H.; Yim, H.W.; Park, H.J.; Cho, Y.; Hong, H.; Kim, N.J.; Oh, I.H. Mesenchymal Stem Cell Therapy for Ischemic Heart Disease: Systematic Review and Meta-analysis. Int. J. Stem Cells 2018, 11, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moreira, A.; Kahlenberg, S.; Hornsby, P. Therapeutic potential of mesenchymal stem cells for diabetes. J. Mol. Endocrinol. 2017, 59, R109–R120. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.; Ma, J.; Han, J.; Zhang, W.; Ma, J. Mesenchymal stem cell related therapies for cartilage lesions and osteoarthritis. Am. J. Transl. Res. 2019, 11, 6275–6289. [Google Scholar]
- Driscoll, J.; Patel, T. The mesenchymal stem cell secretome as an acellular regenerative therapy for liver disease. J. Gastroenterol. 2019, 54, 763–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vizoso, F.J.; Eiro, N.; Cid, S.; Schneider, J.; Perez-Fernandez, R. Mesenchymal Stem Cell Secretome: Toward Cell-Free Therapeutic Strategies in Regenerative Medicine. Int. J. Mol. Sci. 2017, 18, 1852. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.; Li, X.; Zhang, Y.; Han, Y.; Chang, F.; Ding, J. Mesenchymal Stem Cells for Regenerative Medicine. Cells 2019, 8, 886. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Huang, X.; Wang, H.; Liu, X.; Zhang, T.; Wang, Y.; Hu, D. The challenges and promises of allogeneic mesenchymal stem cells for use as a cell-based therapy. Stem Cell Res. Ther. 2015, 6, 234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, X.-L.; Zhang, Y.; Li, X.; Fu, Q.-L. Mechanisms underlying the protective effects of mesenchymal stem cell-based therapy. Cell Mol. Life Sci. 2020, 77, 2771–2794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrell, C.R.; Fellabaum, C.; Jovicic, N.; Djonov, V.; Arsenijevic, N.; Volarevic, V. Molecular Mechanisms Responsible for Therapeutic Potential of Mesenchymal Stem Cell-Derived Secretome. Cells 2019, 8, 467. [Google Scholar] [CrossRef] [Scilit]
- Chapel, A.; Bertho, J.M.; Bensidhoum, M.; Fouillard, L.; Young, R.G.; Frick, J.; Demarquay, C.; Cuvelier, F.; Mathieu, E.; Trompier, F.; et al. Mesenchymal stem cells home to injured tissues when co-infused with hematopoietic cells to treat a radiation-induced multi-organ failure syndrome. J. Gene Med. 2003, 5, 1028–1038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caplan, A.I. Why are MSCs therapeutic? New data: New insight. J. Pathol. 2009, 217, 318–324. [Google Scholar] [CrossRef] [Scilit]
- Ullah, M.; Liu, D.D.; Thakor, A.S. Mesenchymal Stromal Cell Homing: Mechanisms and Strategies for Improvement. iScience 2019, 15, 421–438. [Google Scholar] [CrossRef] [Scilit]
- Salgado, A.J.; Reis, R.L.; Sousa, N.J.; Gimble, J.M. Adipose tissue derived stem cells secretome: Soluble factors and their roles in regenerative medicine. Curr. Stem Cell Res. Ther. 2010, 5, 103–110. [Google Scholar] [CrossRef] [Scilit]
- Sun, D.Z.; Abelson, B.; Babbar, P.; Damaser, M.S. Harnessing the mesenchymal stem cell secretome for regenerative urology. Nat. Rev. Urol. 2019, 16, 363–375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hmadcha, A.; Martin-Montalvo, A.; Gauthier, B.R.; Soria, B.; Capilla-Gonzalez, V. Therapeutic Potential of Mesenchymal Stem Cells for Cancer Therapy. Front. Bioeng. Biotechnol. 2020, 8, 43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Q.; Xiong, X.; Xiao, N.; He, K.; Chen, M.; Peng, J.; Su, X.; Mei, H.; Dai, Y.; Wei, D.; et al. Mesenchymal Stem Cells Alleviate DHEA-Induced Polycystic Ovary Syndrome (PCOS) by Inhibiting Inflammation in Mice. Stem Cells Int. 2019, 2019, 9782373. [Google Scholar] [CrossRef] [Scilit]
- Kalhori, Z.; Azadbakht, M.; Soleimani Mehranjani, M.; Shariatzadeh, M.A. Improvement of the folliculogenesis by transplantation of bone marrow mesenchymal stromal cells in mice with induced polycystic ovary syndrome. Cytotherapy 2018, 20, 1445–1458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marti, N.; Bouchoucha, N.; Sauter, K.S.; Flück, C.E. Resveratrol inhibits androgen production of human adrenocortical H295R cells by lowering CYP17 and CYP21 expression and activities. PLoS ONE 2017, 12, e0174224. [Google Scholar] [CrossRef] [Scilit]
- Kempná, P.; Hofer, G.; Mullis, P.E.; Flück, C.E. Pioglitazone inhibits androgen production in NCI-H295R cells by regulating gene expression of CYP17 and HSD3B2. Mol. Pharmacol. 2007, 71, 787–798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, A.; Magoffin, D.; Munir, I.; Azziz, R. Effect of insulin and testosterone on androgen production and transcription of SULT2A1 in the NCI-H295R adrenocortical cell line. Fertil. Steril. 2009, 92, 793–797. [Google Scholar] [CrossRef] [Scilit]
- Chugh, R.M.; Park, H.S.; El Andaloussi, A.; Elsharoud, A.; Esfandyari, S.; Ulin, M.; Bakir, L.; Aboalsoud, A.; Ali, M.; Ashour, D.; et al. Mesenchymal stem cell therapy ameliorates metabolic dysfunction and restores fertility in a PCOS mouse model through interleukin-10. Stem Cell Res. Ther. 2021, 12, 388. [Google Scholar] [CrossRef] [Scilit]
- Dilogo, I.H.; Fiolin, J.; Aprianto, P. Osteogenic Potency of Secretome Bone Marrow Derived Mesenchymal Stem Cells: A Literature Review. Adv. Sci. Lett. 2018, 24, 6206–6208. [Google Scholar] [CrossRef] [Scilit]
- Polacek, M.; Bruun, J.A.; Elvenes, J.; Figenschau, Y.; Martinez, I. The secretory profiles of cultured human articular chondrocytes and mesenchymal stem cells: Implications for autologous cell transplantation strategies. Cell Transpl. 2011, 20, 1381–1393. [Google Scholar] [CrossRef] [Scilit]
- Yoshino, O.; Shi, J.; Osuga, Y.; Harada, M.; Nishii, O.; Yano, T.; Taketani, Y. The function of bone morphogenetic proteins in the human ovary. Reprod. Med. Biol. 2011, 10, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Hashimoto, O.; Moore, R.K.; Shimasaki, S. Posttranslational processing of mouse and human BMP-15: Potential implication in the determination of ovulation quota. Proc. Natl. Acad. Sci. USA 2005, 102, 5426–5431. [Google Scholar] [CrossRef] [Scilit]
- Otsuka, F.; Inagaki, K. Unique bioactivities of bone morphogenetic proteins in regulation of reproductive endocrine functions. Reprod. Med. Biol. 2011, 10, 131–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Houten, E.L.; Laven, J.S.; Louwers, Y.V.; McLuskey, A.; Themmen, A.P.; Visser, J.A. Bone morphogenetic proteins and the polycystic ovary syndrome. J. Ovarian. Res. 2013, 6, 32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, N.; Kwon, S.; Abbott, D.H.; Geller, D.H.; Dumesic, D.A.; Azziz, R.; Guo, X.; Goodarzi, M.O. Epigenetic mechanism underlying the development of polycystic ovary syndrome (PCOS)-like phenotypes in prenatally androgenized rhesus monkeys. PLoS ONE 2011, 6, e27286. [Google Scholar] [CrossRef] [Scilit]
- Bremer, A.A. Polycystic Ovary Syndrome in the Pediatric Population. Metab. Syndr. Relat. Disord. 2010, 8, 375–394. [Google Scholar] [CrossRef] [Scilit]
- Hardwick, J.C.H.; Van Den Brink, G.R.; Bleuming, S.A.; Ballester, I.; Van Den Brande, J.M.H.; Keller, J.J.; Offerhaus, G.J.A.; Van Deventer, S.J.H.; Peppelenbosch, M.P. Bone morphogenetic protein 2 is expressed by, and acts upon, mature epithelial cells in the colon. Gastroenterology 2004, 126, 111–121. [Google Scholar] [CrossRef] [Scilit]
- Chen, A.; Wang, D.; Liu, X.; He, S.; Yu, Z.; Wang, J. Inhibitory effect of BMP-2 on the proliferation of breast cancer cells. Mol. Med. Rep. 2012, 6, 615–620. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Ge, Y.; Sun, L.; Cao, J.; Wu, Q.; Guo, L.; Wang, Z. Effect of bone morphogenetic protein-2 on proliferation and apoptosis of gastric cancer cells. Int. J. Med. Sci. 2012, 9, 184–192. [Google Scholar] [CrossRef] [Scilit]
- Glister, C.; Satchell, L.; Bathgate, R.A.D.; Wade, J.D.; Dai, Y.; Ivell, R.; Anand-Ivell, R.; Rodgers, R.J.; Knight, P.G. Functional link between bone morphogenetic proteins and insulin-like peptide 3 signaling in modulating ovarian androgen production. Proc. Natl. Acad. Sci. USA 2013, 110, E1426–E1435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Andrisse, S.; Chen, Y.; Childress, S.; Xue, P.; Wang, Z.; Jones, D.; Ko, C.; Divall, S.; Wu, S. Androgen Receptor in the Ovary Theca Cells Plays a Critical Role in Androgen-Induced Reproductive Dysfunction. Endocrinology 2017, 158, 98–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richards, J.S.; Ren, Y.A.; Candelaria, N.; Adams, J.E.; Rajkovic, A. Ovarian Follicular Theca Cell Recruitment, Differentiation, and Impact on Fertility: 2017 Update. Endocr. Rev. 2018, 39, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Paul, D.; Samuel, S.M.; Maulik, N. Mesenchymal stem cell: Present challenges and prospective cellular cardiomyoplasty approaches for myocardial regeneration. Antioxid. Redox Signal. 2009, 11, 1841–1855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laird, M.; Glister, C.; Cheewasopit, W.; Satchell, L.S.; Bicknell, A.B.; Knight, P.G. ‘Free’ inhibin alpha subunit is expressed by bovine ovarian theca cells and its knockdown suppresses androgen production. Sci. Rep. 2019, 9, 19793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kauffman, A.S.; Thackray, V.G.; Ryan, G.E.; Tolson, K.P.; Glidewell-Kenney, C.A.; Semaan, S.J.; Poling, M.C.; Iwata, N.; Breen, K.M.; Duleba, A.J.; et al. A Novel Letrozole Model Recapitulates Both the Reproductive and Metabolic Phenotypes of Polycystic Ovary Syndrome in Female Mice. Biol. Reprod. 2015, 93, 69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hecker, M.; Newsted, J.L.; Murphy, M.B.; Higley, E.B.; Jones, P.D.; Wu, R.; Giesy, J.P. Human adrenocarcinoma (H295R) cells for rapid in vitro determination of effects on steroidogenesis: Hormone production. Toxicol. Appl. Pharmacol. 2006, 217, 114–124. [Google Scholar] [CrossRef] [Scilit]
- McAllister, J.M.; Han, A.X.; Modi, B.P.; Teves, M.E.; Mavodza, G.R.; Anderson, Z.L.; Shen, T.; Christenson, L.K.; Archer, K.J.; Strauss, J.F. miRNA Profiling Reveals miRNA-130b-3p Mediates DENND1A Variant 2 Expression and Androgen Biosynthesis. Endocrinology 2019, 160, 1964–1981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, Z.; Luo, Y.; Lv, Y. Mesenchymal stem cell-derived microvesicles mediate BMP2 gene delivery and enhance bone regeneration. J. Mater. Chem. B 2020, 8, 6378–6389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Osyczka, A.M.; Diefenderfer, D.L.; Bhargave, G.; Leboy, P.S. Different effects of BMP-2 on marrow stromal cells from human and rat bone. Cells Tissues Organs 2004, 176, 109–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marupanthorn, K.; Tantrawatpan, C.; Kheolamai, P.; Tantikanlayaporn, D.; Manochantr, S. Bone morphogenetic protein-2 enhances the osteogenic differentiation capacity of mesenchymal stromal cells derived from human bone marrow and umbilical cord. Int. J. Mol. Med. 2017, 39, 654–662. [Google Scholar] [CrossRef] [Scilit]
- Noth, U.; Rackwitz, L.; Heymer, A.; Weber, M.; Baumann, B.; Steinert, A.; Schutze, N.; Jakob, F.; Eulert, J. Chondrogenic differentiation of human mesenchymal stem cells in collagen type I hydrogels. J. Biomed. Mater. Res. A 2007, 83, 626–635. [Google Scholar] [CrossRef] [Scilit]
- Esfandyari, S.; Chugh, R.M.; Park, H.S.; Hobeika, E.; Ulin, M.; Al-Hendy, A. Mesenchymal Stem Cells as a Bio Organ for Treatment of Female Infertility. Cells 2020, 9, 2253. [Google Scholar] [CrossRef] [Scilit]
- Park, K.S.; Bandeira, E.; Shelke, G.V.; Lasser, C.; Lotvall, J. Enhancement of therapeutic potential of mesenchymal stem cell-derived extracellular vesicles. Stem Cell Res. Ther. 2019, 10, 288. [Google Scholar] [CrossRef] [Scilit]
- Patel, D.M.; Shah, J.; Srivastava, A.S. Therapeutic potential of mesenchymal stem cells in regenerative medicine. Stem Cells Int. 2013, 2013, 496218. [Google Scholar] [CrossRef] [Scilit]
- Satija, N.K.; Singh, V.K.; Verma, Y.K.; Gupta, P.; Sharma, S.; Afrin, F.; Sharma, M.; Sharma, P.; Tripathi, R.P.; Gurudutta, G.U. Mesenchymal stem cell-based therapy: A new paradigm in regenerative medicine. J. Cell Mol. Med. 2009, 13, 4385–4402. [Google Scholar] [CrossRef] [Scilit]
- Ankrum, J.A.; Ong, J.F.; Karp, J.M. Mesenchymal stem cells: Immune evasive, not immune privileged. Nat. Biotechnol. 2014, 32, 252–260. [Google Scholar] [CrossRef] [Scilit]
- Zheng, G.; Huang, R.; Qiu, G.; Ge, M.; Wang, J.; Shu, Q.; Xu, J. Mesenchymal stromal cell-derived extracellular vesicles: Regenerative and immunomodulatory effects and potential applications in sepsis. Cell Tissue Res. 2018, 374, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Fauser, B.C.; Tarlatzis, B.C.; Rebar, R.W.; Legro, R.S.; Balen, A.H.; Lobo, R.; Carmina, E.; Chang, J.; Yildiz, B.O.; Laven, J.S.; et al. Consensus on women’s health aspects of polycystic ovary syndrome (PCOS): The Amsterdam ESHRE/ASRM-Sponsored 3rd PCOS Consensus Workshop Group. Fertil. Steril. 2012, 97, 28–38.e25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez, F.; Sia, C.L.; Bearson, D.M.; Blair, H.E. Hyperandrogenism induces a proinflammatory TNFalpha response to glucose ingestion in a receptor-dependent fashion. J. Clin. Endocrinol. Metab. 2014, 99, E848–E854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scheerlinck, J.-P.Y. Cytokine Species-Specificity and Humanized Mice. In Humanized Mice for HIV Research; Poluektova, L.Y., Garcia, J.V., Koyanagi, Y., Manz, M.G., Tager, A.M., Eds.; Springer: New York, NY, USA, 2014; pp. 93–108. [Google Scholar]
- Scheerlinck, J.P. Functional and structural comparison of cytokines in different species. Vet. Immunol. Immunopathol. 1999, 72, 39–44. [Google Scholar] [CrossRef] [Scilit]
- O’Connor, K.C. Molecular Profiles of Cell-to-Cell Variation in the Regenerative Potential of Mesenchymal Stromal Cells. Stem Cells Int. 2019, 2019, 5924878. [Google Scholar] [CrossRef] [Scilit]
- Glister, C.; Richards, S.L.; Knight, P.G. Bone Morphogenetic Proteins (BMP)-4, -6, and -7 Potently Suppress Basal and Luteinizing Hormone-Induced Androgen Production by Bovine Theca Interna Cells in Primary Culture: Could Ovarian Hyperandrogenic Dysfunction Be Caused by a Defect in Thecal BMP Signaling? Endocrinology 2005, 146, 1883–1892. [Google Scholar] [CrossRef] [Scilit]
- Crowley, L.C.; Marfell, B.J.; Christensen, M.E.; Waterhouse, N.J. Measuring Cell Death by Trypan Blue Uptake and Light Microscopy. Cold Spring Harb. Protoc. 2016, 2016. [Google Scholar] [CrossRef] [Scilit]
- Piccinini, F.; Tesei, A.; Arienti, C.; Bevilacqua, A. Cell Counting and Viability Assessment of 2D and 3D Cell Cultures: Expected Reliability of the Trypan Blue Assay. Biol. Proced. Online 2017, 19, 8. [Google Scholar] [CrossRef] [Scilit]
- Hernandez, N.; Mauri, M.; Alfayate, R.; Torregrosa, M.E.; Chinchilla, V. A fifty-one-year-old woman with raised testosterone concentration. Endocrinol. Nutr. 2011, 58, 50–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Z.S.; Chu, H.C.; Yen, Y.C.; Lewis, B.C.; Chen, Y.W. Kruppel-like factor 4, a tumor suppressor in hepatocellular carcinoma cells reverts epithelial mesenchymal transition by suppressing slug expression. PLoS ONE 2012, 7, e43593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sumimoto, H.; Takano, A.; Teramoto, K.; Daigo, Y. RAS-Mitogen-Activated Protein Kinase Signal Is Required for Enhanced PD-L1 Expression in Human Lung Cancers. PLoS ONE 2016, 11, e0166626. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
|---|---|---|
| Human ACTB | TGGATCAGCAAGCAGGAGTATG | GCATTTGCGGTGGACGAT |
| Human CYP17A1 | GGCCTCAAATGGCAACTCTAGA | CTTCTGATCGCCATCCTTGAA |
| Human CYP11A1 | GAGGGAGACGGGCACACA | TGACATAAACCGACTCCACGTT |
| Human DENND1A | CAATTCCCGGAGGACTACAGT | AGCACGAATGTGAAGTTCTGG |
| Human IL6 | TGCACTTTATGACGCACTCAC | TGTCCAAAAACACGAAATCATGC |
| Human IL1B | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
| Human BCL2 | AACGTGCCTCATGAAATAAG | TTATTGGATGTGCTTTGCATTC |
| Human CASP3 | TGTTTGTGTGCTTCTGAGCC | CACGCCATGTCATCATCAAC |
| Mouse Gapdh | CACATTGGGGGTAGGAACAC | AACTTTGGCATTGTGGAAGG |
| Mouse Cyp17a1 | GAGTTTGCCATCCCGAAGGA | CCAGCTCCGAAGGGCAAATA |
| Mouse Bmp2 | TAGATCTGTACCGCAGGCA | CCGTTTTCCCACTCATCTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chugh, R.M.; Park, H.-s.; Esfandyari, S.; Elsharoud, A.; Ulin, M.; Al-Hendy, A. Mesenchymal Stem Cell-Conditioned Media Regulate Steroidogenesis and Inhibit Androgen Secretion in a PCOS Cell Model via BMP-2. Int. J. Mol. Sci. 2021, 22, 9184. https://doi.org/10.3390/ijms22179184
Chugh RM, Park H-s, Esfandyari S, Elsharoud A, Ulin M, Al-Hendy A. Mesenchymal Stem Cell-Conditioned Media Regulate Steroidogenesis and Inhibit Androgen Secretion in a PCOS Cell Model via BMP-2. International Journal of Molecular Sciences. 2021; 22(17):9184. https://doi.org/10.3390/ijms22179184
Chicago/Turabian StyleChugh, Rishi Man, Hang-soo Park, Sahar Esfandyari, Amro Elsharoud, Mara Ulin, and Ayman Al-Hendy. 2021. "Mesenchymal Stem Cell-Conditioned Media Regulate Steroidogenesis and Inhibit Androgen Secretion in a PCOS Cell Model via BMP-2" International Journal of Molecular Sciences 22, no. 17: 9184. https://doi.org/10.3390/ijms22179184
APA StyleChugh, R. M., Park, H.-s., Esfandyari, S., Elsharoud, A., Ulin, M., & Al-Hendy, A. (2021). Mesenchymal Stem Cell-Conditioned Media Regulate Steroidogenesis and Inhibit Androgen Secretion in a PCOS Cell Model via BMP-2. International Journal of Molecular Sciences, 22(17), 9184. https://doi.org/10.3390/ijms22179184

