Insights into the Transcriptome of Human Cytomegalovirus: A Comprehensive Review
Abstract
1. Introduction
2. HCMV Messenger RNA (mRNA)
The ORFs Are Color-Coded According to the Growth Properties of Their Corresponding Virus Gene Deletion Mutants
3. HCMV Long Non-Coding RNAs (lncRNAs)
3.1. RNA1.2
3.2. RNA2.7
3.3. RNA4.9
3.4. RNA5.0
4. HCMV Circular RNAs (circRNAs)
5. HCMV microRNA (miRNA)
| miRNA | Sequence | Start | End | Length |
|---|---|---|---|---|
| hcmv-miR- UL22A-5p | TAACTAGCCTTCCCGTGAGA | 27,992 | 28,011 | 19 |
| hcmv-miR- UL22A-3p | TCACCAGAATGCTAGTTTGTAG | 28,029 | 28,050 | 21 |
| hcmv-miR- UL36-5p | TCGTTGAAGACACCTGGAAAGA | 49,914 | 49,893 | 21 |
| hcmv-miR- UL36-3p | TTTCCAGGTGTTTTCAACGTG | 49,870 | 49,851 | 19 |
| hcmv-miR- UL70-5p | TGCGTCTCGGCCTCGTCCAGA | 104,404 | 104,424 | 20 |
| hcmv-miR- UL70-3p | GGGGATGGGCTGGCGCGCGG | 104,445 | 104,464 | 19 |
| hcmv-miR- UL112-3p | AAGTGACGGTGAGATCCAGGC | 164,557 | 164,578 | 21 |
| hcmv-miR- UL148D | TCGTCCTCCCCTTCTTCACCG | 193,587 | 193,607 | 20 |
| hcmv-miR- US4-5p | TGGACGTGCAGGGGGATGTC | 201,376 | 201,395 | 19 |
| hcmv-miR- US5-1-3p | TGACAAGCCTGACGAGAGCGT | 202,317 | 202,337 | 20 |
| hcmv-miR- US5-2-3p | TTATGATAGGTGTGACGATGTC | 202,444 | 202,465 | 21 |
| hcmv-miR- US25-1-5p | AACCGCTCAGTGGCTCGGACC | 221,539 | 221,519 | 20 |
| hcmv-miR- US25-1-3p | TCCGAACGCTAGGTCGGTTCT | 221,496 | 221,476 | 20 |
| hcmv-miR- US25-2-5p | AGCGGTCTGTTCAGGTGGATGA | 221,760 | 221,739 | 21 |
| hcmv-miR- US25-2-3p | ATCCACTTGGAGAGCTCCCGCGG T | 221,702 | 221,680 | 22 |
| hcmv-miR- US33-5p | GATTGTGCCCGGACCGTGGGCG | 226,768 | 226,750 | 18 |
| hcmv-miR- US33-3p | TCACGGTCCGAGCACATCCA | 226,731 | 226,712 | 19 |
6. HCMV Gene Expression during a State of Latency
7. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gupta, M.; Shorman, M. Cytomegalovirus. In StatPearls; StatPearls: Treasure Island, FL, USA, 2023. [Google Scholar]
- Fowler, K.B.; Boppana, S.B. Congenital cytomegalovirus infection. Semin. Perinatol. 2018, 42, 149–154. [Google Scholar] [CrossRef]
- Silva, M.C.; Yu, Q.C.; Enquist, L.; Shenk, T. Human cytomegalovirus UL99-encoded pp28 is required for the cytoplasmic envelopment of tegument-associated capsids. J. Virol. 2003, 77, 10594–10605. [Google Scholar] [CrossRef]
- Varnum, S.M.; Streblow, D.N.; Monroe, M.E.; Smith, P.; Auberry, K.J.; Pasa-Tolic, L.; Wang, D.; Camp, D.G., 2nd; Rodland, K.; Wiley, S.; et al. Identification of proteins in human cytomegalovirus (HCMV) particles: The HCMV proteome. J. Virol. 2004, 78, 10960–10966. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Kim, H.; Hong, A.; Song, J.; Lee, S.; Kim, M.; Hwang, S.Y.; Jeong, D.; Kim, J.; Son, A.; et al. Functional and molecular dissection of HCMV long non-coding RNAs. Sci. Rep. 2022, 12, 19303. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Liu, X.; Wang, M.; Cao, D.; Jaijyan, D.K.; Enescu, N.; Liu, J.; Wu, S.; Wang, S.; Sun, W.; et al. Circular RNAs Represent a Novel Class of Human Cytomegalovirus Transcripts. Microbiol. Spectr. 2022, 10, e0110622. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Moreno, R.; Torre-Cisneros, J.; Cantisan, S. Human cytomegalovirus (HCMV)-encoded microRNAs: Potential biomarkers and clinical applications. RNA Biol. 2021, 18, 2194–2202. [Google Scholar] [CrossRef]
- Ye, L.; Qian, Y.; Yu, W.; Guo, G.; Wang, H.; Xue, X. Functional Profile of Human Cytomegalovirus Genes and Their Associated Diseases: A Review. Front. Microbiol. 2020, 11, 2104. [Google Scholar] [CrossRef]
- Ho, M. The history of cytomegalovirus and its diseases. Med. Microbiol. Immunol. 2008, 197, 65–73. [Google Scholar] [CrossRef]
- Chee, M.S.; Bankier, A.T.; Beck, S.; Bohni, R.; Brown, C.M.; Cerny, R.; Horsnell, T.; Hutchison, C.A., 3rd; Kouzarides, T.; Martignetti, J.A.; et al. Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Curr. Top. Microbiol. Immunol. 1990, 154, 125–169. [Google Scholar] [CrossRef]
- Davison, A.J.; Dolan, A.; Akter, P.; Addison, C.; Dargan, D.J.; Alcendor, D.J.; McGeoch, D.J.; Hayward, G.S. The human cytomegalovirus genome revisited: Comparison with the chimpanzee cytomegalovirus genome. J. Gen. Virol. 2003, 84 Pt 1, 17–28. [Google Scholar] [CrossRef]
- Gatherer, D.; Seirafian, S.; Cunningham, C.; Holton, M.; Dargan, D.J.; Baluchova, K.; Hector, R.D.; Galbraith, J.; Herzyk, P.; Wilkinson, G.W.; et al. High-resolution human cytomegalovirus transcriptome. Proc. Natl. Acad. Sci. USA 2011, 108, 19755–19760. [Google Scholar] [CrossRef] [PubMed]
- Murphy, E.; Rigoutsos, I.; Shibuya, T.; Shenk, T.E. Reevaluation of human cytomegalovirus coding potential. Proc. Natl. Acad. Sci. USA 2003, 100, 13585–13590. [Google Scholar] [CrossRef] [PubMed]
- Dolan, A.; Cunningham, C.; Hector, R.D.; Hassan-Walker, A.F.; Lee, L.; Addison, C.; Dargan, D.J.; McGeoch, D.J.; Gatherer, D.; Emery, V.C.; et al. Genetic content of wild-type human cytomegalovirus. J. Gen. Virol. 2004, 85 Pt 5, 1301–1312. [Google Scholar] [CrossRef] [PubMed]
- Balazs, Z.; Tombacz, D.; Szucs, A.; Csabai, Z.; Megyeri, K.; Petrov, A.N.; Snyder, M.; Boldogkoi, Z. Long-Read Sequencing of Human Cytomegalovirus Transcriptome Reveals RNA Isoforms Carrying Distinct Coding Potentials. Sci. Rep. 2017, 7, 15989. [Google Scholar] [CrossRef]
- Dunn, W.; Chou, C.; Li, H.; Hai, R.; Patterson, D.; Stolc, V.; Zhu, H.; Liu, F. Functional profiling of a human cytomegalovirus genome. Proc. Natl. Acad. Sci. USA 2003, 100, 14223–14228. [Google Scholar] [CrossRef]
- Stern-Ginossar, N.; Weisburd, B.; Michalski, A.; Le, V.T.; Hein, M.Y.; Huang, S.X.; Ma, M.; Shen, B.; Qian, S.B.; Hengel, H.; et al. Decoding human cytomegalovirus. Science 2012, 338, 1088–1093. [Google Scholar] [CrossRef]
- Forte, E.; Zhang, Z.; Thorp, E.B.; Hummel, M. Cytomegalovirus Latency and Reactivation: An Intricate Interplay with the Host Immune Response. Front. Cell. Infect. Microbiol. 2020, 10, 130. [Google Scholar] [CrossRef]
- Angulo, A.; Ghazal, P.; Messerle, M. The major immediate-early gene ie3 of mouse cytomegalovirus is essential for viral growth. J. Virol. 2000, 74, 11129–11136. [Google Scholar] [CrossRef]
- Ma, Y.; Wang, N.; Li, M.; Gao, S.; Wang, L.; Zheng, B.; Qi, Y.; Ruan, Q. Human CMV transcripts: An overview. Future Microbiol. 2012, 7, 577–593. [Google Scholar] [CrossRef]
- Fehr, A.R.; Yu, D. Human cytomegalovirus gene UL21a encodes a short-lived cytoplasmic protein and facilitates virus replication in fibroblasts. J. Virol. 2010, 84, 291–302. [Google Scholar] [CrossRef]
- Fehr, A.R.; Yu, D. Human cytomegalovirus early protein pUL21a promotes efficient viral DNA synthesis and the late accumulation of immediate-early transcripts. J. Virol. 2011, 85, 663–674. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.K.; Duh, C.Y.; Wu, C.W. Human cytomegalovirus UL76 encodes a novel virion-associated protein that is able to inhibit viral replication. J. Virol. 2004, 78, 9750–9762. [Google Scholar] [CrossRef] [PubMed]
- Degnin, C.R.; Schleiss, M.R.; Cao, J.; Geballe, A.P. Translational inhibition mediated by a short upstream open reading frame in the human cytomegalovirus gpUL4 (gp48) transcript. J. Virol. 1993, 67, 5514–5521. [Google Scholar] [CrossRef]
- Alderete, J.P.; Jarrahian, S.; Geballe, A.P. Translational effects of mutations and polymorphisms in a repressive upstream open reading frame of the human cytomegalovirus UL4 gene. J. Virol. 1999, 73, 8330–8337. [Google Scholar] [CrossRef]
- Moorman, N.J.; Cristea, I.M.; Terhune, S.S.; Rout, M.P.; Chait, B.T.; Shenk, T. Human cytomegalovirus protein UL38 inhibits host cell stress responses by antagonizing the tuberous sclerosis protein complex. Cell Host Microbe 2008, 3, 253–262. [Google Scholar] [CrossRef] [PubMed]
- Aoyagi, M.; Gaspar, M.; Shenk, T.E. Human cytomegalovirus UL69 protein facilitates translation by associating with the mRNA cap-binding complex and excluding 4EBP1. Proc. Natl. Acad. Sci. USA 2010, 107, 2640–2645. [Google Scholar] [CrossRef]
- Ziehr, B.; Lenarcic, E.; Vincent, H.A.; Cecil, C.; Garcia, B.; Shenk, T.; Moorman, N.J. Human cytomegalovirus TRS1 protein associates with the 7-methylguanosine mRNA cap and facilitates translation. Proteomics 2015, 15, 1983–1994. [Google Scholar] [CrossRef]
- Kim, J.S.; Choi, S.E.; Yun, I.H.; Kim, J.Y.; Ahn, C.; Kim, S.J.; Ha, J.; Hwang, E.S.; Cha, C.Y.; Miyagawa, S.; et al. Human cytomegalovirus UL18 alleviated human NK-mediated swine endothelial cell lysis. Biochem. Biophys. Res. Commun. 2004, 315, 144–150. [Google Scholar] [CrossRef]
- Hancock, M.H.; Crawford, L.B.; Perez, W.; Struthers, H.M.; Mitchell, J.; Caposio, P. Human Cytomegalovirus UL7, miR-US5-1, and miR-UL112-3p Inactivation of FOXO3a Protects CD34(+) Hematopoietic Progenitor Cells from Apoptosis. mSphere 2021, 6, e00986-20. [Google Scholar] [CrossRef]
- Skaletskaya, A.; Bartle, L.M.; Chittenden, T.; McCormick, A.L.; Mocarski, E.S.; Goldmacher, V.S. A cytomegalovirus-encoded inhibitor of apoptosis that suppresses caspase-8 activation. Proc. Natl. Acad. Sci. USA 2001, 98, 7829–7834. [Google Scholar] [CrossRef]
- Tao, R.; Xu, J.; Gao, H.; Zhao, W.; Shang, S. Characteristics and functions of human cytomegalovirus UL128 gene/protein. Acta Virol. 2014, 58, 103–107. [Google Scholar] [CrossRef] [PubMed]
- Cobbs, C.S.; Soroceanu, L.; Denham, S.; Zhang, W.; Kraus, M.H. Modulation of oncogenic phenotype in human glioma cells by cytomegalovirus IE1-mediated mitogenicity. Cancer Res. 2008, 68, 724–730. [Google Scholar] [CrossRef] [PubMed]
- Castillo, J.P.; Yurochko, A.D.; Kowalik, T.F. Role of human cytomegalovirus immediate-early proteins in cell growth control. J. Virol. 2000, 74, 8028–8037. [Google Scholar] [CrossRef] [PubMed]
- Bruno, L.; Cortese, M.; Monda, G.; Gentile, M.; Calo, S.; Schiavetti, F.; Zedda, L.; Cattaneo, E.; Piccioli, D.; Schaefer, M.; et al. Human cytomegalovirus pUL10 interacts with leukocytes and impairs TCR-mediated T-cell activation. Immunol. Cell Biol. 2016, 94, 849–860. [Google Scholar] [CrossRef] [PubMed]
- Gabaev, I.; Steinbruck, L.; Pokoyski, C.; Pich, A.; Stanton, R.J.; Schwinzer, R.; Schulz, T.F.; Jacobs, R.; Messerle, M.; Kay-Fedorov, P.C. The human cytomegalovirus UL11 protein interacts with the receptor tyrosine phosphatase CD45, resulting in functional paralysis of T cells. PLoS Pathog. 2011, 7, e1002432. [Google Scholar] [CrossRef]
- Cheung, T.C.; Humphreys, I.R.; Potter, K.G.; Norris, P.S.; Shumway, H.M.; Tran, B.R.; Patterson, G.; Jean-Jacques, R.; Yoon, M.; Spear, P.G.; et al. Evolutionarily divergent herpesviruses modulate T cell activation by targeting the herpesvirus entry mediator cosignaling pathway. Proc. Natl. Acad. Sci. USA 2005, 102, 13218–13223. [Google Scholar] [CrossRef]
- Mocarski, E.S., Jr. Betaherpes viral genes and their functions. In Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis; Arvin, A., Campadelli-Fiume, G., Mocarski, E., Moore, P.S., Roizman, B., Whitley, R., Yamanishi, K., Eds.; Cambridge University Press: Cambridge, UK, 2007. [Google Scholar]
- Van Damme, E.; Van Loock, M. Functional annotation of human cytomegalovirus gene products: An update. Front. Microbiol. 2014, 5, 218. [Google Scholar] [CrossRef]
- Nightingale, K.; Potts, M.; Hunter, L.M.; Fielding, C.A.; Zerbe, C.M.; Fletcher-Etherington, A.; Nobre, L.; Wang, E.C.Y.; Strang, B.L.; Houghton, J.W.; et al. Human cytomegalovirus protein RL1 degrades the antiviral factor SLFN11 via recruitment of the CRL4 E3 ubiquitin ligase complex. Proc. Natl. Acad. Sci. USA 2022, 119, e2108173119. [Google Scholar] [CrossRef]
- Reeves, M.B.; Davies, A.A.; McSharry, B.P.; Wilkinson, G.W.; Sinclair, J.H. Complex I binding by a virally encoded RNA regulates mitochondria-induced cell death. Science 2007, 316, 1345–1348. [Google Scholar] [CrossRef]
- Huang, Y.; Guo, X.; Zhang, J.; Li, J.; Xu, M.; Wang, Q.; Liu, Z.; Ma, Y.; Qi, Y.; Ruan, Q. Human cytomegalovirus RNA2.7 inhibits RNA polymerase II (Pol II) Serine-2 phosphorylation by reducing the interaction between Pol II and phosphorylated cyclin-dependent kinase 9 (pCDK9). Virol. Sin. 2022, 37, 358–369. [Google Scholar] [CrossRef]
- Lau, B.; Kerr, K.; Gu, Q.; Nightingale, K.; Antrobus, R.; Suarez, N.M.; Stanton, R.J.; Wang, E.C.Y.; Weekes, M.P.; Davison, A.J. Human Cytomegalovirus Long Non-coding RNA1.2 Suppresses Extracellular Release of the Pro-inflammatory Cytokine IL-6 by Blocking NF-kappaB Activation. Front. Cell. Infect. Microbiol. 2020, 10, 361. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.Y.; Ma, Y.P.; Qi, Y.; Huang, Y.J.; Liu, Z.Y.; Lu, M.Q.; Ruan, Q. Identification and characterization of a novel group of natural anti-sense transcripts from RNA1.2 gene locus of human cytomegalovirus. Chin. Med. J. 2019, 132, 1591–1598. [Google Scholar] [CrossRef] [PubMed]
- Lilley, B.N.; Ploegh, H.L.; Tirabassi, R.S. Human cytomegalovirus open reading frame TRL11/IRL11 encodes an immunoglobulin G Fc-binding protein. J. Virol. 2001, 75, 11218–11221. [Google Scholar] [CrossRef] [PubMed]
- Corrales-Aguilar, E.; Trilling, M.; Hunold, K.; Fiedler, M.; Le, V.T.; Reinhard, H.; Ehrhardt, K.; Merce-Maldonado, E.; Aliyev, E.; Zimmermann, A.; et al. Human cytomegalovirus Fcgamma binding proteins gp34 and gp68 antagonize Fcgamma receptors I, II and III. PLoS Pathog. 2014, 10, e1004131. [Google Scholar] [CrossRef]
- Vlahava, V.M.; Murrell, I.; Zhuang, L.; Aicheler, R.J.; Lim, E.; Miners, K.L.; Ladell, K.; Suarez, N.M.; Price, D.A.; Davison, A.J.; et al. Monoclonal antibodies targeting nonstructural viral antigens can activate ADCC against human cytomegalovirus. J. Clin. Investig. 2021, 131, e139296. [Google Scholar] [CrossRef]
- Cortese, M.; Calo, S.; D’Aurizio, R.; Lilja, A.; Pacchiani, N.; Merola, M. Recombinant human cytomegalovirus (HCMV) RL13 binds human immunoglobulin G Fc. PLoS ONE 2012, 7, e50166. [Google Scholar] [CrossRef]
- Stanton, R.J.; Baluchova, K.; Dargan, D.J.; Cunningham, C.; Sheehy, O.; Seirafian, S.; McSharry, B.P.; Neale, M.L.; Davies, J.A.; Tomasec, P.; et al. Reconstruction of the complete human cytomegalovirus genome in a BAC reveals RL13 to be a potent inhibitor of replication. J. Clin. Investig. 2010, 120, 3191–3208. [Google Scholar] [CrossRef]
- Wang, G.; Ren, G.; Cui, X.; Lu, Z.; Ma, Y.; Qi, Y.; Huang, Y.; Liu, Z.; Sun, Z.; Ruan, Q. Human cytomegalovirus RL13 protein interacts with host NUDT14 protein affecting viral DNA replication. Mol. Med. Rep. 2016, 13, 2167–2174. [Google Scholar] [CrossRef]
- Shikhagaie, M.; Merce-Maldonado, E.; Isern, E.; Muntasell, A.; Alba, M.M.; Lopez-Botet, M.; Hengel, H.; Angulo, A. The human cytomegalovirus-specific UL1 gene encodes a late-phase glycoprotein incorporated in the virion envelope. J. Virol. 2012, 86, 4091–4101. [Google Scholar] [CrossRef]
- Cao, J.; Geballe, A.P. Inhibition of nascent-peptide release at translation termination. Mol. Cell. Biol. 1996, 16, 7109–7114. [Google Scholar] [CrossRef]
- Anselmi, G.; Giuliani, M.; Vezzani, G.; Ferranti, R.; Gentile, M.; Cortese, M.; Amendola, D.; Pacchiani, N.; D’Aurizio, R.; Bruno, L.; et al. Characterization of pUL5, an HCMV protein interacting with the cellular protein IQGAP1. Virology 2020, 540, 57–65. [Google Scholar] [CrossRef]
- Engel, P.; Perez-Carmona, N.; Alba, M.M.; Robertson, K.; Ghazal, P.; Angulo, A. Human cytomegalovirus UL7, a homologue of the SLAM-family receptor CD229, impairs cytokine production. Immunol. Cell Biol. 2011, 89, 753–766. [Google Scholar] [CrossRef] [PubMed]
- MacManiman, J.D.; Meuser, A.; Botto, S.; Smith, P.P.; Liu, F.; Jarvis, M.A.; Nelson, J.A.; Caposio, P. Human cytomegalovirus-encoded pUL7 is a novel CEACAM1-like molecule responsible for promotion of angiogenesis. mBio 2014, 5, e02035. [Google Scholar] [CrossRef]
- Crawford, L.B.; Kim, J.H.; Collins-McMillen, D.; Lee, B.J.; Landais, I.; Held, C.; Nelson, J.A.; Yurochko, A.D.; Caposio, P. Human Cytomegalovirus Encodes a Novel FLT3 Receptor Ligand Necessary for Hematopoietic Cell Differentiation and Viral Reactivation. mBio 2018, 9, e00682-18. [Google Scholar] [CrossRef] [PubMed]
- Perez-Carmona, N.; Martinez-Vicente, P.; Farre, D.; Gabaev, I.; Messerle, M.; Engel, P.; Angulo, A. A Prominent Role of the Human Cytomegalovirus UL8 Glycoprotein in Restraining Proinflammatory Cytokine Production by Myeloid Cells at Late Times during Infection. J. Virol. 2018, 92, e02229-17. [Google Scholar] [CrossRef] [PubMed]
- Zischke, J.; Mamareli, P.; Pokoyski, C.; Gabaev, I.; Buyny, S.; Jacobs, R.; Falk, C.S.; Lochner, M.; Sparwasser, T.; Schulz, T.F.; et al. The human cytomegalovirus glycoprotein pUL11 acts via CD45 to induce T cell IL-10 secretion. PLoS Pathog. 2017, 13, e1006454. [Google Scholar] [CrossRef] [PubMed]
- Cosman, D.; Mullberg, J.; Sutherland, C.L.; Chin, W.; Armitage, R.; Fanslow, W.; Kubin, M.; Chalupny, N.J. ULBPs, novel MHC class I-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity 2001, 14, 123–133. [Google Scholar] [CrossRef] [PubMed]
- Dunn, C.; Chalupny, N.J.; Sutherland, C.L.; Dosch, S.; Sivakumar, P.V.; Johnson, D.C.; Cosman, D. Human cytomegalovirus glycoprotein UL16 causes intracellular sequestration of NKG2D ligands, protecting against natural killer cell cytotoxicity. J. Exp. Med. 2003, 197, 1427–1439. [Google Scholar] [CrossRef]
- Vales-Gomez, M.; Browne, H.; Reyburn, H.T. Expression of the UL16 glycoprotein of Human Cytomegalovirus protects the virus-infected cell from attack by natural killer cells. BMC Immunol. 2003, 4, 4. [Google Scholar] [CrossRef]
- Wilkinson, G.W.; Tomasec, P.; Stanton, R.J.; Armstrong, M.; Prod’homme, V.; Aicheler, R.; McSharry, B.P.; Rickards, C.R.; Cochrane, D.; Llewellyn-Lacey, S.; et al. Modulation of natural killer cells by human cytomegalovirus. J. Clin. Virol. 2008, 41, 206–212. [Google Scholar] [CrossRef]
- Reyburn, H.T.; Mandelboim, O.; Vales-Gomez, M.; Davis, D.M.; Pazmany, L.; Strominger, J.L. The class I MHC homologue of human cytomegalovirus inhibits attack by natural killer cells. Nature 1997, 386, 514–517. [Google Scholar] [CrossRef] [PubMed]
- Prod’homme, V.; Griffin, C.; Aicheler, R.J.; Wang, E.C.; McSharry, B.P.; Rickards, C.R.; Stanton, R.J.; Borysiewicz, L.K.; Lopez-Botet, M.; Wilkinson, G.W.; et al. The human cytomegalovirus MHC class I homolog UL18 inhibits LIR-1+ but activates LIR-1− NK cells. J. Immunol. 2007, 178, 4473–4481. [Google Scholar] [CrossRef] [PubMed]
- Patel, M.; Vlahava, V.M.; Forbes, S.K.; Fielding, C.A.; Stanton, R.J.; Wang, E.C.Y. HCMV-Encoded NK Modulators: Lessons from in vitro and in vivo Genetic Variation. Front. Immunol. 2018, 9, 2214. [Google Scholar] [CrossRef] [PubMed]
- Berg, L.; Riise, G.C.; Cosman, D.; Bergstrom, T.; Olofsson, S.; Karre, K.; Carbone, E. LIR-1 expression on lymphocytes, and cytomegalovirus disease in lung-transplant recipients. Lancet 2003, 361, 1099–1101. [Google Scholar] [CrossRef]
- Antrobus, R.D.; Khan, N.; Hislop, A.D.; Montamat-Sicotte, D.; Garner, L.I.; Rickinson, A.B.; Moss, P.A.; Willcox, B.E. Virus-specific cytotoxic T lymphocytes differentially express cell-surface leukocyte immunoglobulin-like receptor-1, an inhibitory receptor for class I major histocompatibility complex molecules. J. Infect. Dis. 2005, 191, 1842–1853. [Google Scholar] [CrossRef]
- Jelcic, I.; Reichel, J.; Schlude, C.; Treutler, E.; Sinzger, C.; Steinle, A. The polymorphic HCMV glycoprotein UL20 is targeted for lysosomal degradation by multiple cytoplasmic dileucine motifs. Traffic 2011, 12, 1444–1456. [Google Scholar] [CrossRef]
- Fehr, A.R.; Gualberto, N.C.; Savaryn, J.P.; Terhune, S.S.; Yu, D. Proteasome-dependent disruption of the E3 ubiquitin ligase anaphase-promoting complex by HCMV protein pUL21a. PLoS Pathog. 2012, 8, e1002789. [Google Scholar] [CrossRef]
- Clark, A.E.; Spector, D.H. Studies on the Contribution of Human Cytomegalovirus UL21a and UL97 to Viral Growth and Inactivation of the Anaphase-Promoting Complex/Cyclosome (APC/C) E3 Ubiquitin Ligase Reveal a Unique Cellular Mechanism for Downmodulation of the APC/C Subunits APC1, APC4, and APC5. J. Virol. 2015, 89, 6928–6939. [Google Scholar]
- Caffarelli, N.; Fehr, A.R.; Yu, D. Cyclin A degradation by primate cytomegalovirus protein pUL21a counters its innate restriction of virus replication. PLoS Pathog. 2013, 9, e1003825. [Google Scholar] [CrossRef]
- Eifler, M.; Uecker, R.; Weisbach, H.; Bogdanow, B.; Richter, E.; Konig, L.; Vetter, B.; Lenac-Rovis, T.; Jonjic, S.; Neitzel, H.; et al. PUL21a-Cyclin A2 interaction is required to protect human cytomegalovirus-infected cells from the deleterious consequences of mitotic entry. PLoS Pathog. 2014, 10, e1004514. [Google Scholar] [CrossRef]
- Raftery, M.J.; Moncke-Buchner, E.; Matsumura, H.; Giese, T.; Winkelmann, A.; Reuter, M.; Terauchi, R.; Schonrich, G.; Kruger, D.H. Unravelling the interaction of human cytomegalovirus with dendritic cells by using SuperSAGE. J. Gen. Virol. 2009, 90 Pt 9, 2221–2233. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Sanchez, J.; Stone, M.J.; Payne, R.J. Sulfation of the Human Cytomegalovirus Protein UL22A Enhances Binding to the Chemokine RANTES. Angew. Chem. 2017, 56, 8490–8494. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Sheng, J.; Vu, G.P.; Liu, Y.; Foo, C.; Wu, S.; Trang, P.; Paliza-Carre, M.; Ran, Y.; Yang, X.; et al. Human cytomegalovirus UL23 inhibits transcription of interferon-gamma stimulated genes and blocks antiviral interferon-gamma responses by interacting with human N-myc interactor protein. PLoS Pathog. 2018, 14, e1006867. [Google Scholar] [CrossRef] [PubMed]
- Feng, L.; Li, W.; Wu, X.; Li, X.; Yang, X.; Ran, Y.; Wu, J.; Li, H. Human Cytomegalovirus UL23 Attenuates Signal Transducer and Activator of Transcription 1 Phosphorylation and Type I Interferon Response. Front. Microbiol. 2021, 12, 692515. [Google Scholar] [CrossRef]
- Wang, H.; Peng, W.; Wang, J.; Zhang, C.; Zhao, W.; Ran, Y.; Yang, X.; Chen, J.; Li, H. Human Cytomegalovirus UL23 Antagonizes the Antiviral Effect of Interferon-gamma by Restraining the Expression of Specific IFN-Stimulated Genes. Viruses 2023, 15, 1014. [Google Scholar] [CrossRef]
- Sleman, S.; Hao, H.; Najmuldeen, H.; Jalal, P.; Saeed, N.; Othman, D.; Qian, Z. Human Cytomegalovirus UL24 and UL43 Cooperate to Modulate the Expression of Immunoregulatory UL16 Binding Protein 1. Viral Immunol. 2022, 35, 529–544. [Google Scholar] [CrossRef] [PubMed]
- Sleman, S.; Najmuldeen, H.; Hao, H.; Jalal, P.; Saeed, N.; Othman, D.; Qian, Z. Human cytomegalovirus UL24 and UL43 products participate in SAMHD1 subcellular localization. VirusDisease 2022, 33, 383–396. [Google Scholar] [CrossRef]
- Nobre, L.V.; Nightingale, K.; Ravenhill, B.J.; Antrobus, R.; Soday, L.; Nichols, J.; Davies, J.A.; Seirafian, S.; Wang, E.C.; Davison, A.J.; et al. Human cytomegalovirus interactome analysis identifies degradation hubs, domain associations and viral protein functions. eLife 2019, 8, e49894. [Google Scholar] [CrossRef]
- Stamminger, T.; Gstaiger, M.; Weinzierl, K.; Lorz, K.; Winkler, M.; Schaffner, W. Open reading frame UL26 of human cytomegalovirus encodes a novel tegument protein that contains a strong transcriptional activation domain. J. Virol. 2002, 76, 4836–4847. [Google Scholar] [CrossRef]
- Munger, J.; Yu, D.; Shenk, T. UL26-deficient human cytomegalovirus produces virions with hypophosphorylated pp28 tegument protein that is unstable within newly infected cells. J. Virol. 2006, 80, 3541–3548. [Google Scholar] [CrossRef] [PubMed]
- Lorz, K.; Hofmann, H.; Berndt, A.; Tavalai, N.; Mueller, R.; Schlotzer-Schrehardt, U.; Stamminger, T. Deletion of open reading frame UL26 from the human cytomegalovirus genome results in reduced viral growth, which involves impaired stability of viral particles. J. Virol. 2006, 80, 5423–5434. [Google Scholar] [CrossRef] [PubMed]
- Kalejta, R.F. Tegument proteins of human cytomegalovirus. Microbiol. Mol. Biol. Rev. 2008, 72, 249–265, table of contents. [Google Scholar] [CrossRef] [PubMed]
- Mathers, C.; Spencer, C.M.; Munger, J. Distinct domains within the human cytomegalovirus U(L)26 protein are important for wildtype viral replication and virion stability. PLoS ONE 2014, 9, e88101. [Google Scholar] [CrossRef] [PubMed]
- Mathers, C.; Schafer, X.; Martinez-Sobrido, L.; Munger, J. The human cytomegalovirus UL26 protein antagonizes NF-kappaB activation. J. Virol. 2014, 88, 14289–14300. [Google Scholar] [CrossRef]
- Goodwin, C.M.; Munger, J. The IkappaB Kinases Restrict Human Cytomegalovirus Infection. J. Virol. 2019, 93, e02030-18. [Google Scholar] [CrossRef]
- Komazin, G.; Ptak, R.G.; Emmer, B.T.; Townsend, L.B.; Drach, J.C. Resistance of human cytomegalovirus to the benzimidazole L-ribonucleoside maribavir maps to UL27. J. Virol. 2003, 77, 11499–11506. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chou, S.; Marousek, G.I.; Senters, A.E.; Davis, M.G.; Biron, K.K. Mutations in the human cytomegalovirus UL27 gene that confer resistance to maribavir. J. Virol. 2004, 78, 7124–7130. [Google Scholar] [CrossRef] [PubMed]
- Hakki, M.; Drummond, C.; Houser, B.; Marousek, G.; Chou, S. Resistance to maribavir is associated with the exclusion of pUL27 from nucleoli during human cytomegalovirus infection. Antiviral. Res. 2011, 92, 313–318. [Google Scholar] [CrossRef]
- Piret, J.; Boivin, G. Clinical development of letermovir and maribavir: Overview of human cytomegalovirus drug resistance. Antiviral. Res. 2019, 163, 91–105. [Google Scholar] [CrossRef]
- Mitchell, D.P.; Savaryn, J.P.; Moorman, N.J.; Shenk, T.; Terhune, S.S. Human cytomegalovirus UL28 and UL29 open reading frames encode a spliced mRNA and stimulate accumulation of immediate-early RNAs. J. Virol. 2009, 83, 10187–10197. [Google Scholar] [CrossRef]
- Terhune, S.S.; Moorman, N.J.; Cristea, I.M.; Savaryn, J.P.; Cuevas-Bennett, C.; Rout, M.P.; Chait, B.T.; Shenk, T. Human cytomegalovirus UL29/28 protein interacts with components of the NuRD complex which promote accumulation of immediate-early RNA. PLoS Pathog. 2010, 6, e1000965. [Google Scholar] [CrossRef] [PubMed]
- Savaryn, J.P.; Reitsma, J.M.; Bigley, T.M.; Halligan, B.D.; Qian, Z.; Yu, D.; Terhune, S.S. Human cytomegalovirus pUL29/28 and pUL38 repression of p53-regulated p21CIP1 and caspase 1 promoters during infection. J. Virol. 2013, 87, 2463–2474. [Google Scholar] [CrossRef] [PubMed]
- Westdorp, K.N.; Sand, A.; Moorman, N.J.; Terhune, S.S. Cytomegalovirus Late Protein pUL31 Alters Pre-rRNA Expression and Nuclear Organization during Infection. J. Virol. 2017, 91, e00593-17. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.F.; Zou, H.M.; Liao, B.W.; Zhang, H.Y.; Yang, Y.; Fu, Y.Z.; Wang, S.Y.; Luo, M.H.; Wang, Y.Y. Human Cytomegalovirus Protein UL31 Inhibits DNA Sensing of cGAS to Mediate Immune Evasion. Cell Host Microbe 2018, 24, 69–80.e64. [Google Scholar] [CrossRef] [PubMed]
- AuCoin, D.P.; Smith, G.B.; Meiering, C.D.; Mocarski, E.S. Betaherpesvirus-conserved cytomegalovirus tegument protein ppUL32 (pp150) controls cytoplasmic events during virion maturation. J. Virol. 2006, 80, 8199–8210. [Google Scholar] [CrossRef]
- Tandon, R.; Mocarski, E.S. Control of cytoplasmic maturation events by cytomegalovirus tegument protein pp150. J. Virol. 2008, 82, 9433–9444. [Google Scholar] [CrossRef]
- Dai, X.; Yu, X.; Gong, H.; Jiang, X.; Abenes, G.; Liu, H.; Shivakoti, S.; Britt, W.J.; Zhu, H.; Liu, F.; et al. The smallest capsid protein mediates binding of the essential tegument protein pp150 to stabilize DNA-containing capsids in human cytomegalovirus. PLoS Pathog. 2013, 9, e1003525. [Google Scholar] [CrossRef]
- Bogdanow, B.; Weisbach, H.; von Einem, J.; Straschewski, S.; Voigt, S.; Winkler, M.; Hagemeier, C.; Wiebusch, L. Human cytomegalovirus tegument protein pp150 acts as a cyclin A2-CDK-dependent sensor of the host cell cycle and differentiation state. Proc. Natl. Acad. Sci. USA 2013, 110, 17510–17515. [Google Scholar] [CrossRef]
- Kwon, K.M.; Kim, Y.E.; Lee, M.K.; Chung, W.C.; Hyeon, S.; Han, M.; Lee, D.; Gong, S.; Ahn, J.H. Human Cytomegalovirus UL48 Deubiquitinase Primarily Targets Innermost Tegument Proteins pp150 and Itself To Regulate Their Stability and Protects Virions from Inclusion of Ubiquitin Conjugates. J. Virol. 2021, 95, e0099121. [Google Scholar] [CrossRef]
- Casarosa, P.; Gruijthuijsen, Y.K.; Michel, D.; Beisser, P.S.; Holl, J.; Fitzsimons, C.P.; Verzijl, D.; Bruggeman, C.A.; Mertens, T.; Leurs, R.; et al. Constitutive signaling of the human cytomegalovirus-encoded receptor UL33 differs from that of its rat cytomegalovirus homolog R33 by promiscuous activation of G proteins of the Gq, Gi, and Gs classes. J. Biol. Chem. 2003, 278, 50010–50023. [Google Scholar] [CrossRef]
- Beisser, P.S.; Goh, C.S.; Cohen, F.E.; Michelson, S. Viral chemokine receptors and chemokines in human cytomegalovirus trafficking and interaction with the immune system. CMV chemokine receptors. Curr. Top. Microbiol. Immunol. 2002, 269, 203–234. [Google Scholar] [PubMed]
- Tadagaki, K.; Tudor, D.; Gbahou, F.; Tschische, P.; Waldhoer, M.; Bomsel, M.; Jockers, R.; Kamal, M. Human cytomegalovirus-encoded UL33 and UL78 heteromerize with host CCR5 and CXCR4 impairing their HIV coreceptor activity. Blood 2012, 119, 4908–4918. [Google Scholar] [CrossRef] [PubMed]
- Van Senten, J.R.; Bebelman, M.P.; Fan, T.S.; Heukers, R.; Bergkamp, N.D.; van Gasselt, P.; Langemeijer, E.V.; Slinger, E.; Lagerweij, T.; Rahbar, A.; et al. The human cytomegalovirus-encoded G protein-coupled receptor UL33 exhibits oncomodulatory properties. J. Biol. Chem. 2019, 294, 16297–16308. [Google Scholar] [CrossRef] [PubMed]
- Van Senten, J.R.; Bebelman, M.P.; van Gasselt, P.; Bergkamp, N.D.; van den Bor, J.; Siderius, M.; Smit, M.J. Human Cytomegalovirus-Encoded G Protein-Coupled Receptor UL33 Facilitates Virus Dissemination via the Extracellular and Cell-to-Cell Route. Viruses 2020, 12, 594. [Google Scholar] [CrossRef] [PubMed]
- Krishna, B.A.; Wass, A.B.; Dooley, A.L.; O’Connor, C.M. CMV-encoded GPCR pUL33 activates CREB and facilitates its recruitment to the MIE locus for efficient viral reactivation. J. Cell Sci. 2021, 134, jcs254268. [Google Scholar] [CrossRef]
- Davis-Poynter, N.; Farrell, H.E. Constitutive Signaling by the Human Cytomegalovirus G Protein Coupled Receptor Homologs US28 and UL33 Enables Trophoblast Migration In Vitro. Viruses 2022, 14, 391. [Google Scholar] [CrossRef]
- Lester, E.; Rana, R.; Liu, Z.; Biegalke, B.J. Identification of the functional domains of the essential human cytomegalovirus UL34 proteins. Virology 2006, 353, 27–34. [Google Scholar] [CrossRef][Green Version]
- Biegalke, B.J.; Lester, E.; Branda, A.; Rana, R. Characterization of the human cytomegalovirus UL34 gene. J. Virol. 2004, 78, 9579–9583. [Google Scholar] [CrossRef]
- Rana, R.; Biegalke, B.J. Human cytomegalovirus UL34 early and late proteins are essential for viral replication. Viruses 2014, 6, 476–488. [Google Scholar] [CrossRef]
- Slayton, M.; Hossain, T.; Biegalke, B.J. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth. Virology 2018, 518, 414–422. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Biegalke, B.J. Human cytomegalovirus UL34 binds to multiple sites within the viral genome. J. Virol. 2013, 87, 3587–3591. [Google Scholar] [CrossRef] [PubMed]
- Turner, D.L.; Templin, R.M.; Barugahare, A.A.; Russ, B.E.; Turner, S.J.; Ramm, G.; Mathias, R.A. UL34 Deletion Restricts Human Cytomegalovirus Capsid Formation and Maturation. Int. J. Mol. Sci. 2022, 23, 5773. [Google Scholar] [CrossRef] [PubMed]
- Schierling, K.; Buser, C.; Mertens, T.; Winkler, M. Human cytomegalovirus tegument protein ppUL35 is important for viral replication and particle formation. J. Virol. 2005, 79, 3084–3096. [Google Scholar] [CrossRef]
- Liu, Y.; Biegalke, B.J. The human cytomegalovirus UL35 gene encodes two proteins with different functions. J. Virol. 2002, 76, 2460–2468. [Google Scholar] [CrossRef]
- Salsman, J.; Jagannathan, M.; Paladino, P.; Chan, P.K.; Dellaire, G.; Raught, B.; Frappier, L. Proteomic profiling of the human cytomegalovirus UL35 gene products reveals a role for UL35 in the DNA repair response. J. Virol. 2012, 86, 806–820. [Google Scholar] [CrossRef] [PubMed]
- Fabits, M.; Goncalves Magalhaes, V.; Chan, B.; Girault, V.; Elbasani, E.; Rossetti, E.; Saeland, E.; Messerle, M.; Pichlmair, A.; Lisnic, V.J.; et al. The Cytomegalovirus Tegument Protein UL35 Antagonizes Pattern Recognition Receptor-Mediated Type I IFN Transcription. Microorganisms 2020, 8, 790. [Google Scholar] [CrossRef]
- Colberg-Poley, A.M.; Santomenna, L.D.; Harlow, P.P.; Benfield, P.A.; Tenney, D.J. Human cytomegalovirus US3 and UL36-38 immediate-early proteins regulate gene expression. J. Virol. 1992, 66, 95–105. [Google Scholar] [CrossRef]
- McCormick, A.L.; Roback, L.; Livingston-Rosanoff, D.; St Clair, C. The human cytomegalovirus UL36 gene controls caspase-dependent and -independent cell death programs activated by infection of monocytes differentiating to macrophages. J. Virol. 2010, 84, 5108–5123. [Google Scholar] [CrossRef]
- Muscolino, E.; Castiglioni, C.; Brixel, R.; Frascaroli, G.; Brune, W. Species-Specific Inhibition of Necroptosis by HCMV UL36. Viruses 2021, 13, 2134. [Google Scholar] [CrossRef]
- Smith, J.A.; Pari, G.S. Expression of human cytomegalovirus UL36 and UL37 genes is required for viral DNA replication. J. Virol. 1995, 69, 1925–1931. [Google Scholar] [CrossRef]
- Biegalke, B.J. Human cytomegalovirus US3 gene expression is regulated by a complex network of positive and negative regulators. Virology 1999, 261, 155–164. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ren, Y.; Wang, A.; Wu, D.; Wang, C.; Huang, M.; Xiong, X.; Jin, L.; Zhou, W.; Qiu, Y.; Zhou, X. Dual inhibition of innate immunity and apoptosis by human cytomegalovirus protein UL37x1 enables efficient virus replication. Nat. Microbiol. 2022, 7, 1041–1053. [Google Scholar] [CrossRef]
- Williamson, C.D.; Zhang, A.; Colberg-Poley, A.M. The human cytomegalovirus protein UL37 exon 1 associates with internal lipid rafts. J. Virol. 2011, 85, 2100–2111. [Google Scholar] [CrossRef]
- Zhang, A.; Hildreth, R.L.; Colberg-Poley, A.M. Human cytomegalovirus inhibits apoptosis by proteasome-mediated degradation of Bax at endoplasmic reticulum-mitochondrion contacts. J. Virol. 2013, 87, 5657–5668. [Google Scholar] [CrossRef] [PubMed]
- Goldmacher, V.S.; Bartle, L.M.; Skaletskaya, A.; Dionne, C.A.; Kedersha, N.L.; Vater, C.A.; Han, J.W.; Lutz, R.J.; Watanabe, S.; Cahir McFarland, E.D.; et al. A cytomegalovirus-encoded mitochondria-localized inhibitor of apoptosis structurally unrelated to Bcl-2. Proc. Natl. Acad. Sci. USA 1999, 96, 12536–12541. [Google Scholar] [CrossRef] [PubMed]
- Xi, Y.; Harwood, S.; Wise, L.M.; Purdy, J.G. Human Cytomegalovirus pUL37x1 Is Important for Remodeling of Host Lipid Metabolism. J. Virol. 2019, 93, e00843-19. [Google Scholar] [CrossRef] [PubMed]
- Wyrwicz, L.S.; Rychlewski, L. Cytomegalovirus immediate early gene UL37 encodes a novel MHC-like protein. Acta Biochim. Pol. 2008, 55, 67–73. [Google Scholar] [CrossRef]
- Mavinakere, M.S.; Williamson, C.D.; Goldmacher, V.S.; Colberg-Poley, A.M. Processing of human cytomegalovirus UL37 mutant glycoproteins in the endoplasmic reticulum lumen prior to mitochondrial importation. J. Virol. 2006, 80, 6771–6783. [Google Scholar] [CrossRef]
- Terhune, S.; Torigoi, E.; Moorman, N.; Silva, M.; Qian, Z.; Shenk, T.; Yu, D. Human cytomegalovirus UL38 protein blocks apoptosis. J. Virol. 2007, 81, 3109–3123. [Google Scholar] [CrossRef]
- Xuan, B.; Qian, Z.; Torigoi, E.; Yu, D. Human cytomegalovirus protein pUL38 induces ATF4 expression, inhibits persistent JNK phosphorylation, and suppresses endoplasmic reticulum stress-induced cell death. J. Virol. 2009, 83, 3463–3474. [Google Scholar] [CrossRef]
- Qian, Z.; Xuan, B.; Gualberto, N.; Yu, D. The human cytomegalovirus protein pUL38 suppresses endoplasmic reticulum stress-mediated cell death independently of its ability to induce mTORC1 activation. J. Virol. 2011, 85, 9103–9113. [Google Scholar]
- Rodriguez-Sanchez, I.; Schafer, X.L.; Monaghan, M.; Munger, J. The Human Cytomegalovirus UL38 protein drives mTOR-independent metabolic flux reprogramming by inhibiting TSC2. PLoS Pathog. 2019, 15, e1007569. [Google Scholar] [CrossRef]
- Tomasec, P.; Braud, V.M.; Rickards, C.; Powell, M.B.; McSharry, B.P.; Gadola, S.; Cerundolo, V.; Borysiewicz, L.K.; McMichael, A.J.; Wilkinson, G.W. Surface expression of HLA-E, an inhibitor of natural killer cells, enhanced by human cytomegalovirus gpUL40. Science 2000, 287, 1031. [Google Scholar] [CrossRef] [PubMed]
- Prod’homme, V.; Tomasec, P.; Cunningham, C.; Lemberg, M.K.; Stanton, R.J.; McSharry, B.P.; Wang, E.C.; Cuff, S.; Martoglio, B.; Davison, A.J.; et al. Human cytomegalovirus UL40 signal peptide regulates cell surface expression of the NK cell ligands HLA-E and gpUL18. J. Immunol. 2012, 188, 2794–2804. [Google Scholar] [CrossRef]
- Ulbrecht, M.; Martinozzi, S.; Grzeschik, M.; Hengel, H.; Ellwart, J.W.; Pla, M.; Weiss, E.H. Cutting edge: The human cytomegalovirus UL40 gene product contains a ligand for HLA-E and prevents NK cell-mediated lysis. J. Immunol. 2000, 164, 5019–5022. [Google Scholar] [CrossRef] [PubMed]
- Hammer, Q.; Ruckert, T.; Borst, E.M.; Dunst, J.; Haubner, A.; Durek, P.; Heinrich, F.; Gasparoni, G.; Babic, M.; Tomic, A.; et al. Peptide-specific recognition of human cytomegalovirus strains controls adaptive natural killer cells. Nat. Immunol. 2018, 19, 453–463. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.Z.; Guo, Y.; Zou, H.M.; Su, S.; Wang, S.Y.; Yang, Q.; Luo, M.H.; Wang, Y.Y. Human cytomegalovirus protein UL42 antagonizes cGAS/MITA-mediated innate antiviral response. PLoS Pathog. 2019, 15, e1007691. [Google Scholar] [CrossRef] [PubMed]
- Koshizuka, T.; Tanaka, K.; Suzutani, T. Degradation of host ubiquitin E3 ligase Itch by human cytomegalovirus UL42. J. Gen. Virol. 2016, 97, 196–208. [Google Scholar]
- Koshizuka, T.; Kondo, H.; Kato, H.; Takahashi, K. Human cytomegalovirus UL42 protein inhibits the degradation of glycoprotein B through inhibition of Nedd4 family ubiquitin E3 ligases. Microbiol. Immunol. 2021, 65, 472–480. [Google Scholar] [CrossRef]
- Koshizuka, T.; Inoue, N. Activation of c-Jun by human cytomegalovirus UL42 through JNK activation. PLoS ONE 2020, 15, e0232635. [Google Scholar] [CrossRef]
- Neo, J.Y.J.; Wee, S.Y.K.; Bonne, I.; Tay, S.H.; Raida, M.; Jovanovic, V.; Fairhurst, A.M.; Lu, J.; Hanson, B.J.; MacAry, P.A. Characterisation of a human antibody that potentially links cytomegalovirus infection with systemic lupus erythematosus. Sci. Rep. 2019, 9, 9998. [Google Scholar] [CrossRef] [PubMed]
- Krosky, P.M.; Baek, M.C.; Jahng, W.J.; Barrera, I.; Harvey, R.J.; Biron, K.K.; Coen, D.M.; Sethna, P.B. The human cytomegalovirus UL44 protein is a substrate for the UL97 protein kinase. J. Virol. 2003, 77, 7720–7727. [Google Scholar] [CrossRef] [PubMed]
- Weiland, K.L.; Oien, N.L.; Homa, F.; Wathen, M.W. Functional analysis of human cytomegalovirus polymerase accessory protein. Virus Res. 1994, 34, 191–206. [Google Scholar] [CrossRef] [PubMed]
- Loregian, A.; Appleton, B.A.; Hogle, J.M.; Coen, D.M. Specific residues in the connector loop of the human cytomegalovirus DNA polymerase accessory protein UL44 are crucial for interaction with the UL54 catalytic subunit. J. Virol. 2004, 78, 9084–9092. [Google Scholar] [CrossRef]
- Loregian, A.; Appleton, B.A.; Hogle, J.M.; Coen, D.M. Residues of human cytomegalovirus DNA polymerase catalytic subunit UL54 that are necessary and sufficient for interaction with the accessory protein UL44. J. Virol. 2004, 78, 158–167. [Google Scholar] [CrossRef]
- Kwon, Y.; Kim, M.N.; Young Choi, E.; Heon Kim, J.; Hwang, E.S.; Cha, C.Y. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44. Microbiol. Immunol. 2012, 56, 324–331. [Google Scholar] [CrossRef]
- Fu, Y.Z.; Su, S.; Zou, H.M.; Guo, Y.; Wang, S.Y.; Li, S.; Luo, M.H.; Wang, Y.Y. Human Cytomegalovirus DNA Polymerase Subunit UL44 Antagonizes Antiviral Immune Responses by Suppressing IRF3- and NF-kappaB-Mediated Transcription. J. Virol. 2019, 93, e00181-19. [Google Scholar] [CrossRef]
- Sinigalia, E.; Alvisi, G.; Segre, C.V.; Mercorelli, B.; Muratore, G.; Winkler, M.; Hsiao, H.H.; Urlaub, H.; Ripalti, A.; Chiocca, S.; et al. The human cytomegalovirus DNA polymerase processivity factor UL44 is modified by SUMO in a DNA-dependent manner. PLoS ONE 2012, 7, e49630. [Google Scholar] [CrossRef]
- Chen, J.; Li, G.; He, H.; Li, X.; Niu, W.; Cao, D.; Shen, A. Sumoylation of the Carboxy-Terminal of Human Cytomegalovirus DNA Polymerase Processivity Factor UL44 Attenuates Viral DNA Replication. Front. Microbiol. 2021, 12, 652719. [Google Scholar] [CrossRef] [PubMed]
- Patrone, M.; Percivalle, E.; Secchi, M.; Fiorina, L.; Pedrali-Noy, G.; Zoppe, M.; Baldanti, F.; Hahn, G.; Koszinowski, U.H.; Milanesi, G.; et al. The human cytomegalovirus UL45 gene product is a late, virion-associated protein and influences virus growth at low multiplicities of infection. J. Gen. Virol. 2003, 84 Pt 12, 3359–3370. [Google Scholar] [CrossRef]
- Kwon, K.M.; Oh, S.E.; Kim, Y.E.; Han, T.H.; Ahn, J.H. Cooperative inhibition of RIP1-mediated NF-kappaB signaling by cytomegalovirus-encoded deubiquitinase and inactive homolog of cellular ribonucleotide reductase large subunit. PLoS Pathog. 2017, 13, e1006423. [Google Scholar] [CrossRef] [PubMed]
- Ivanova, L.; Schlesinger, S.; Olivo, P.D. Regulated expression of a Sindbis virus replicon by herpesvirus promoters. J. Virol. 1999, 73, 1998–2005. [Google Scholar] [CrossRef] [PubMed]
- Hahn, G.; Khan, H.; Baldanti, F.; Koszinowski, U.H.; Revello, M.G.; Gerna, G. The human cytomegalovirus ribonucleotide reductase homolog UL45 is dispensable for growth in endothelial cells, as determined by a BAC-cloned clinical isolate of human cytomegalovirus with preserved wild-type characteristics. J. Virol. 2002, 76, 9551–9555. [Google Scholar] [CrossRef] [PubMed]
- Gibson, W.; Baxter, M.K.; Clopper, K.S. Cytomegalovirus “missing” capsid protein identified as heat-aggregable product of human cytomegalovirus UL46. J. Virol. 1996, 70, 7454–7461. [Google Scholar] [CrossRef] [PubMed]
- Cappadona, I.; Villinger, C.; Schutzius, G.; Mertens, T.; von Einem, J. Human Cytomegalovirus pUL47 Modulates Tegumentation and Capsid Accumulation at the Viral Assembly Complex. J. Virol. 2015, 89, 7314–7328. [Google Scholar] [CrossRef]
- Bechtel, J.T.; Shenk, T. Human cytomegalovirus UL47 tegument protein functions after entry and before immediate-early gene expression. J. Virol. 2002, 76, 1043–1050. [Google Scholar] [CrossRef]
- Wang, J.; Loveland, A.N.; Kattenhorn, L.M.; Ploegh, H.L.; Gibson, W. High-molecular-weight protein (pUL48) of human cytomegalovirus is a competent deubiquitinating protease: Mutant viruses altered in its active-site cysteine or histidine are viable. J. Virol. 2006, 80, 6003–6012. [Google Scholar] [CrossRef]
- Das, S.; Ortiz, D.A.; Gurczynski, S.J.; Khan, F.; Pellett, P.E. Identification of human cytomegalovirus genes important for biogenesis of the cytoplasmic virion assembly complex. J. Virol. 2014, 88, 9086–9099. [Google Scholar] [CrossRef]
- Kim, Y.E.; Oh, S.E.; Kwon, K.M.; Lee, C.H.; Ahn, J.H. Involvement of the N-Terminal Deubiquitinating Protease Domain of Human Cytomegalovirus UL48 Tegument Protein in Autoubiquitination, Virion Stability, and Virus Entry. J. Virol. 2016, 90, 3229–3242. [Google Scholar] [CrossRef]
- Gibson, W.; Clopper, K.S.; Britt, W.J.; Baxter, M.K. Human cytomegalovirus (HCMV) smallest capsid protein identified as product of short open reading frame located between HCMV UL48 and UL49. J. Virol. 1996, 70, 5680–5683. [Google Scholar] [CrossRef]
- Lai, L.; Britt, W.J. The interaction between the major capsid protein and the smallest capsid protein of human cytomegalovirus is dependent on two linear sequences in the smallest capsid protein. J. Virol. 2003, 77, 2730–2735. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Li, Y.; Zhao, G.; Wu, Y.; Zhang, X.; Li, H.; Zhou, T. Inhibition of human cytomegalovirus DNA replication by small interfering RNAs targeted to UL49. Acta Biochim. Biophys. Sin. 2013, 45, 401–407. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Li, H.; Li, Y.; Zeng, Z.; Li, S.; Zhang, X.; Zou, Y.; Zhou, T. Effective inhibition of HCMV UL49 gene expression and viral replication by oligonucleotide external guide sequences and RNase P. Virol. J. 2010, 7, 100. [Google Scholar] [CrossRef]
- Zhu, F.; Yuan, J.; Li, H.J.; Zeng, Z.F.; Luo, Z.W.; Li, S.Q.; He, C.Q.; Jia, X.F.; Zhang, X.; Zuo, H.; et al. Human cytomegalovirus UL49 encodes an early, virion-associated protein essential for virus growth in human foreskin fibroblasts. Arch. Virol. 2016, 161, 1273–1284. [Google Scholar] [CrossRef] [PubMed]
- Turner, D.L.; Fritzlar, S.; Sadeghipour, S.; Barugahare, A.A.; Russ, B.E.; Turner, S.J.; Mathias, R.A. UL49 is an essential subunit of the viral pre-initiation complex that regulates human cytomegalovirus gene transcription. iScience 2022, 25, 105168. [Google Scholar] [CrossRef]
- Sharma, M.; Kamil, J.P.; Coughlin, M.; Reim, N.I.; Coen, D.M. Human cytomegalovirus UL50 and UL53 recruit viral protein kinase UL97, not protein kinase C, for disruption of nuclear lamina and nuclear egress in infected cells. J. Virol. 2014, 88, 249–262. [Google Scholar] [CrossRef]
- Lee, M.K.; Kim, Y.J.; Kim, Y.E.; Han, T.H.; Milbradt, J.; Marschall, M.; Ahn, J.H. Transmembrane Protein pUL50 of Human Cytomegalovirus Inhibits ISGylation by Downregulating UBE1L. J. Virol. 2018, 92, e00462-18. [Google Scholar] [CrossRef]
- Sonntag, E.; Hamilton, S.T.; Bahsi, H.; Wagner, S.; Jonjic, S.; Rawlinson, W.D.; Marschall, M.; Milbradt, J. Cytomegalovirus pUL50 is the multi-interacting determinant of the core nuclear egress complex (NEC) that recruits cellular accessory NEC components. J. Gen. Virol. 2016, 97, 1676–1685. [Google Scholar] [CrossRef]
- Lee, M.K.; Hyeon, S.; Ahn, J.H. The Human Cytomegalovirus Transmembrane Protein pUL50 Induces Loss of VCP/p97 and Is Regulated by a Small Isoform of pUL50. J. Virol. 2020, 94, e00110-20. [Google Scholar] [CrossRef]
- Borst, E.M.; Kleine-Albers, J.; Gabaev, I.; Babic, M.; Wagner, K.; Binz, A.; Degenhardt, I.; Kalesse, M.; Jonjic, S.; Bauerfeind, R.; et al. The human cytomegalovirus UL51 protein is essential for viral genome cleavage-packaging and interacts with the terminase subunits pUL56 and pUL89. J. Virol. 2013, 87, 1720–1732. [Google Scholar] [CrossRef]
- Neuber, S.; Wagner, K.; Goldner, T.; Lischka, P.; Steinbrueck, L.; Messerle, M.; Borst, E.M. Mutual Interplay between the Human Cytomegalovirus Terminase Subunits pUL51, pUL56, and pUL89 Promotes Terminase Complex Formation. J. Virol. 2017, 91, e02384-16. [Google Scholar] [CrossRef] [PubMed]
- Neuber, S.; Wagner, K.; Messerle, M.; Borst, E.M. The C-terminal part of the human cytomegalovirus terminase subunit pUL51 is central for terminase complex assembly. J. Gen. Virol. 2018, 99, 119–134. [Google Scholar] [CrossRef] [PubMed]
- Borst, E.M.; Wagner, K.; Binz, A.; Sodeik, B.; Messerle, M. The essential human cytomegalovirus gene UL52 is required for cleavage-packaging of the viral genome. J. Virol. 2008, 82, 2065–2078. [Google Scholar] [CrossRef] [PubMed]
- Dal Monte, P.; Pignatelli, S.; Zini, N.; Maraldi, N.M.; Perret, E.; Prevost, M.C.; Landini, M.P. Analysis of intracellular and intraviral localization of the human cytomegalovirus UL53 protein. J. Gen. Virol. 2002, 83 Pt 5, 1005–1012. [Google Scholar] [CrossRef]
- Kuan, M.I.; O’Dowd, J.M.; Fortunato, E.A. The absence of p53 during Human Cytomegalovirus infection leads to decreased UL53 expression, disrupting UL50 localization to the inner nuclear membrane, and thereby inhibiting capsid nuclear egress. Virology 2016, 497, 262–278. [Google Scholar] [CrossRef] [PubMed]
- Wilkie, A.R.; Sharma, M.; Coughlin, M.; Pesola, J.M.; Ericsson, M.; Lawler, J.L.; Fernandez, R.; Coen, D.M. Human Cytomegalovirus Nuclear Egress Complex Subunit, UL53, Associates with Capsids and Myosin Va, but Is Not Important for Capsid Localization towards the Nuclear Periphery. Viruses 2022, 14, 479. [Google Scholar] [CrossRef]
- Galitska, G.; Biolatti, M.; De Andrea, M.; Leone, A.; Coscia, A.; Bertolotti, L.; Ala, U.; Bertino, E.; Dell’Oste, V.; Landolfo, S. Biological relevance of Cytomegalovirus genetic variability in congenitally and postnatally infected children. J. Clin. Virol. Off. Publ. Pan Am. Soc. Clin. Virol. 2018, 108, 132–140. [Google Scholar] [CrossRef] [PubMed]
- Yurochko, A.D.; Hwang, E.S.; Rasmussen, L.; Keay, S.; Pereira, L.; Huang, E.S. The human cytomegalovirus UL55 (gB) and UL75 (gH) glycoprotein ligands initiate the rapid activation of Sp1 and NF-kappaB during infection. J. Virol. 1997, 71, 5051–5059. [Google Scholar] [CrossRef]
- Navarro, D.; Paz, P.; Tugizov, S.; Topp, K.; La Vail, J.; Pereira, L. Glycoprotein B of human cytomegalovirus promotes virion penetration into cells, transmission of infection from cell to cell, and fusion of infected cells. Virology 1993, 197, 143–158. [Google Scholar] [CrossRef]
- Jarvis, M.A.; Jones, T.R.; Drummond, D.D.; Smith, P.P.; Britt, W.J.; Nelson, J.A.; Baldick, C.J. Phosphorylation of human cytomegalovirus glycoprotein B (gB) at the acidic cluster casein kinase 2 site (Ser900) is required for localization of gB to the trans-Golgi network and efficient virus replication. J. Virol. 2004, 78, 285–293. [Google Scholar] [CrossRef]
- Isaacson, M.K.; Compton, T. Human cytomegalovirus glycoprotein B is required for virus entry and cell-to-cell spread but not for virion attachment, assembly, or egress. J. Virol. 2009, 83, 3891–3903. [Google Scholar] [CrossRef] [PubMed]
- Xiaofei, E.; Stadler, B.M.; Debatis, M.; Wang, S.; Lu, S.; Kowalik, T.F. RNA interference-mediated targeting of human cytomegalovirus immediate-early or early gene products inhibits viral replication with differential effects on cellular functions. J. Virol. 2012, 86, 5660–5673. [Google Scholar]
- Lopper, M.; Compton, T. Coiled-coil domains in glycoproteins B and H are involved in human cytomegalovirus membrane fusion. J. Virol. 2004, 78, 8333–8341. [Google Scholar] [CrossRef] [PubMed]
- Bogner, E.; Radsak, K.; Stinski, M.F. The gene product of human cytomegalovirus open reading frame UL56 binds the pac motif and has specific nuclease activity. J. Virol. 1998, 72, 2259–2264. [Google Scholar] [CrossRef]
- Champier, G.; Couvreux, A.; Hantz, S.; Rametti, A.; Mazeron, M.C.; Bouaziz, S.; Denis, F.; Alain, S. Putative functional domains of human cytomegalovirus pUL56 involved in dimerization and benzimidazole D-ribonucleoside activity. Antivir. Ther. 2008, 13, 643–654. [Google Scholar] [CrossRef]
- Scholz, B.; Rechter, S.; Drach, J.C.; Townsend, L.B.; Bogner, E. Identification of the ATP-binding site in the terminase subunit pUL56 of human cytomegalovirus. Nucleic Acids Res. 2003, 31, 1426–1433. [Google Scholar] [CrossRef]
- Woon, H.G.; Scott, G.M.; Yiu, K.L.; Miles, D.H.; Rawlinson, W.D. Identification of putative functional motifs in viral proteins essential for human cytomegalovirus DNA replication. Virus Genes 2008, 37, 193–202. [Google Scholar] [CrossRef] [PubMed]
- Herbein, G. The Human Cytomegalovirus, from Oncomodulation to Oncogenesis. Viruses 2018, 10, 408. [Google Scholar] [CrossRef]
- Rossetto, C.C.; Tarrant-Elorza, M.; Pari, G.S. Cis and trans acting factors involved in human cytomegalovirus experimental and natural latent infection of CD14 (+) monocytes and CD34 (+) cells. PLoS Pathog. 2013, 9, e1003366. [Google Scholar] [CrossRef]
- Tai-Schmiedel, J.; Karniely, S.; Lau, B.; Ezra, A.; Eliyahu, E.; Nachshon, A.; Kerr, K.; Suarez, N.; Schwartz, M.; Davison, A.J.; et al. Human cytomegalovirus long noncoding RNA4.9 regulates viral DNA replication. PLoS Pathog. 2020, 16, e1008390. [Google Scholar] [CrossRef]
- Winkler, M.; Rice, S.A.; Stamminger, T. UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression. J. Virol. 1994, 68, 3943–3954. [Google Scholar] [CrossRef] [PubMed]
- Lischka, P.; Toth, Z.; Thomas, M.; Mueller, R.; Stamminger, T. The UL69 transactivator protein of human cytomegalovirus interacts with DEXD/H-Box RNA helicase UAP56 to promote cytoplasmic accumulation of unspliced RNA. Mol. Cell. Biol. 2006, 26, 1631–1643. [Google Scholar] [CrossRef] [PubMed]
- Lu, M.; Shenk, T. Human cytomegalovirus UL69 protein induces cells to accumulate in G1 phase of the cell cycle. J. Virol. 1999, 73, 676–683. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, M.L.; Blankenship, C.; Shenk, T. Human cytomegalovirus UL69 protein is required for efficient accumulation of infected cells in the G1 phase of the cell cycle. Proc. Natl. Acad. Sci. USA 2000, 97, 2692–2696. [Google Scholar] [CrossRef]
- Lischka, P.; Rosorius, O.; Trommer, E.; Stamminger, T. A novel transferable nuclear export signal mediates CRM1-independent nucleocytoplasmic shuttling of the human cytomegalovirus transactivator protein pUL69. EMBO J. 2001, 20, 7271–7283. [Google Scholar] [CrossRef][Green Version]
- Toth, Z.; Stamminger, T. The human cytomegalovirus regulatory protein UL69 and its effect on mRNA export. Front. Biosci. 2008, 13, 2939–2949. [Google Scholar] [CrossRef]
- Thomas, M.; Sonntag, E.; Muller, R.; Schmidt, S.; Zielke, B.; Fossen, T.; Stamminger, T. pUL69 of Human Cytomegalovirus Recruits the Cellular Protein Arginine Methyltransferase 6 via a Domain That Is Crucial for mRNA Export and Efficient Viral Replication. J. Virol. 2015, 89, 9601–9615. [Google Scholar] [CrossRef][Green Version]
- Pari, G.S. Nuts and bolts of human cytomegalovirus lytic DNA replication. Curr. Top. Microbiol. Immunol. 2008, 325, 153–166. [Google Scholar]
- Shen, A.; Lei, J.; Yang, E.; Pei, Y.; Chen, Y.C.; Gong, H.; Xiao, G.; Liu, F. Human cytomegalovirus primase UL70 specifically interacts with cellular factor Snapin. J. Virol. 2011, 85, 11732–11741. [Google Scholar] [CrossRef] [PubMed]
- Pei, Y.; Fu, W.; Yang, E.; Shen, A.; Chen, Y.C.; Gong, H.; Chen, J.; Huang, J.; Xiao, G.; Liu, F. A Hsp40 chaperone protein interacts with and modulates the cellular distribution of the primase protein of human cytomegalovirus. PLoS Pathog. 2012, 8, e1002968. [Google Scholar] [CrossRef] [PubMed]
- Schauflinger, M.; Fischer, D.; Schreiber, A.; Chevillotte, M.; Walther, P.; Mertens, T.; von Einem, J. The tegument protein UL71 of human cytomegalovirus is involved in late envelopment and affects multivesicular bodies. J. Virol. 2011, 85, 3821–3832. [Google Scholar] [CrossRef] [PubMed]
- Meissner, C.S.; Suffner, S.; Schauflinger, M.; von Einem, J.; Bogner, E. A leucine zipper motif of a tegument protein triggers final envelopment of human cytomegalovirus. J. Virol. 2012, 86, 3370–3382. [Google Scholar] [CrossRef] [PubMed]
- Dietz, A.N.; Villinger, C.; Becker, S.; Frick, M.; von Einem, J. A Tyrosine-Based Trafficking Motif of the Tegument Protein pUL71 Is Crucial for Human Cytomegalovirus Secondary Envelopment. J. Virol. 2018, 92, e00907-17. [Google Scholar] [CrossRef] [PubMed]
- Read, C.; Schauflinger, M.; Nikolaenko, D.; Walther, P.; von Einem, J. Regulation of Human Cytomegalovirus Secondary Envelopment by a C-Terminal Tetralysine Motif in pUL71. J. Virol. 2019, 93, e02244-18. [Google Scholar] [CrossRef]
- Caposio, P.; Riera, L.; Hahn, G.; Landolfo, S.; Gribaudo, G. Evidence that the human cytomegalovirus 46-kDa UL72 protein is not an active dUTPase but a late protein dispensable for replication in fibroblasts. Virology 2004, 325, 264–276. [Google Scholar] [CrossRef]
- Dal Monte, P.; Pignatelli, S.; Mach, M.; Landini, M.P. The product of human cytomegalovirus UL73 is a new polymorphic structural glycoprotein (gpUL73). J. Hum. Virol. 2001, 4, 26–34. [Google Scholar]
- Pignatelli, S.; Dal Monte, P.; Landini, M.P. gpUL73 (gN) genomic variants of human cytomegalovirus isolates are clustered into four distinct genotypes. J. Gen. Virol. 2001, 82, 2777–2784. [Google Scholar] [CrossRef]
- Mach, M.; Kropff, B.; Kryzaniak, M.; Britt, W. Complex formation by glycoproteins M and N of human cytomegalovirus: Structural and functional aspects. J. Virol. 2005, 79, 2160–2170. [Google Scholar] [CrossRef]
- Dal Monte, P.; Pignatelli, S.; Rossini, G.; Landini, M.P. Genomic variants among human cytomegalovirus (HCMV) clinical isolates: The glycoprotein n (gN) paradigm. Hum. Immunol. 2004, 65, 387–394. [Google Scholar] [CrossRef]
- Huber, M.T.; Compton, T. The human cytomegalovirus UL74 gene encodes the third component of the glycoprotein H-glycoprotein L-containing envelope complex. J. Virol. 1998, 72, 8191–8197. [Google Scholar] [CrossRef]
- Paterson, D.A.; Dyer, A.P.; Milne, R.S.; Sevilla-Reyes, E.; Gompels, U.A. A role for human cytomegalovirus glycoprotein O (gO) in cell fusion and a new hypervariable locus. Virology 2002, 293, 281–294. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Lanchy, J.M.; Ryckman, B.J. Human Cytomegalovirus gH/gL/gO Promotes the Fusion Step of Entry into All Cell Types, whereas gH/gL/UL128-131 Broadens Virus Tropism through a Distinct Mechanism. J. Virol. 2015, 89, 8999–9009. [Google Scholar] [CrossRef] [PubMed]
- Kinzler, E.R.; Compton, T. Characterization of human cytomegalovirus glycoprotein-induced cell-cell fusion. J. Virol. 2005, 79, 7827–7837. [Google Scholar] [CrossRef]
- Jiang, X.J.; Adler, B.; Sampaio, K.L.; Digel, M.; Jahn, G.; Ettischer, N.; Stierhof, Y.D.; Scrivano, L.; Koszinowski, U.; Mach, M.; et al. UL74 of human cytomegalovirus contributes to virus release by promoting secondary envelopment of virions. J. Virol. 2008, 82, 2802–2812. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.J.; Sampaio, K.L.; Ettischer, N.; Stierhof, Y.D.; Jahn, G.; Kropff, B.; Mach, M.; Sinzger, C. UL74 of human cytomegalovirus reduces the inhibitory effect of gH-specific and gB-specific antibodies. Arch. Virol. 2011, 156, 2145–2155. [Google Scholar] [CrossRef] [PubMed]
- Vanarsdall, A.L.; Chase, M.C.; Johnson, D.C. Human cytomegalovirus glycoprotein gO complexes with gH/gL, promoting interference with viral entry into human fibroblasts but not entry into epithelial cells. J. Virol. 2011, 85, 11638–11645. [Google Scholar] [CrossRef] [PubMed]
- Day, L.Z.; Stegmann, C.; Schultz, E.P.; Lanchy, J.M.; Yu, Q.; Ryckman, B.J. Polymorphisms in Human Cytomegalovirus Glycoprotein O (gO) Exert Epistatic Influences on Cell-Free and Cell-to-Cell Spread and Antibody Neutralization on gH Epitopes. J. Virol. 2020, 94, e02051-19. [Google Scholar] [CrossRef] [PubMed]
- McWatters, B.J.; Stenberg, R.M.; Kerry, J.A. Characterization of the human cytomegalovirus UL75 (glycoprotein H) late gene promoter. Virology 2002, 303, 309–316. [Google Scholar] [CrossRef][Green Version]
- Siew, V.K.; Duh, C.Y.; Wang, S.K. Human cytomegalovirus UL76 induces chromosome aberrations. J. Biomed. Sci. 2009, 16, 107. [Google Scholar] [CrossRef]
- Costa, H.; Nascimento, R.; Sinclair, J.; Parkhouse, R.M. Human cytomegalovirus gene UL76 induces IL-8 expression through activation of the DNA damage response. PLoS Pathog. 2013, 9, e1003609. [Google Scholar] [CrossRef]
- Isomura, H.; Stinski, M.F.; Murata, T.; Nakayama, S.; Chiba, S.; Akatsuka, Y.; Kanda, T.; Tsurumi, T. The human cytomegalovirus UL76 gene regulates the level of expression of the UL77 gene. PLoS ONE 2010, 5, e11901. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.R.; Jiang, M.J.; Wang, H.H.; Hu, C.H.; Hsu, M.S.; Hsi, E.; Duh, C.Y.; Wang, S.K. Human cytomegalovirus UL76 elicits novel aggresome formation via interaction with S5a of the ubiquitin proteasome system. J. Virol. 2013, 87, 11562–11578. [Google Scholar] [CrossRef]
- Koppen-Rung, P.; Dittmer, A.; Bogner, E. Intracellular Distribution of Capsid-Associated pUL77 of Human Cytomegalovirus and Interactions with Packaging Proteins and pUL93. J. Virol. 2016, 90, 5876–5885. [Google Scholar] [CrossRef] [PubMed]
- Meissner, C.S.; Koppen-Rung, P.; Dittmer, A.; Lapp, S.; Bogner, E. A “coiled-coil” motif is important for oligomerization and DNA binding properties of human cytomegalovirus protein UL77. PLoS ONE 2011, 6, e25115. [Google Scholar] [CrossRef]
- O’Connor, C.M.; Shenk, T. Human cytomegalovirus pUL78 G protein-coupled receptor homologue is required for timely cell entry in epithelial cells but not fibroblasts. J. Virol. 2012, 86, 11425–11433. [Google Scholar] [CrossRef] [PubMed]
- Tschische, P.; Tadagaki, K.; Kamal, M.; Jockers, R.; Waldhoer, M. Heteromerization of human cytomegalovirus encoded chemokine receptors. Biochem. Pharmacol. 2011, 82, 610–619. [Google Scholar] [CrossRef]
- Perng, Y.C.; Qian, Z.; Fehr, A.R.; Xuan, B.; Yu, D. The human cytomegalovirus gene UL79 is required for the accumulation of late viral transcripts. J. Virol. 2011, 85, 4841–4852. [Google Scholar] [CrossRef]
- Isomura, H.; Stinski, M.F.; Murata, T.; Yamashita, Y.; Kanda, T.; Toyokuni, S.; Tsurumi, T. The human cytomegalovirus gene products essential for late viral gene expression assemble into prereplication complexes before viral DNA replication. J. Virol. 2011, 85, 6629–6644. [Google Scholar] [CrossRef]
- Wang, L.; Li, M.; Cai, M.; Xing, J.; Wang, S.; Zheng, C. A PY-nuclear localization signal is required for nuclear accumulation of HCMV UL79 protein. Med. Microbiol. Immunol. 2012, 201, 381–387. [Google Scholar] [CrossRef]
- De Oliveira, C.A.; Guimaraes, C.R.; Barreiro, G.; de Alencastro, R.B. Investigation of the induced-fit mechanism and catalytic activity of the human cytomegalovirus protease homodimer via molecular dynamics simulations. Proteins 2003, 52, 483–491. [Google Scholar] [CrossRef]
- Nguyen, N.L.; Loveland, A.N.; Gibson, W. Nuclear localization sequences in cytomegalovirus capsid assembly proteins (UL80 proteins) are required for virus production: Inactivating NLS1, NLS2, or both affects replication to strikingly different extents. J. Virol. 2008, 82, 5381–5389. [Google Scholar] [CrossRef] [PubMed]
- Gibson, W. Structure and formation of the cytomegalovirus virion. Curr. Top. Microbiol. Immunol. 2008, 325, 187–204. [Google Scholar]
- Wood, L.J.; Baxter, M.K.; Plafker, S.M.; Gibson, W. Human cytomegalovirus capsid assembly protein precursor (pUL80.5) interacts with itself and with the major capsid protein (pUL86) through two different domains. J. Virol. 1997, 71, 179–190. [Google Scholar] [CrossRef]
- Loveland, A.N.; Nguyen, N.L.; Brignole, E.J.; Gibson, W. The amino-conserved domain of human cytomegalovirus UL80a proteins is required for key interactions during early stages of capsid formation and virus production. J. Virol. 2007, 81, 620–628. [Google Scholar] [CrossRef]
- Bresnahan, W.A.; Shenk, T.E. UL82 virion protein activates expression of immediate early viral genes in human cytomegalovirus-infected cells. Proc. Natl. Acad. Sci. USA 2000, 97, 14506–14511. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.; Stinski, M.F. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements. J. Virol. 1992, 66, 4434–4444. [Google Scholar] [CrossRef] [PubMed]
- Kalejta, R.F.; Shenk, T. The human cytomegalovirus UL82 gene product (pp71) accelerates progression through the G1 phase of the cell cycle. J. Virol. 2003, 77, 3451–3459. [Google Scholar] [CrossRef]
- Kalejta, R.F.; Bechtel, J.T.; Shenk, T. Human cytomegalovirus pp71 stimulates cell cycle progression by inducing the proteasome-dependent degradation of the retinoblastoma family of tumor suppressors. Mol. Cell. Biol. 2003, 23, 1885–1895. [Google Scholar] [CrossRef]
- Kalejta, R.F.; Shenk, T. Proteasome-dependent, ubiquitin-independent degradation of the Rb family of tumor suppressors by the human cytomegalovirus pp71 protein. Proc. Natl. Acad. Sci. USA 2003, 100, 3263–3268. [Google Scholar] [CrossRef]
- Kalejta, R.F. Human cytomegalovirus pp71: A new viral tool to probe the mechanisms of cell cycle progression and oncogenesis controlled by the retinoblastoma family of tumor suppressors. J. Cell. Biochem. 2004, 93, 37–45. [Google Scholar] [CrossRef]
- Cantrell, S.R.; Bresnahan, W.A. Interaction between the human cytomegalovirus UL82 gene product (pp71) and hDaxx regulates immediate-early gene expression and viral replication. J. Virol. 2005, 79, 7792–7802. [Google Scholar] [CrossRef] [PubMed]
- Saffert, R.T.; Kalejta, R.F. Inactivating a cellular intrinsic immune defense mediated by Daxx is the mechanism through which the human cytomegalovirus pp71 protein stimulates viral immediate-early gene expression. J. Virol. 2006, 80, 3863–3871. [Google Scholar] [CrossRef] [PubMed]
- Trgovcich, J.; Cebulla, C.; Zimmerman, P.; Sedmak, D.D. Human cytomegalovirus protein pp71 disrupts major histocompatibility complex class I cell surface expression. J. Virol. 2006, 80, 951–963. [Google Scholar] [CrossRef]
- Hwang, J.; Kalejta, R.F. Human cytomegalovirus protein pp71 induces Daxx SUMOylation. J. Virol. 2009, 83, 6591–6598. [Google Scholar] [CrossRef] [PubMed]
- Penkert, R.R.; Kalejta, R.F. Tale of a tegument transactivator: The past, present and future of human CMV pp71. Future Virol. 2012, 7, 855–869. [Google Scholar] [CrossRef]
- Fu, Y.Z.; Su, S.; Gao, Y.Q.; Wang, P.P.; Huang, Z.F.; Hu, M.M.; Luo, W.W.; Li, S.; Luo, M.H.; Wang, Y.Y.; et al. Human Cytomegalovirus Tegument Protein UL82 Inhibits STING-Mediated Signaling to Evade Antiviral Immunity. Cell Host Microbe 2017, 21, 231–243. [Google Scholar] [CrossRef] [PubMed]
- McLaughlin-Taylor, E.; Pande, H.; Forman, S.J.; Tanamachi, B.; Li, C.R.; Zaia, J.A.; Greenberg, P.D.; Riddell, S.R. Identification of the major late human cytomegalovirus matrix protein pp65 as a target antigen for CD8+ virus-specific cytotoxic T lymphocytes. J. Med. Virol. 1994, 43, 103–110. [Google Scholar] [CrossRef]
- Abate, D.A.; Watanabe, S.; Mocarski, E.S. Major human cytomegalovirus structural protein pp65 (ppUL83) prevents interferon response factor 3 activation in the interferon response. J. Virol. 2004, 78, 10995–11006. [Google Scholar] [CrossRef]
- Arnon, T.I.; Achdout, H.; Levi, O.; Markel, G.; Saleh, N.; Katz, G.; Gazit, R.; Gonen-Gross, T.; Hanna, J.; Nahari, E.; et al. Inhibition of the NKp30 activating receptor by pp65 of human cytomegalovirus. Nat. Immunol. 2005, 6, 515–523. [Google Scholar] [CrossRef]
- Arnon, T.I.; Markel, G.; Mandelboim, O. Tumor and viral recognition by natural killer cells receptors. Semin. Cancer Biol. 2006, 16, 348–358. [Google Scholar] [CrossRef]
- Odeberg, J.; Plachter, B.; Branden, L.; Soderberg-Naucler, C. Human cytomegalovirus protein pp65 mediates accumulation of HLA-DR in lysosomes and destruction of the HLA-DR alpha-chain. Blood 2003, 101, 4870–4877. [Google Scholar] [CrossRef] [PubMed]
- Tomtishen, J.P., 3rd. Human cytomegalovirus tegument proteins (pp65, pp71, pp150, pp28). Virol. J. 2012, 9, 22. [Google Scholar] [CrossRef] [PubMed]
- Cristea, I.M.; Moorman, N.J.; Terhune, S.S.; Cuevas, C.D.; O’Keefe, E.S.; Rout, M.P.; Chait, B.T.; Shenk, T. Human cytomegalovirus pUL83 stimulates activity of the viral immediate-early promoter through its interaction with the cellular IFI16 protein. J. Virol. 2010, 84, 7803–7814. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Chen, J.; Cristea, I.M. Human cytomegalovirus tegument protein pUL83 inhibits IFI16-mediated DNA sensing for immune evasion. Cell Host Microbe 2013, 14, 591–599. [Google Scholar] [CrossRef]
- Biolatti, M.; Dell’Oste, V.; Pautasso, S.; von Einem, J.; Marschall, M.; Plachter, B.; Gariglio, M.; De Andrea, M.; Landolfo, S. Regulatory Interaction between the Cellular Restriction Factor IFI16 and Viral pp65 (pUL83) Modulates Viral Gene Expression and IFI16 Protein Stability. J. Virol. 2016, 90, 8238–8250. [Google Scholar] [CrossRef]
- Huang, Y.; Ma, D.; Huang, H.; Lu, Y.; Liao, Y.; Liu, L.; Liu, X.; Fang, F. Interaction between HCMV pUL83 and human AIM2 disrupts the activation of the AIM2 inflammasome. Virol. J. 2017, 14, 34. [Google Scholar] [CrossRef]
- Biolatti, M.; Dell’Oste, V.; Pautasso, S.; Gugliesi, F.; von Einem, J.; Krapp, C.; Jakobsen, M.R.; Borgogna, C.; Gariglio, M.; De Andrea, M.; et al. Human Cytomegalovirus Tegument Protein pp65 (pUL83) Dampens Type I Interferon Production by Inactivating the DNA Sensor cGAS without Affecting STING. J. Virol. 2018, 92, e01774-17. [Google Scholar] [CrossRef]
- Xu, Y.; Cei, S.A.; Rodriguez Huete, A.; Colletti, K.S.; Pari, G.S. Human cytomegalovirus DNA replication requires transcriptional activation via an IE2- and UL84-responsive bidirectional promoter element within oriLyt. J. Virol. 2004, 78, 11664–11677. [Google Scholar] [CrossRef]
- Colletti, K.S.; Xu, Y.; Cei, S.A.; Tarrant, M.; Pari, G.S. Human cytomegalovirus UL84 oligomerization and heterodimerization domains act as transdominant inhibitors of oriLyt-dependent DNA replication: Evidence that IE2-UL84 and UL84-UL84 interactions are required for lytic DNA replication. J. Virol. 2004, 78, 9203–9214. [Google Scholar] [CrossRef]
- Colletti, K.S.; Smallenburg, K.E.; Xu, Y.; Pari, G.S. Human cytomegalovirus UL84 interacts with an RNA stem-loop sequence found within the RNA/DNA hybrid region of oriLyt. J. Virol. 2007, 81, 7077–7085. [Google Scholar] [CrossRef]
- Kagele, D.; Gao, Y.; Smallenburg, K.; Pari, G.S. Interaction of HCMV UL84 with C/EBPalpha transcription factor binding sites within oriLyt is essential for lytic DNA replication. Virology 2009, 392, 16–23. [Google Scholar] [CrossRef]
- Sarisky, R.T.; Hayward, G.S. Evidence that the UL84 gene product of human cytomegalovirus is essential for promoting oriLyt-dependent DNA replication and formation of replication compartments in cotransfection assays. J. Virol. 1996, 70, 7398–7413. [Google Scholar] [CrossRef]
- Xu, Y.; Colletti, K.S.; Pari, G.S. Human cytomegalovirus UL84 localizes to the cell nucleus via a nuclear localization signal and is a component of viral replication compartments. J. Virol. 2002, 76, 8931–8938. [Google Scholar] [CrossRef][Green Version]
- Xu, Y.; Cei, S.A.; Huete, A.R.; Pari, G.S. Human cytomegalovirus UL84 insertion mutant defective for viral DNA synthesis and growth. J. Virol. 2004, 78, 10360–10369. [Google Scholar] [CrossRef][Green Version]
- Gao, Y.; Kagele, D.; Smallenberg, K.; Pari, G.S. Nucleocytoplasmic shuttling of human cytomegalovirus UL84 is essential for virus growth. J. Virol. 2010, 84, 8484–8494. [Google Scholar] [CrossRef] [PubMed]
- Hwang, E.S.; Zhang, Z.; Cai, H.; Huang, D.Y.; Huong, S.M.; Cha, C.Y.; Huang, E.S. Human cytomegalovirus IE1-72 protein interacts with p53 and inhibits p53-dependent transactivation by a mechanism different from that of IE2-86 protein. J. Virol. 2009, 83, 12388–12398. [Google Scholar] [CrossRef] [PubMed]
- Mukai, T.; Isegawa, Y.; Yamanishi, K. Identification of the major capsid protein gene of human herpesvirus 7. Virus Res. 1995, 37, 55–62. [Google Scholar] [CrossRef]
- Kumar, R.; Cruz, L.; Sandhu, P.K.; Buchkovich, N.J. UL88 Mediates the Incorporation of a Subset of Proteins into the Virion Tegument. J. Virol. 2020, 94, e00474-20. [Google Scholar] [CrossRef]
- Bogner, E. Human cytomegalovirus terminase as a target for antiviral chemotherapy. Rev. Med. Virol. 2002, 12, 115–127. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Mao, L.; Kankanala, J.; Wang, Z.; Geraghty, R.J. Inhibition of Human Cytomegalovirus pUL89 Terminase Subunit Blocks Virus Replication and Genome Cleavage. J. Virol. 2017, 91, e02152-16. [Google Scholar] [CrossRef]
- Thoma, C.; Bogner, E. Short hairpin RNAs specific to human cytomegalovirus terminase subunit pUL89 prevent viral maturation. Antivir. Ther. 2010, 15, 391–400. [Google Scholar] [CrossRef]
- Buerger, I.; Reefschlaeger, J.; Bender, W.; Eckenberg, P.; Popp, A.; Weber, O.; Graeper, S.; Klenk, H.D.; Ruebsamen-Waigmann, H.; Hallenberger, S. A novel nonnucleoside inhibitor specifically targets cytomegalovirus DNA maturation via the UL89 and UL56 gene products. J. Virol. 2001, 75, 9077–9086. [Google Scholar] [CrossRef] [PubMed]
- Underwood, M.R.; Harvey, R.J.; Stanat, S.C.; Hemphill, M.L.; Miller, T.; Drach, J.C.; Townsend, L.B.; Biron, K.K. Inhibition of human cytomegalovirus DNA maturation by a benzimidazole ribonucleoside is mediated through the UL89 gene product. J. Virol. 1998, 72, 717–725. [Google Scholar] [CrossRef] [PubMed]
- Omoto, S.; Mocarski, E.S. Cytomegalovirus UL91 is essential for transcription of viral true late (gamma2) genes. J. Virol. 2013, 87, 8651–8664. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Omoto, S.; Mocarski, E.S. Transcription of true late (gamma2) cytomegalovirus genes requires UL92 function that is conserved among beta- and gammaherpesviruses. J. Virol. 2014, 88, 120–130. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Borst, E.M.; Bauerfeind, R.; Binz, A.; Stephan, T.M.; Neuber, S.; Wagner, K.; Steinbruck, L.; Sodeik, B.; Lenac Rovis, T.; Jonjic, S.; et al. The Essential Human Cytomegalovirus Proteins pUL77 and pUL93 Are Structural Components Necessary for Viral Genome Encapsidation. J. Virol. 2016, 90, 5860–5875. [Google Scholar] [CrossRef]
- DeRussy, B.M.; Tandon, R. Human Cytomegalovirus pUL93 Is Required for Viral Genome Cleavage and Packaging. J. Virol. 2015, 89, 12221–12225. [Google Scholar] [CrossRef]
- Zou, H.M.; Huang, Z.F.; Yang, Y.; Luo, W.W.; Wang, S.Y.; Luo, M.H.; Fu, Y.Z.; Wang, Y.Y. Human Cytomegalovirus Protein UL94 Targets MITA to Evade the Antiviral Immune Response. J. Virol. 2020, 94, e00022-20. [Google Scholar] [CrossRef]
- Phillips, S.L.; Bresnahan, W.A. The human cytomegalovirus (HCMV) tegument protein UL94 is essential for secondary envelopment of HCMV virions. J. Virol. 2012, 86, 2523–2532. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, Z.; Zhao, X.; Wei, H.; Deng, J.; Cui, Z.; Zhang, X.E. Human cytomegalovirus UL94 is a nucleocytoplasmic shuttling protein containing two NLSs and one NES. Virus Res. 2012, 166, 31–42. [Google Scholar] [CrossRef]
- Wing, B.A.; Lee, G.C.; Huang, E.S. The human cytomegalovirus UL94 open reading frame encodes a conserved herpesvirus capsid/tegument-associated virion protein that is expressed with true late kinetics. J. Virol. 1996, 70, 3339–3345. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Cui, Z.; Zhang, Z.; Wei, H.; Zhou, Y.; Wang, M.; Zhang, X.E. The tegument protein UL94 of human cytomegalovirus as a binding partner for tegument protein pp28 identified by intracellular imaging. Virology 2009, 388, 68–77. [Google Scholar] [CrossRef][Green Version]
- Phillips, S.L.; Cygnar, D.; Thomas, A.; Bresnahan, W.A. Interaction between the human cytomegalovirus tegument proteins UL94 and UL99 is essential for virus replication. J. Virol. 2012, 86, 9995–10005. [Google Scholar] [CrossRef]
- Tandon, R.; Mocarski, E.S. Cytomegalovirus pUL96 is critical for the stability of pp150-associated nucleocapsids. J. Virol. 2011, 85, 7129–7141. [Google Scholar] [CrossRef]
- Michel, D.; Mertens, T. The UL97 protein kinase of human cytomegalovirus and homologues in other herpesviruses: Impact on virus and host. Biochim. Biophys. Acta 2004, 1697, 169–180. [Google Scholar] [CrossRef]
- Dell’Oste, V.; Gatti, D.; Gugliesi, F.; De Andrea, M.; Bawadekar, M.; Lo Cigno, I.; Biolatti, M.; Vallino, M.; Marschall, M.; Gariglio, M.; et al. Innate nuclear sensor IFI16 translocates into the cytoplasm during the early stage of in vitro human cytomegalovirus infection and is entrapped in the egressing virions during the late stage. J. Virol. 2014, 88, 6970–6982. [Google Scholar] [CrossRef] [PubMed]
- Landolfo, S.; De Andrea, M.; Dell’Oste, V.; Gugliesi, F. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape. World J. Virol. 2016, 5, 87–96. [Google Scholar] [CrossRef] [PubMed]
- Bigley, T.M.; Reitsma, J.M.; Mirza, S.P.; Terhune, S.S. Human cytomegalovirus pUL97 regulates the viral major immediate early promoter by phosphorylation-mediated disruption of histone deacetylase 1 binding. J. Virol. 2013, 87, 7393–7408. [Google Scholar] [CrossRef]
- Graf, L.; Webel, R.; Wagner, S.; Hamilton, S.T.; Rawlinson, W.D.; Sticht, H.; Marschall, M. The cyclin-dependent kinase ortholog pUL97 of human cytomegalovirus interacts with cyclins. Viruses 2013, 5, 3213–3230. [Google Scholar] [CrossRef]
- Wolf, D.G.; Courcelle, C.T.; Prichard, M.N.; Mocarski, E.S. Distinct and separate roles for herpesvirus-conserved UL97 kinase in cytomegalovirus DNA synthesis and encapsidation. Proc. Natl. Acad. Sci. USA 2001, 98, 1895–1900. [Google Scholar] [CrossRef]
- Prichard, M.N.; Gao, N.; Jairath, S.; Mulamba, G.; Krosky, P.; Coen, D.M.; Parker, B.O.; Pari, G.S. A recombinant human cytomegalovirus with a large deletion in UL97 has a severe replication deficiency. J. Virol. 1999, 73, 5663–5670. [Google Scholar] [CrossRef] [PubMed]
- Krosky, P.M.; Baek, M.C.; Coen, D.M. The human cytomegalovirus UL97 protein kinase, an antiviral drug target, is required at the stage of nuclear egress. J. Virol. 2003, 77, 905–914. [Google Scholar] [CrossRef] [PubMed]
- Gill, R.B.; James, S.H.; Prichard, M.N. Human cytomegalovirus UL97 kinase alters the accumulation of CDK1. J. Gen. Virol. 2012, 93 Pt 8, 1743–1755. [Google Scholar] [CrossRef]
- Goldberg, M.D.; Honigman, A.; Weinstein, J.; Chou, S.; Taraboulos, A.; Rouvinski, A.; Shinder, V.; Wolf, D.G. Human cytomegalovirus UL97 kinase and nonkinase functions mediate viral cytoplasmic secondary envelopment. J. Virol. 2011, 85, 3375–3384. [Google Scholar] [CrossRef]
- Azzeh, M.; Honigman, A.; Taraboulos, A.; Rouvinski, A.; Wolf, D.G. Structural changes in human cytomegalovirus cytoplasmic assembly sites in the absence of UL97 kinase activity. Virology 2006, 354, 69–79. [Google Scholar] [CrossRef]
- Wing, B.A.; Huang, E.S. Analysis and mapping of a family of 3′-coterminal transcripts containing coding sequences for human cytomegalovirus open reading frames UL93 through UL99. J. Virol. 1995, 69, 1521–1531. [Google Scholar] [CrossRef]
- Gao, M.; Robertson, B.J.; McCann, P.J.; O’Boyle, D.R.; Weller, S.K.; Newcomb, W.W.; Brown, J.C.; Weinheimer, S.P. Functional conservations of the alkaline nuclease of herpes simplex type 1 and human cytomegalovirus. Virology 1998, 249, 460–470. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sheaffer, A.K.; Weinheimer, S.P.; Tenney, D.J. The human cytomegalovirus UL98 gene encodes the conserved herpesvirus alkaline nuclease. J. Gen. Virol. 1997, 78 Pt 11, 2953–2961. [Google Scholar] [CrossRef][Green Version]
- Adam, B.L.; Jervey, T.Y.; Kohler, C.P.; Wright, G.L., Jr.; Nelson, J.A.; Stenberg, R.M. The human cytomegalovirus UL98 gene transcription unit overlaps with the pp28 true late gene (UL99) and encodes a 58-kilodalton early protein. J. Virol. 1995, 69, 5304–5310. [Google Scholar] [CrossRef]
- Jones, T.R.; Lee, S.W. An acidic cluster of human cytomegalovirus UL99 tegument protein is required for trafficking and function. J. Virol. 2004, 78, 1488–1502. [Google Scholar] [CrossRef]
- Britt, W.J.; Jarvis, M.; Seo, J.Y.; Drummond, D.; Nelson, J. Rapid genetic engineering of human cytomegalovirus by using a lambda phage linear recombination system: Demonstration that pp28 (UL99) is essential for production of infectious virus. J. Virol. 2004, 78, 539–543. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.Y.; Heo, J.A.; Britt, W.J. Phosphorylation of tegument protein pp28 contributes to trafficking to the assembly compartment in human cytomegalovirus infection. J. Microbiol. 2020, 58, 624–631. [Google Scholar] [CrossRef] [PubMed]
- Kari, B.; Li, W.; Cooper, J.; Goertz, R.; Radeke, B. The human cytomegalovirus UL100 gene encodes the gC-II glycoproteins recognized by group 2 monoclonal antibodies. J. Gen. Virol. 1994, 75 Pt 11, 3081–3086. [Google Scholar] [CrossRef] [PubMed]
- Mach, M.; Kropff, B.; Dal Monte, P.; Britt, W. Complex formation by human cytomegalovirus glycoproteins M (gpUL100) and N (gpUL73). J. Virol. 2000, 74, 11881–11892. [Google Scholar] [CrossRef] [PubMed]
- Krzyzaniak, M.; Mach, M.; Britt, W.J. The cytoplasmic tail of glycoprotein M (gpUL100) expresses trafficking signals required for human cytomegalovirus assembly and replication. J. Virol. 2007, 81, 10316–10328. [Google Scholar] [CrossRef]
- Krzyzaniak, M.A.; Mach, M.; Britt, W.J. HCMV-encoded glycoprotein M (UL100) interacts with Rab11 effector protein FIP4. Traffic 2009, 10, 1439–1457. [Google Scholar] [CrossRef]
- Smith, J.A.; Pari, G.S. Human cytomegalovirus UL102 gene. J. Virol. 1995, 69, 1734–1740. [Google Scholar] [CrossRef]
- McMahon, T.P.; Anders, D.G. Interactions between human cytomegalovirus helicase-primase proteins. Virus Res 2002, 86, 39–52. [Google Scholar] [CrossRef]
- Ortiz, D.A.; Glassbrook, J.E.; Pellett, P.E. Protein-Protein Interactions Suggest Novel Activities of Human Cytomegalovirus Tegument Protein pUL103. J. Virol. 2016, 90, 7798–7810. [Google Scholar] [CrossRef]
- Ahlqvist, J.; Mocarski, E. Cytomegalovirus UL103 controls virion and dense body egress. J. Virol. 2011, 85, 5125–5135. [Google Scholar] [CrossRef]
- Gentry, B.G.; Bogner, E.; Drach, J.C. Targeting the terminase: An important step forward in the treatment and prophylaxis of human cytomegalovirus infections. Antivir. Res. 2019, 161, 116–124. [Google Scholar] [CrossRef]
- Dittmer, A.; Drach, J.C.; Townsend, L.B.; Fischer, A.; Bogner, E. Interaction of the putative human cytomegalovirus portal protein pUL104 with the large terminase subunit pUL56 and its inhibition by benzimidazole-D-ribonucleosides. J. Virol. 2005, 79, 14660–14667. [Google Scholar] [CrossRef] [PubMed]
- Komazin, G.; Townsend, L.B.; Drach, J.C. Role of a mutation in human cytomegalovirus gene UL104 in resistance to benzimidazole ribonucleosides. J. Virol. 2004, 78, 710–715. [Google Scholar] [CrossRef] [PubMed]
- Dittmer, A.; Bogner, E. Analysis of the quaternary structure of the putative HCMV portal protein PUL104. Biochemistry 2005, 44, 759–765. [Google Scholar] [CrossRef]
- Holzenburg, A.; Dittmer, A.; Bogner, E. Assembly of monomeric human cytomegalovirus pUL104 into portal structures. J. Gen. Virol. 2009, 90 Pt 10, 2381–2385. [Google Scholar] [CrossRef]
- Dittmer, A.; Bogner, E. Specific short hairpin RNA-mediated inhibition of viral DNA packaging of human cytomegalovirus. FEBS Lett. 2006, 580, 6132–6138. [Google Scholar] [CrossRef]
- Smith, J.A.; Jairath, S.; Crute, J.J.; Pari, G.S. Characterization of the human cytomegalovirus UL105 gene and identification of the putative helicase protein. Virology 1996, 220, 251–255. [Google Scholar] [CrossRef][Green Version]
- Pari, G.S.; Anders, D.G. Eleven loci encoding trans-acting factors are required for transient complementation of human cytomegalovirus oriLyt-dependent DNA replication. J. Virol. 1993, 67, 6979–6988. [Google Scholar] [CrossRef]
- Kotenko, S.V.; Saccani, S.; Izotova, L.S.; Mirochnitchenko, O.V.; Pestka, S. Human cytomegalovirus harbors its own unique IL-10 homolog (cmvIL-10). Proc. Natl. Acad. Sci. USA 2000, 97, 1695–1700. [Google Scholar] [CrossRef]
- Jenkins, C.; Abendroth, A.; Slobedman, B. A novel viral transcript with homology to human interleukin-10 is expressed during latent human cytomegalovirus infection. J. Virol. 2004, 78, 1440–1447. [Google Scholar] [CrossRef]
- Chang, W.L.; Baumgarth, N.; Yu, D.; Barry, P.A. Human cytomegalovirus-encoded interleukin-10 homolog inhibits maturation of dendritic cells and alters their functionality. J. Virol. 2004, 78, 8720–8731. [Google Scholar] [CrossRef] [PubMed]
- Cheung, A.K.; Gottlieb, D.J.; Plachter, B.; Pepperl-Klindworth, S.; Avdic, S.; Cunningham, A.L.; Abendroth, A.; Slobedman, B. The role of the human cytomegalovirus UL111A gene in down-regulating CD4+ T-cell recognition of latently infected cells: Implications for virus elimination during latency. Blood 2009, 114, 4128–4137. [Google Scholar] [CrossRef]
- Slobedman, B.; Barry, P.A.; Spencer, J.V.; Avdic, S.; Abendroth, A. Virus-encoded homologs of cellular interleukin-10 and their control of host immune function. J. Virol. 2009, 83, 9618–9629. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Lin, K.; Huang, X.; Xie, W.; Xiang, D.; Ding, N.; Hu, C.; Shen, X.; Xue, X.; Huang, Y. Overexpression of the human cytomegalovirus UL111A is correlated with favorable survival of patients with gastric cancer and changes T-cell infiltration and suppresses carcinogenesis. J. Cancer Res. Clin. Oncol. 2020, 146, 555–568. [Google Scholar] [CrossRef] [PubMed]
- Tu, C.C.; Arnolds, K.L.; O’Connor, C.M.; Spencer, J.V. Human Cytomegalovirus UL111A and US27 Gene Products Enhance the CXCL12/CXCR4 Signaling Axis via Distinct Mechanisms. J. Virol. 2018, 92, e01981-17. [Google Scholar] [CrossRef]
- Avdic, S.; McSharry, B.P.; Steain, M.; Poole, E.; Sinclair, J.; Abendroth, A.; Slobedman, B. Human Cytomegalovirus-Encoded Human Interleukin-10 (IL-10) Homolog Amplifies Its Immunomodulatory Potential by Upregulating Human IL-10 in Monocytes. J. Virol. 2016, 90, 3819–3827. [Google Scholar] [CrossRef]
- Li, J.; Yamamoto, T.; Ohtsubo, K.; Shirakata, M.; Hirai, K. Major product pp43 of human cytomegalovirus U(L)112-113 gene is a transcriptional coactivator with two functionally distinct domains. Virology 1999, 260, 89–97. [Google Scholar] [CrossRef][Green Version]
- Penfold, M.E.; Mocarski, E.S. Formation of cytomegalovirus DNA replication compartments defined by localization of viral proteins and DNA synthesis. Virology 1997, 239, 46–61. [Google Scholar] [CrossRef]
- Yamamoto, T.; Suzuki, S.; Radsak, K.; Hirai, K. The UL112/113 gene products of human cytomegalovirus which colocalize with viral DNA in infected cell nuclei are related to efficient viral DNA replication. Virus Res. 1998, 56, 107–114. [Google Scholar] [CrossRef]
- Ahn, J.H.; Jang, W.J.; Hayward, G.S. The human cytomegalovirus IE2 and UL112-113 proteins accumulate in viral DNA replication compartments that initiate from the periphery of promyelocytic leukemia protein-associated nuclear bodies (PODs or ND10). J. Virol. 1999, 73, 10458–10471. [Google Scholar] [CrossRef]
- Park, M.Y.; Kim, Y.E.; Seo, M.R.; Lee, J.R.; Lee, C.H.; Ahn, J.H. Interactions among four proteins encoded by the human cytomegalovirus UL112-113 region regulate their intranuclear targeting and the recruitment of UL44 to prereplication foci. J. Virol. 2006, 80, 2718–2727. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kim, Y.E.; Ahn, J.H. Role of the specific interaction of UL112-113 p84 with UL44 DNA polymerase processivity factor in promoting DNA replication of human cytomegalovirus. J. Virol. 2010, 84, 8409–8421. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.E.; Park, M.Y.; Kang, K.J.; Han, T.H.; Lee, C.H.; Ahn, J.H. Requirement of the N-terminal residues of human cytomegalovirus UL112-113 proteins for viral growth and oriLyt-dependent DNA replication. J. Microbiol. 2015, 53, 561–569. [Google Scholar] [CrossRef] [PubMed]
- Caragliano, E.; Bonazza, S.; Frascaroli, G.; Tang, J.; Soh, T.K.; Grunewald, K.; Bosse, J.B.; Brune, W. Human cytomegalovirus forms phase-separated compartments at viral genomes to facilitate viral replication. Cell Rep. 2022, 38, 110469. [Google Scholar] [CrossRef] [PubMed]
- Ranneberg-Nilsen, T.; Dale, H.A.; Luna, L.; Slettebakk, R.; Sundheim, O.; Rollag, H.; Bjoras, M. Characterization of human cytomegalovirus uracil DNA glycosylase (UL114) and its interaction with polymerase processivity factor (UL44). J. Mol. Biol. 2008, 381, 276–288. [Google Scholar] [CrossRef] [PubMed]
- Ranneberg-Nilsen, T.; Rollag, H.; Slettebakk, R.; Backe, P.H.; Olsen, O.; Luna, L.; Bjoras, M. The chromatin remodeling factor SMARCB1 forms a complex with human cytomegalovirus proteins UL114 and UL44. PLoS ONE 2012, 7, e34119. [Google Scholar] [CrossRef] [PubMed]
- Prichard, M.N.; Lawlor, H.; Duke, G.M.; Mo, C.; Wang, Z.; Dixon, M.; Kemble, G.; Kern, E.R. Human cytomegalovirus uracil DNA glycosylase associates with ppUL44 and accelerates the accumulation of viral DNA. Virol. J. 2005, 2, 55. [Google Scholar] [CrossRef]
- Courcelle, C.T.; Courcelle, J.; Prichard, M.N.; Mocarski, E.S. Requirement for uracil-DNA glycosylase during the transition to late-phase cytomegalovirus DNA replication. J. Virol. 2001, 75, 7592–7601. [Google Scholar] [CrossRef]
- Prichard, M.N.; Duke, G.M.; Mocarski, E.S. Human cytomegalovirus uracil DNA glycosylase is required for the normal temporal regulation of both DNA synthesis and viral replication. J. Virol. 1996, 70, 3018–3025. [Google Scholar] [CrossRef]
- Strang, B.L.; Coen, D.M. Interaction of the human cytomegalovirus uracil DNA glycosylase UL114 with the viral DNA polymerase catalytic subunit UL54. J. Gen. Virol. 2010, 91 Pt 8, 2029–2033. [Google Scholar] [CrossRef]
- Huber, M.T.; Compton, T. Intracellular formation and processing of the heterotrimeric gH-gL-gO (gCIII) glycoprotein envelope complex of human cytomegalovirus. J. Virol. 1999, 73, 3886–3892. [Google Scholar] [CrossRef] [PubMed]
- Calo, S.; Cortese, M.; Ciferri, C.; Bruno, L.; Gerrein, R.; Benucci, B.; Monda, G.; Gentile, M.; Kessler, T.; Uematsu, Y.; et al. The Human Cytomegalovirus UL116 Gene Encodes an Envelope Glycoprotein Forming a Complex with gH Independently from gL. J. Virol. 2016, 90, 4926–4938. [Google Scholar] [CrossRef] [PubMed]
- Vezzani, G.; Amendola, D.; Yu, D.; Chandramouli, S.; Frigimelica, E.; Maione, D.; Merola, M. The Human Cytomegalovirus UL116 Glycoprotein Is a Chaperone to Control gH-Based Complexes Levels on Virions. Front. Microbiol. 2021, 12, 630121. [Google Scholar] [CrossRef] [PubMed]
- Gatault, P.; Jones, I.K.A.; Meyer, C.; Kreklywich, C.; Alexander, T.; Smith, P.P.; Denton, M.; Powell, J.; Orloff, S.L.; Streblow, D.N. Rat and human cytomegalovirus ORF116 encodes a virion envelope glycoprotein required for infectivity. Virology 2021, 557, 23–33. [Google Scholar] [CrossRef]
- Siddiquey, M.N.A.; Schultz, E.P.; Yu, Q.; Amendola, D.; Vezzani, G.; Yu, D.; Maione, D.; Lanchy, J.M.; Ryckman, B.J.; Merola, M.; et al. The Human Cytomegalovirus Protein UL116 Interacts with the Viral Endoplasmic-Reticulum-Resident Glycoprotein UL148 and Promotes the Incorporation of gH/gL Complexes into Virions. J. Virol. 2021, 95, e0220720. [Google Scholar] [CrossRef]
- Qian, Z.; Xuan, B.; Hong, T.T.; Yu, D. The full-length protein encoded by human cytomegalovirus gene UL117 is required for the proper maturation of viral replication compartments. J. Virol. 2008, 82, 3452–3465. [Google Scholar] [CrossRef]
- Qian, Z.; Leung-Pineda, V.; Xuan, B.; Piwnica-Worms, H.; Yu, D. Human cytomegalovirus protein pUL117 targets the mini-chromosome maintenance complex and suppresses cellular DNA synthesis. PLoS Pathog. 2010, 6, e1000814. [Google Scholar] [CrossRef]
- Michelson, S. Consequences of human cytomegalovirus mimicry. Hum. Immunol. 2004, 65, 465–475. [Google Scholar] [CrossRef]
- Kolb, P.; Hoffmann, K.; Sievert, A.; Reinhard, H.; Merce-Maldonado, E.; Le-Trilling, V.T.K.; Halenius, A.; Gutle, D.; Hengel, H. Human cytomegalovirus antagonizes activation of Fcgamma receptors by distinct and synergizing modes of IgG manipulation. eLife 2021, 10, e63877. [Google Scholar] [CrossRef]
- Ndjamen, B.; Joshi, D.S.; Fraser, S.E.; Bjorkman, P.J. Characterization of Antibody Bipolar Bridging Mediated by the Human Cytomegalovirus Fc Receptor gp68. J. Virol. 2016, 90, 3262–3267. [Google Scholar] [CrossRef]
- Vezzani, G.; Pimazzoni, S.; Ferranti, R.; Calo, S.; Monda, G.; Amendola, D.; Frigimelica, E.; Maione, D.; Cortese, M.; Merola, M. Human immunoglobulins are transported to HCMV viral envelope by viral Fc gamma receptors-dependent and independent mechanisms. Front. Microbiol. 2022, 13, 1106401. [Google Scholar] [CrossRef] [PubMed]
- Murphy, E.A.; Streblow, D.N.; Nelson, J.A.; Stinski, M.F. The human cytomegalovirus IE86 protein can block cell cycle progression after inducing transition into the S phase of permissive cells. J. Virol. 2000, 74, 7108–7118. [Google Scholar] [CrossRef]
- Yoo, Y.D.; Chiou, C.J.; Choi, K.S.; Yi, Y.; Michelson, S.; Kim, S.; Hayward, G.S.; Kim, S.J. The IE2 regulatory protein of human cytomegalovirus induces expression of the human transforming growth factor beta1 gene through an Egr-1 binding site. J. Virol. 1996, 70, 7062–7070. [Google Scholar] [CrossRef] [PubMed]
- Dickinson, L.A.; Trauger, J.W.; Baird, E.E.; Ghazal, P.; Dervan, P.B.; Gottesfeld, J.M. Anti-repression of RNA polymerase II transcription by pyrrole-imidazole polyamides. Biochemistry 1999, 38, 10801–10807. [Google Scholar] [CrossRef]
- Marchini, A.; Liu, H.; Zhu, H. Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J. Virol. 2001, 75, 1870–1878. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.H.; Chang, M.D.; Tai, K.Y.; Yang, Y.T.; Wang, P.S.; Chen, C.J.; Wang, Y.H.; Lee, S.C.; Wu, C.W.; Juan, L.J. HCMV IE2-mediated inhibition of HAT activity downregulates p53 function. EMBO J. 2004, 23, 2269–2280. [Google Scholar] [CrossRef]
- Lang, D.; Gebert, S.; Arlt, H.; Stamminger, T. Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB. J. Virol. 1995, 69, 6030–6037. [Google Scholar] [CrossRef]
- Kim, E.T.; Kim, Y.E.; Huh, Y.H.; Ahn, J.H. Role of noncovalent SUMO binding by the human cytomegalovirus IE2 transactivator in lytic growth. J. Virol. 2010, 84, 8111–8123. [Google Scholar] [CrossRef]
- Yang, Y.; Ren, G.; Wang, Z.; Wang, B. Human cytomegalovirus IE2 protein regulates macrophage-mediated immune escape by upregulating GRB2 expression in UL122 genetically modified mice. Biosci. Trends 2020, 13, 502–509. [Google Scholar] [CrossRef]
- Zalckvar, E.; Paulus, C.; Tillo, D.; Asbach-Nitzsche, A.; Lubling, Y.; Winterling, C.; Strieder, N.; Mucke, K.; Goodrum, F.; Segal, E.; et al. Nucleosome maps of the human cytomegalovirus genome reveal a temporal switch in chromatin organization linked to a major IE protein. Proc. Natl. Acad. Sci. USA 2013, 110, 13126–13131. [Google Scholar] [CrossRef]
- Mucke, K.; Paulus, C.; Bernhardt, K.; Gerrer, K.; Schon, K.; Fink, A.; Sauer, E.M.; Asbach-Nitzsche, A.; Harwardt, T.; Kieninger, B.; et al. Human cytomegalovirus major immediate early 1 protein targets host chromosomes by docking to the acidic pocket on the nucleosome surface. J. Virol. 2014, 88, 1228–1248. [Google Scholar] [CrossRef]
- Nevels, M.; Paulus, C.; Shenk, T. Human cytomegalovirus immediate-early 1 protein facilitates viral replication by antagonizing histone deacetylation. Proc. Natl. Acad. Sci. USA 2004, 101, 17234–17239. [Google Scholar] [CrossRef] [PubMed]
- Paulus, C.; Krauss, S.; Nevels, M. A human cytomegalovirus antagonist of type I IFN-dependent signal transducer and activator of transcription signaling. Proc. Natl. Acad. Sci. USA 2006, 103, 3840–3845. [Google Scholar] [CrossRef]
- Reitsma, J.M.; Sato, H.; Nevels, M.; Terhune, S.S.; Paulus, C. Human cytomegalovirus IE1 protein disrupts interleukin-6 signaling by sequestering STAT3 in the nucleus. J. Virol. 2013, 87, 10763–10776. [Google Scholar] [CrossRef] [PubMed]
- Knoblach, T.; Grandel, B.; Seiler, J.; Nevels, M.; Paulus, C. Human cytomegalovirus IE1 protein elicits a type II interferon-like host cell response that depends on activated STAT1 but not interferon-gamma. PLoS Pathog. 2011, 7, e1002016. [Google Scholar] [CrossRef] [PubMed]
- Scherer, M.; Schilling, E.M.; Stamminger, T. The Human CMV IE1 Protein: An Offender of PML Nuclear Bodies. In Advances in Anatomy, Embryology and Cell Biology; Springer: Berlin/Heidelberg, Germany, 2017; Volume 223, pp. 77–94. [Google Scholar]
- Lundquist, C.A.; Meier, J.L.; Stinski, M.F. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 1999, 73, 9039–9052. [Google Scholar] [CrossRef] [PubMed]
- Angulo, A.; Kerry, D.; Huang, H.; Borst, E.M.; Razinsky, A.; Wu, J.; Hobom, U.; Messerle, M.; Ghazal, P. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J. Virol. 2000, 74, 2826–2839. [Google Scholar] [CrossRef][Green Version]
- Lashmit, P.E.; Lundquist, C.A.; Meier, J.L.; Stinski, M.F. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 2004, 78, 5113–5123. [Google Scholar] [CrossRef][Green Version]
- Lee, J.; Klase, Z.; Gao, X.; Caldwell, J.S.; Stinski, M.F.; Kashanchi, F.; Chao, S.H. Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes. Virology 2007, 366, 117–125. [Google Scholar] [CrossRef][Green Version]
- Akter, P.; Cunningham, C.; McSharry, B.P.; Dolan, A.; Addison, C.; Dargan, D.J.; Hassan-Walker, A.F.; Emery, V.C.; Griffiths, P.D.; Wilkinson, G.W.G.; et al. Two novel spliced genes in human cytomegalovirus. J. Gen. Virol. 2003, 84 Pt 5, 1117–1122. [Google Scholar] [CrossRef]
- Zheng, Q.; Tao, R.; Gao, H.; Xu, J.; Shang, S.; Zhao, N. HCMV-encoded UL128 enhances TNF-alpha and IL-6 expression and promotes PBMC proliferation through the MAPK/ERK pathway in vitro. Viral Immunol. 2012, 25, 98–105. [Google Scholar] [CrossRef]
- Gao, H.; Tao, R.; Zheng, Q.; Xu, J.; Shang, S. Recombinant HCMV UL128 expression and functional identification of PBMC-attracting activity in vitro. Arch. Virol. 2013, 158, 173–177. [Google Scholar] [CrossRef]
- Kempova, V.; Lenhartova, S.; Benko, M.; Nemcovic, M.; Kudelova, M.; Nemcovicova, I. The power of human cytomegalovirus (HCMV) hijacked UL/b’ functions lost in vitro. Acta Virol. 2020, 64, 117–130. [Google Scholar] [CrossRef] [PubMed]
- Straschewski, S.; Patrone, M.; Walther, P.; Gallina, A.; Mertens, T.; Frascaroli, G. Protein pUL128 of human cytomegalovirus is necessary for monocyte infection and blocking of migration. J. Virol. 2011, 85, 5150–5158. [Google Scholar] [CrossRef] [PubMed]
- Ryckman, B.J.; Rainish, B.L.; Chase, M.C.; Borton, J.A.; Nelson, J.A.; Jarvis, M.A.; Johnson, D.C. Characterization of the human cytomegalovirus gH/gL/UL128-131 complex that mediates entry into epithelial and endothelial cells. J. Virol. 2008, 82, 60–70. [Google Scholar] [CrossRef]
- Nogalski, M.T.; Chan, G.C.; Stevenson, E.V.; Collins-McMillen, D.K.; Yurochko, A.D. The HCMV gH/gL/UL128-131 complex triggers the specific cellular activation required for efficient viral internalization into target monocytes. PLoS Pathog. 2013, 9, e1003463. [Google Scholar] [CrossRef] [PubMed]
- Hahn, G.; Revello, M.G.; Patrone, M.; Percivalle, E.; Campanini, G.; Sarasini, A.; Wagner, M.; Gallina, A.; Milanesi, G.; Koszinowski, U.; et al. Human cytomegalovirus UL131-128 genes are indispensable for virus growth in endothelial cells and virus transfer to leukocytes. J. Virol. 2004, 78, 10023–10033. [Google Scholar] [CrossRef]
- Wang, G.; Ren, G.; Cui, X.; Lu, Z.; Ma, Y.; Qi, Y.; Huang, Y.; Liu, Z.; Sun, Z.; Ruan, Q. Host protein Snapin interacts with human cytomegalovirus pUL130 and affects viral DNA replication. J. Biosci. 2016, 41, 173–182. [Google Scholar] [CrossRef]
- Patrone, M.; Secchi, M.; Fiorina, L.; Ierardi, M.; Milanesi, G.; Gallina, A. Human cytomegalovirus UL130 protein promotes endothelial cell infection through a producer cell modification of the virion. J. Virol. 2005, 79, 8361–8373. [Google Scholar] [CrossRef]
- Schuessler, A.; Sampaio, K.L.; Scrivano, L.; Sinzger, C. Mutational mapping of UL130 of human cytomegalovirus defines peptide motifs within the C-terminal third as essential for endothelial cell infection. J. Virol. 2010, 84, 9019–9026. [Google Scholar] [CrossRef][Green Version]
- Schuessler, A.; Sampaio, K.L.; Straschewski, S.; Sinzger, C. Mutational mapping of pUL131A of human cytomegalovirus emphasizes its central role for endothelial cell tropism. J. Virol. 2012, 86, 504–512. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Adler, B.; Scrivano, L.; Ruzcics, Z.; Rupp, B.; Sinzger, C.; Koszinowski, U. Role of human cytomegalovirus UL131A in cell type-specific virus entry and release. J. Gen. Virol. 2006, 87 Pt 9, 2451–2460. [Google Scholar] [CrossRef]
- Wu, H.; Kropff, B.; Mach, M.; Britt, W.J. Human Cytomegalovirus Envelope Protein gpUL132 Regulates Infectious Virus Production through Formation of the Viral Assembly Compartment. mBio 2020, 11, e02044-20. [Google Scholar] [CrossRef] [PubMed]
- Spaderna, S.; Kropff, B.; Kodel, Y.; Shen, S.; Coley, S.; Lu, S.; Britt, W.; Mach, M. Deletion of gpUL132, a structural component of human cytomegalovirus, results in impaired virus replication in fibroblasts. J. Virol. 2005, 79, 11837–11847. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Nguyen, C.C.; Siddiquey, M.N.A.; Zhang, H.; Li, G.; Kamil, J.P. Human Cytomegalovirus Tropism Modulator UL148 Interacts with SEL1L, a Cellular Factor That Governs Endoplasmic Reticulum-Associated Degradation of the Viral Envelope Glycoprotein gO. J. Virol. 2018, 92, e00688-18. [Google Scholar] [CrossRef]
- Siddiquey, M.N.A.; Zhang, H.; Nguyen, C.C.; Domma, A.J.; Kamil, J.P. The Human Cytomegalovirus Endoplasmic Reticulum-Resident Glycoprotein UL148 Activates the Unfolded Protein Response. J. Virol. 2018, 92, e00896-18. [Google Scholar] [CrossRef]
- Wang, E.C.Y.; Pjechova, M.; Nightingale, K.; Vlahava, V.M.; Patel, M.; Ruckova, E.; Forbes, S.K.; Nobre, L.; Antrobus, R.; Roberts, D.; et al. Suppression of costimulation by human cytomegalovirus promotes evasion of cellular immune defenses. Proc. Natl. Acad. Sci. USA 2018, 115, 4998–5003. [Google Scholar] [CrossRef]
- Nguyen, C.C.; Domma, A.J.; Zhang, H.; Kamil, J.P. Endoplasmic Reticulum (ER) Reorganization and Intracellular Retention of CD58 Are Functionally Independent Properties of the Human Cytomegalovirus ER-Resident Glycoprotein UL148. J. Virol. 2020, 94, e01435-19. [Google Scholar] [CrossRef]
- Zhang, H.; Read, C.; Nguyen, C.C.; Siddiquey, M.N.A.; Shang, C.; Hall, C.M.; von Einem, J.; Kamil, J.P. The Human Cytomegalovirus Nonstructural Glycoprotein UL148 Reorganizes the Endoplasmic Reticulum. mBio 2019, 10, e02110-19. [Google Scholar] [CrossRef]
- Li, G.; Nguyen, C.C.; Ryckman, B.J.; Britt, W.J.; Kamil, J.P. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism. Proc. Natl. Acad. Sci. USA 2015, 112, 4471–4476. [Google Scholar] [CrossRef]
- Seidel, E.; Dassa, L.; Schuler, C.; Oiknine-Djian, E.; Wolf, D.G.; Le-Trilling, V.T.K.; Mandelboim, O. The human cytomegalovirus protein UL147A downregulates the most prevalent MICA allele: MICA*008, to evade NK cell-mediated killing. PLoS Pathog. 2021, 17, e1008807. [Google Scholar] [CrossRef]
- Lurain, N.S.; Fox, A.M.; Lichy, H.M.; Bhorade, S.M.; Ware, C.F.; Huang, D.D.; Kwan, S.P.; Garrity, E.R.; Chou, S. Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts. Virol. J. 2006, 3, 4. [Google Scholar] [CrossRef] [PubMed]
- Heo, J.; Petheram, S.; Demmler, G.; Murph, J.R.; Adler, S.P.; Bale, J.; Sparer, T.E. Polymorphisms within human cytomegalovirus chemokine (UL146/UL147) and cytokine receptor genes (UL144) are not predictive of sequelae in congenitally infected children. Virology 2008, 378, 86–96. [Google Scholar] [CrossRef] [PubMed]
- Luttichau, H.R. The cytomegalovirus UL146 gene product vCXCL1 targets both CXCR1 and CXCR2 as an agonist. J. Biol. Chem. 2010, 285, 9137–9146. [Google Scholar] [CrossRef] [PubMed]
- Penfold, M.E.; Dairaghi, D.J.; Duke, G.M.; Saederup, N.; Mocarski, E.S.; Kemble, G.W.; Schall, T.J. Cytomegalovirus encodes a potent alpha chemokine. Proc. Natl. Acad. Sci. USA 1999, 96, 9839–9844. [Google Scholar] [CrossRef] [PubMed]
- He, R.; Ruan, Q.; Qi, Y.; Ma, Y.P.; Huang, Y.J.; Sun, Z.R.; Ji, Y.H. Sequence variability of human cytomegalovirus UL146 and UL147 genes in low-passage clinical isolates. Intervirology 2006, 49, 215–223. [Google Scholar] [CrossRef] [PubMed]
- Le-Trilling, V.T.K.; Becker, T.; Nachshon, A.; Stern-Ginossar, N.; Scholer, L.; Voigt, S.; Hengel, H.; Trilling, M. The Human Cytomegalovirus pUL145 Isoforms Act as Viral DDB1-Cullin-Associated Factors to Instruct Host Protein Degradation to Impede Innate Immunity. Cell Rep. 2020, 30, 2248–2260.e2245. [Google Scholar] [CrossRef]
- Benedict, C.A.; Butrovich, K.D.; Lurain, N.S.; Corbeil, J.; Rooney, I.; Schneider, P.; Tschopp, J.; Ware, C.F. Cutting edge: A novel viral TNF receptor superfamily member in virulent strains of human cytomegalovirus. J. Immunol. 1999, 162, 6967–6970. [Google Scholar] [CrossRef]
- Poole, E.; Atkins, E.; Nakayama, T.; Yoshie, O.; Groves, I.; Alcami, A.; Sinclair, J. NF-kappaB-mediated activation of the chemokine CCL22 by the product of the human cytomegalovirus gene UL144 escapes regulation by viral IE86. J. Virol. 2008, 82, 4250–4256. [Google Scholar] [CrossRef]
- Poole, E.; King, C.A.; Sinclair, J.H.; Alcami, A. The UL144 gene product of human cytomegalovirus activates NFkappaB via a TRAF6-dependent mechanism. EMBO J. 2006, 25, 4390–4399. [Google Scholar] [CrossRef]
- Bitra, A.; Nemcovicova, I.; Picarda, G.; Doukov, T.; Wang, J.; Benedict, C.A.; Zajonc, D.M. Structure of human cytomegalovirus UL144, an HVEM orthologue, bound to the B and T cell lymphocyte attenuator. J. Biol. Chem. 2019, 294, 10519–10529. [Google Scholar] [CrossRef] [PubMed]
- Wills, M.R.; Ashiru, O.; Reeves, M.B.; Okecha, G.; Trowsdale, J.; Tomasec, P.; Wilkinson, G.W.; Sinclair, J.; Sissons, J.G. Human cytomegalovirus encodes an MHC class I-like molecule (UL142) that functions to inhibit NK cell lysis. J. Immunol. 2005, 175, 7457–7465. [Google Scholar] [CrossRef]
- Chalupny, N.J.; Rein-Weston, A.; Dosch, S.; Cosman, D. Down-regulation of the NKG2D ligand MICA by the human cytomegalovirus glycoprotein UL142. Biochem. Biophys. Res. Commun. 2006, 346, 175–181. [Google Scholar] [CrossRef] [PubMed]
- Ashiru, O.; Bennett, N.J.; Boyle, L.H.; Thomas, M.; Trowsdale, J.; Wills, M.R. NKG2D ligand MICA is retained in the cis-Golgi apparatus by human cytomegalovirus protein UL142. J. Virol. 2009, 83, 12345–12354. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Qi, Y.; Ma, Y.; He, R.; Sun, Z.; Huang, Y.; Ji, Y.; Ruan, Q. Interaction between the human cytomegalovirusencoded UL142 and cellular Snapin proteins. Mol. Med. Rep. 2015, 11, 1069–1072. [Google Scholar] [CrossRef]
- Bennett, N.J.; Ashiru, O.; Morgan, F.J.; Pang, Y.; Okecha, G.; Eagle, R.A.; Trowsdale, J.; Sissons, J.G.; Wills, M.R. Intracellular sequestration of the NKG2D ligand ULBP3 by human cytomegalovirus. J. Immunol. 2010, 185, 1093–1102. [Google Scholar] [CrossRef]
- Smith, W.; Tomasec, P.; Aicheler, R.; Loewendorf, A.; Nemcovicova, I.; Wang, E.C.; Stanton, R.J.; Macauley, M.; Norris, P.; Willen, L.; et al. Human cytomegalovirus glycoprotein UL141 targets the TRAIL death receptors to thwart host innate antiviral defenses. Cell Host Microbe 2013, 13, 324–335. [Google Scholar] [CrossRef]
- Nemcovicova, I.; Benedict, C.A.; Zajonc, D.M. Structure of human cytomegalovirus UL141 binding to TRAIL-R2 reveals novel, non-canonical death receptor interactions. PLoS Pathog. 2013, 9, e1003224. [Google Scholar] [CrossRef]
- Tomasec, P.; Wang, E.C.; Davison, A.J.; Vojtesek, B.; Armstrong, M.; Griffin, C.; McSharry, B.P.; Morris, R.J.; Llewellyn-Lacey, S.; Rickards, C.; et al. Downregulation of natural killer cell-activating ligand CD155 by human cytomegalovirus UL141. Nat. Immunol. 2005, 6, 181–188. [Google Scholar] [CrossRef]
- Prod’homme, V.; Sugrue, D.M.; Stanton, R.J.; Nomoto, A.; Davies, J.; Rickards, C.R.; Cochrane, D.; Moore, M.; Wilkinson, G.W.G.; Tomasec, P. Human cytomegalovirus UL141 promotes efficient downregulation of the natural killer cell activating ligand CD112. J. Gen. Virol. 2010, 91 Pt 8, 2034–2039. [Google Scholar] [CrossRef]
- Hsu, J.L.; van den Boomen, D.J.; Tomasec, P.; Weekes, M.P.; Antrobus, R.; Stanton, R.J.; Ruckova, E.; Sugrue, D.; Wilkie, G.S.; Davison, A.J.; et al. Plasma membrane profiling defines an expanded class of cell surface proteins selectively targeted for degradation by HCMV US2 in cooperation with UL141. PLoS Pathog. 2015, 11, e1004811. [Google Scholar] [CrossRef] [PubMed]
- Zou, F.; Lu, Z.T.; Wang, S.; Wu, S.; Wu, Y.Y.; Sun, Z.R. Human cytomegalovirus UL141 protein interacts with CELF5 and affects viral DNA replication. Mol. Med. Rep. 2018, 17, 4657–4664. [Google Scholar] [CrossRef] [PubMed]
- Qi, Y.; Mao, Z.Q.; Ruan, Q.; He, R.; Ma, Y.P.; Sun, Z.R.; Ji, Y.H.; Huang, Y. Human cytomegalovirus (HCMV) UL139 open reading frame: Sequence variants are clustered into three major genotypes. J. Med. Virol. 2006, 78, 517–522. [Google Scholar] [CrossRef] [PubMed]
- Mancebo, F.J.; Parras-Molto, M.; Garcia-Rios, E.; Perez-Romero, P. Deciphering the Potential Coding of Human Cytomegalovirus: New Predicted Transmembrane Proteome. Int. J. Mol. Sci. 2022, 23, 2768. [Google Scholar] [CrossRef]
- Le, V.T.; Trilling, M.; Hengel, H. The cytomegaloviral protein pUL138 acts as potentiator of tumor necrosis factor (TNF) receptor 1 surface density to enhance ULb’-encoded modulation of TNF-alpha signaling. J. Virol. 2011, 85, 13260–13270. [Google Scholar] [CrossRef]
- Montag, C.; Wagner, J.A.; Gruska, I.; Vetter, B.; Wiebusch, L.; Hagemeier, C. The latency-associated UL138 gene product of human cytomegalovirus sensitizes cells to tumor necrosis factor alpha (TNF-alpha) signaling by upregulating TNF-alpha receptor 1 cell surface expression. J. Virol. 2011, 85, 11409–11421. [Google Scholar] [CrossRef]
- Goodrum, F.; Reeves, M.; Sinclair, J.; High, K.; Shenk, T. Human cytomegalovirus sequences expressed in latently infected individuals promote a latent infection in vitro. Blood 2007, 110, 937–945. [Google Scholar] [CrossRef]
- Petrucelli, A.; Umashankar, M.; Zagallo, P.; Rak, M.; Goodrum, F. Interactions between proteins encoded within the human cytomegalovirus UL133-UL138 locus. J. Virol. 2012, 86, 8653–8662. [Google Scholar] [CrossRef]
- Lee, S.H.; Caviness, K.; Albright, E.R.; Lee, J.H.; Gelbmann, C.B.; Rak, M.; Goodrum, F.; Kalejta, R.F. Long and Short Isoforms of the Human Cytomegalovirus UL138 Protein Silence IE Transcription and Promote Latency. J. Virol. 2016, 90, 9483–9494. [Google Scholar] [CrossRef]
- Petrucelli, A.; Rak, M.; Grainger, L.; Goodrum, F. Characterization of a novel Golgi apparatus-localized latency determinant encoded by human cytomegalovirus. J. Virol. 2009, 83, 5615–5629. [Google Scholar] [CrossRef]
- Chen, W.; Lin, K.; Zhang, L.; Guo, G.; Sun, X.; Chen, J.; Ye, L.; Ye, S.; Mao, C.; Xu, J.; et al. The cytomegalovirus protein UL138 induces apoptosis of gastric cancer cells by binding to heat shock protein 70. Oncotarget 2016, 7, 5630–5645. [Google Scholar] [CrossRef] [PubMed]
- Han, L.; Ma, Y.; Liu, Z.; Liu, C.; Lu, Y.; Qi, Y.; Huang, Y.; Sun, Z.; Ruan, Q. Transcriptional regulation and influence on replication of the human cytomegalovirus UL138 1.4 kb transcript. Mol. Med. Rep. 2017, 16, 5649–5658. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Buehler, J.; Carpenter, E.; Zeltzer, S.; Igarashi, S.; Rak, M.; Mikell, I.; Nelson, J.A.; Goodrum, F. Host signaling and EGR1 transcriptional control of human cytomegalovirus replication and latency. PLoS Pathog. 2019, 15, e1008037. [Google Scholar] [CrossRef]
- Mlera, L.; Moy, M.; Maness, K.; Tran, L.N.; Goodrum, F.D. The Role of the Human Cytomegalovirus UL133-UL138 Gene Locus in Latency and Reactivation. Viruses 2020, 12, 714. [Google Scholar] [CrossRef] [PubMed]
- Albright, E.R.; Mickelson, C.K.; Kalejta, R.F. Human Cytomegalovirus UL138 Protein Inhibits the STING Pathway and Reduces Interferon Beta mRNA Accumulation during Lytic and Latent Infections. mBio 2021, 12, e0226721. [Google Scholar] [CrossRef]
- Zarrella, K.; Longmire, P.; Zeltzer, S.; Collins-McMillen, D.; Hancock, M.; Buehler, J.; Reitsma, J.M.; Terhune, S.S.; Nelson, J.A.; Goodrum, F. Human Cytomegalovirus UL138 Interaction with USP1 Activates STAT1 in infection. bioRxiv 2023. preprint. [Google Scholar] [CrossRef]
- Caviness, K.; Bughio, F.; Crawford, L.B.; Streblow, D.N.; Nelson, J.A.; Caposio, P.; Goodrum, F. Complex Interplay of the UL136 Isoforms Balances Cytomegalovirus Replication and Latency. mBio 2016, 7, e01986. [Google Scholar] [CrossRef]
- Caviness, K.; Cicchini, L.; Rak, M.; Umashankar, M.; Goodrum, F. Complex expression of the UL136 gene of human cytomegalovirus results in multiple protein isoforms with unique roles in replication. J. Virol. 2014, 88, 14412–14425. [Google Scholar] [CrossRef]
- Cui, X.; Sun, Z.R.; Ren, G.W.; Wang, G.L.; Qi, Y.; Ma, Y.P.; Ruan, Q. Interaction between human cytomegalovirus UL136 protein and ATP1B1 protein. Braz. J. Med. Biol. Res. Rev. Bras. Pesqui. Medicas Biol. 2011, 44, 1251–1255. [Google Scholar] [CrossRef][Green Version]
- Bughio, F.; Elliott, D.A.; Goodrum, F. An endothelial cell-specific requirement for the UL133-UL138 locus of human cytomegalovirus for efficient virus maturation. J. Virol. 2013, 87, 3062–3075. [Google Scholar] [CrossRef]
- Liao, H.; Lee, J.H.; Kondo, R.; Katata, M.; Imadome, K.; Miyado, K.; Inoue, N.; Fujiwara, S.; Nakamura, H. The highly conserved human cytomegalovirus UL136 ORF generates multiple Golgi-localizing protein isoforms through differential translation initiation. Virus Res. 2014, 179, 241–246. [Google Scholar] [CrossRef] [PubMed]
- Bughio, F.; Umashankar, M.; Wilson, J.; Goodrum, F. Human Cytomegalovirus UL135 and UL136 Genes Are Required for Postentry Tropism in Endothelial Cells. J. Virol. 2015, 89, 6536–6550. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Shi, L.; Fan, B.; Chen, D.; Guo, C.; Xiang, H.; Nie, Y.; Zhong, D.; Shi, X. Human cytomegalovirus protein UL136 activates the IL-6/STAT3 signal through MiR-138 and MiR-34c in gastric cancer cells. Int. J. Clin. Oncol. 2020, 25, 1936–1944. [Google Scholar] [CrossRef]
- Stanton, R.J.; Prod’homme, V.; Purbhoo, M.A.; Moore, M.; Aicheler, R.J.; Heinzmann, M.; Bailer, S.M.; Haas, J.; Antrobus, R.; Weekes, M.P.; et al. HCMV pUL135 remodels the actin cytoskeleton to impair immune recognition of infected cells. Cell Host Microbe 2014, 16, 201–214. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Rak, M.; Nguyen, C.C.; Umashankar, M.; Goodrum, F.D.; Kamil, J.P. An epistatic relationship between the viral protein kinase UL97 and the UL133-UL138 latency locus during the human cytomegalovirus lytic cycle. J. Virol. 2014, 88, 6047–6060. [Google Scholar] [CrossRef] [PubMed]
- Rak, M.A.; Buehler, J.; Zeltzer, S.; Reitsma, J.; Molina, B.; Terhune, S.; Goodrum, F. Human Cytomegalovirus UL135 Interacts with Host Adaptor Proteins to Regulate Epidermal Growth Factor Receptor and Reactivation from Latency. J. Virol. 2018, 92, e00919-18. [Google Scholar] [CrossRef]
- Moy, M.A.; Collins-McMillen, D.; Crawford, L.; Parkins, C.; Zeltzer, S.; Caviness, K.; Caposio, P.; Goodrum, F. UL135 and UL136 Epistasis Controls Reactivation of Human Cytomegalovirus. bioRxiv 2023. preprint. [Google Scholar]
- Umashankar, M.; Petrucelli, A.; Cicchini, L.; Caposio, P.; Kreklywich, C.N.; Rak, M.; Bughio, F.; Goldman, D.C.; Hamlin, K.L.; Nelson, J.A.; et al. A novel human cytomegalovirus locus modulates cell type-specific outcomes of infection. PLoS Pathog. 2011, 7, e1002444. [Google Scholar] [CrossRef]
- Dutta, N.; Lashmit, P.; Yuan, J.; Meier, J.; Stinski, M.F. The human cytomegalovirus UL133-138 gene locus attenuates the lytic viral cycle in fibroblasts. PLoS ONE 2015, 10, e0120946. [Google Scholar] [CrossRef]
- Dassa, L.; Seidel, E.; Oiknine-Djian, E.; Yamin, R.; Wolf, D.G.; Le-Trilling, V.T.K.; Mandelboim, O. The Human Cytomegalovirus Protein UL148A Downregulates the NK Cell-Activating Ligand MICA To Avoid NK Cell Attack. J. Virol. 2018, 92, e00162-18. [Google Scholar] [CrossRef]
- Stasiak, P.C.; Mocarski, E.S. Transactivation of the cytomegalovirus ICP36 gene promoter requires the alpha gene product TRS1 in addition to IE1 and IE2. J. Virol. 1992, 66, 1050–1058. [Google Scholar] [CrossRef] [PubMed]
- Child, S.J.; Hakki, M.; De Niro, K.L.; Geballe, A.P. Evasion of cellular antiviral responses by human cytomegalovirus TRS1 and IRS1. J. Virol. 2004, 78, 197–205. [Google Scholar] [CrossRef] [PubMed]
- Marshall, E.E.; Bierle, C.J.; Brune, W.; Geballe, A.P. Essential role for either TRS1 or IRS1 in human cytomegalovirus replication. J. Virol. 2009, 83, 4112–4120. [Google Scholar] [CrossRef] [PubMed]
- Ziehr, B.; Vincent, H.A.; Moorman, N.J. Human Cytomegalovirus pTRS1 and pIRS1 Antagonize Protein Kinase R to Facilitate Virus Replication. J. Virol. 2016, 90, 3839–3848. [Google Scholar] [CrossRef] [PubMed]
- Strang, B.L.; Geballe, A.P.; Coen, D.M. Association of human cytomegalovirus proteins IRS1 and TRS1 with the viral DNA polymerase accessory subunit UL44. J. Gen. Virol. 2010, 91 Pt 9, 2167–2175. [Google Scholar] [CrossRef] [PubMed]
- Domma, A.J.; Goodrum, F.D.; Moorman, N.J.; Kamil, J.P. Human cytomegalovirus attenuates AKT activity by destabilizing insulin receptor substrate proteins. bioRxiv 2023. preprint. [Google Scholar]
- Tomazin, R.; Boname, J.; Hegde, N.R.; Lewinsohn, D.M.; Altschuler, Y.; Jones, T.R.; Cresswell, P.; Nelson, J.A.; Riddell, S.R.; Johnson, D.C. Cytomegalovirus US2 destroys two components of the MHC class II pathway, preventing recognition by CD4+ T cells. Nat. Med. 1999, 5, 1039–1043. [Google Scholar] [CrossRef]
- Hesse, J.; Ameres, S.; Besold, K.; Krauter, S.; Moosmann, A.; Plachter, B. Suppression of CD8+ T-cell recognition in the immediate-early phase of human cytomegalovirus infection. J. Gen. Virol. 2013, 94 Pt 2, 376–386. [Google Scholar] [CrossRef]
- Oresic, K.; Noriega, V.; Andrews, L.; Tortorella, D. A structural determinant of human cytomegalovirus US2 dictates the down-regulation of class I major histocompatibility molecules. J. Biol. Chem. 2006, 281, 19395–19406. [Google Scholar] [CrossRef]
- Oresic, K.; Tortorella, D. Endoplasmic reticulum chaperones participate in human cytomegalovirus US2-mediated degradation of class I major histocompatibility complex molecules. J. Gen. Virol. 2008, 89, 1122–1130. [Google Scholar] [CrossRef]
- Jones, T.R.; Sun, L. Human cytomegalovirus US2 destabilizes major histocompatibility complex class I heavy chains. J. Virol. 1997, 71, 2970–2979. [Google Scholar] [CrossRef]
- Han, J.; Rho, S.B.; Lee, J.Y.; Bae, J.; Park, S.H.; Lee, S.J.; Lee, S.Y.; Ahn, C.; Kim, J.Y.; Chun, T. Human cytomegalovirus (HCMV) US2 protein interacts with human CD1d (hCD1d) and down-regulates invariant NKT (iNKT) cell activity. Mol. Cells 2013, 36, 455–464. [Google Scholar] [CrossRef]
- Johnson, D.C.; Hegde, N.R. Inhibition of the MHC class II antigen presentation pathway by human cytomegalovirus. Curr. Top. Microbiol. Immunol. 2002, 269, 101–115. [Google Scholar]
- Jones, T.R.; Wiertz, E.J.; Sun, L.; Fish, K.N.; Nelson, J.A.; Ploegh, H.L. Human cytomegalovirus US3 impairs transport and maturation of major histocompatibility complex class I heavy chains. Proc. Natl. Acad. Sci. USA 1996, 93, 11327–11333. [Google Scholar] [CrossRef] [PubMed]
- Misaghi, S.; Sun, Z.Y.; Stern, P.; Gaudet, R.; Wagner, G.; Ploegh, H. Structural and functional analysis of human cytomegalovirus US3 protein. J. Virol. 2004, 78, 413–423. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Noriega, V.M.; Hesse, J.; Gardner, T.J.; Besold, K.; Plachter, B.; Tortorella, D. Human cytomegalovirus US3 modulates destruction of MHC class I molecules. Mol. Immunol. 2012, 51, 245–253. [Google Scholar] [CrossRef]
- Liu, Z.; Winkler, M.; Biegalke, B. Human cytomegalovirus: Host immune modulation by the viral US3 gene. Int. J. Biochem. Cell Biol. 2009, 41, 503–506. [Google Scholar] [CrossRef] [PubMed]
- Jun, Y.; Kim, E.; Jin, M.; Sung, H.C.; Han, H.; Geraghty, D.E.; Ahn, K. Human cytomegalovirus gene products US3 and US6 down-regulate trophoblast class I MHC molecules. J. Immunol. 2000, 164, 805–811. [Google Scholar] [CrossRef] [PubMed]
- Hegde, N.R.; Tomazin, R.A.; Wisner, T.W.; Dunn, C.; Boname, J.M.; Lewinsohn, D.M.; Johnson, D.C. Inhibition of HLA-DR assembly, transport, and loading by human cytomegalovirus glycoprotein US3: A novel mechanism for evading major histocompatibility complex class II antigen presentation. J. Virol. 2002, 76, 10929–10941. [Google Scholar] [CrossRef] [PubMed]
- Ahn, K.; Gruhler, A.; Galocha, B.; Jones, T.R.; Wiertz, E.J.; Ploegh, H.L.; Peterson, P.A.; Yang, Y.; Fruh, K. The ER-luminal domain of the HCMV glycoprotein US6 inhibits peptide translocation by TAP. Immunity 1997, 6, 613–621. [Google Scholar] [CrossRef]
- Hewitt, E.W.; Gupta, S.S.; Lehner, P.J. The human cytomegalovirus gene product US6 inhibits ATP binding by TAP. EMBO J. 2001, 20, 387–396. [Google Scholar] [CrossRef] [PubMed]
- Dugan, G.E.; Hewitt, E.W. Structural and Functional Dissection of the Human Cytomegalovirus Immune Evasion Protein US6. J. Virol. 2008, 82, 3271–3282. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Tirabassi, R.; Hook, L.; Landais, I.; Grey, F.; Meyers, H.; Hewitt, H.; Nelson, J. Human cytomegalovirus US7 is regulated synergistically by two virally encoded microRNAs and by two distinct mechanisms. J. Virol. 2011, 85, 11938–11944. [Google Scholar] [CrossRef] [PubMed]
- Park, A.; Ra, E.A.; Lee, T.A.; Choi, H.J.; Lee, E.; Kang, S.; Seo, J.Y.; Lee, S.; Park, B. HCMV-encoded US7 and US8 act as antagonists of innate immunity by distinctively targeting TLR-signaling pathways. Nat. Commun. 2019, 10, 4670. [Google Scholar] [CrossRef]
- Tirabassi, R.S.; Ploegh, H.L. The human cytomegalovirus US8 glycoprotein binds to major histocompatibility complex class I products. J. Virol. 2002, 76, 6832–6835. [Google Scholar] [CrossRef]
- Maidji, E.; Tugizov, S.; Jones, T.; Zheng, Z.; Pereira, L. Accessory human cytomegalovirus glycoprotein US9 in the unique short component of the viral genome promotes cell-to-cell transmission of virus in polarized epithelial cells. J. Virol. 1996, 70, 8402–8410. [Google Scholar] [CrossRef]
- Seidel, E.; Le, V.T.K.; Bar-On, Y.; Tsukerman, P.; Enk, J.; Yamin, R.; Stein, N.; Schmiedel, D.; Oiknine Djian, E.; Weisblum, Y.; et al. Dynamic Co-evolution of Host and Pathogen: HCMV Downregulates the Prevalent Allele MICA *008 to Escape Elimination by NK Cells. Cell Rep. 2015, 10, 968–982. [Google Scholar] [CrossRef]
- Choi, H.J.; Park, A.; Kang, S.; Lee, E.; Lee, T.A.; Ra, E.A.; Lee, J.; Lee, S.; Park, B. Human cytomegalovirus-encoded US9 targets MAVS and STING signaling to evade type I interferon immune responses. Nat. Commun. 2018, 9, 125. [Google Scholar] [CrossRef]
- Furman, M.H.; Dey, N.; Tortorella, D.; Ploegh, H.L. The human cytomegalovirus US10 gene product delays trafficking of major histocompatibility complex class I molecules. J. Virol. 2002, 76, 11753–11756. [Google Scholar] [CrossRef]
- Park, B.; Spooner, E.; Houser, B.L.; Strominger, J.L.; Ploegh, H.L. The HCMV membrane glycoprotein US10 selectively targets HLA-G for degradation. J. Exp. Med. 2010, 207, 2033–2041. [Google Scholar] [CrossRef]
- Cho, S.; Kim, B.Y.; Ahn, K.; Jun, Y. The C-terminal amino acid of the MHC-I heavy chain is critical for binding to Derlin-1 in human cytomegalovirus US11-induced MHC-I degradation. PLoS ONE 2013, 8, e72356. [Google Scholar] [CrossRef] [PubMed]
- Gauthami, S.; Kumar, D.; SivaSai, K.S.R.; Hegde, N.R. The use of BirA-BAP system to study the effect of US2 and US11 on MHC class I heavy chain in cells. Immunol. Lett. 2017, 190, 233–239. [Google Scholar] [CrossRef] [PubMed]
- Barel, M.T.; Hassink, G.C.; van Voorden, S.; Wiertz, E.J. Human cytomegalovirus-encoded US2 and US11 target unassembled MHC class I heavy chains for degradation. Mol. Immunol. 2006, 43, 1258–1266. [Google Scholar] [CrossRef]
- Tirosh, B.; Iwakoshi, N.N.; Lilley, B.N.; Lee, A.H.; Glimcher, L.H.; Ploegh, H.L. Human cytomegalovirus protein US11 provokes an unfolded protein response that may facilitate the degradation of class I major histocompatibility complex products. J. Virol. 2005, 79, 2768–2779. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.O.; Hwang, S.; Park, J.; Park, B.; Jin, B.S.; Lee, S.; Kim, E.; Cho, S.; Kim, Y.; Cho, K.; et al. Functional dissection of HCMV US11 in mediating the degradation of MHC class I molecules. Biochem. Biophys. Res. Commun. 2005, 330, 1262–1267. [Google Scholar] [CrossRef]
- Zimmermann, C.; Kowalewski, D.; Bauersfeld, L.; Hildenbrand, A.; Gerke, C.; Schwarzmuller, M.; Le-Trilling, V.T.K.; Stevanovic, S.; Hengel, H.; Momburg, F.; et al. HLA-B locus products resist degradation by the human cytomegalovirus immunoevasin US11. PLoS Pathog. 2019, 15, e1008040. [Google Scholar] [CrossRef] [PubMed]
- Fielding, C.A.; Weekes, M.P.; Nobre, L.V.; Ruckova, E.; Wilkie, G.S.; Paulo, J.A.; Chang, C.; Suarez, N.M.; Davies, J.A.; Antrobus, R.; et al. Control of immune ligands by members of a cytomegalovirus gene expansion suppresses natural killer cell activation. eLife 2017, 6, e22206. [Google Scholar] [CrossRef]
- Kim, H.J.; Lee, Y.; Lee, S.; Park, B. HCMV-encoded viral protein US12 promotes autophagy by inducing autophagy flux. Biochem. Biophys. Res. Commun. 2023, 654, 94–101. [Google Scholar] [CrossRef]
- Luganini, A.; Cavaletto, N.; Raimondo, S.; Geuna, S.; Gribaudo, G. Loss of the Human Cytomegalovirus US16 Protein Abrogates Virus Entry into Endothelial and Epithelial Cells by Reducing the Virion Content of the Pentamer. J. Virol. 2017, 91, e00205-17. [Google Scholar] [CrossRef]
- Bronzini, M.; Luganini, A.; Dell’Oste, V.; De Andrea, M.; Landolfo, S.; Gribaudo, G. The US16 gene of human cytomegalovirus is required for efficient viral infection of endothelial and epithelial cells. J. Virol. 2012, 86, 6875–6888. [Google Scholar] [CrossRef][Green Version]
- Nguyen, C.C.; Kamil, J.P. Pathogen at the Gates: Human Cytomegalovirus Entry and Cell Tropism. Viruses 2018, 10, 704. [Google Scholar] [CrossRef]
- Gurczynski, S.J.; Das, S.; Pellett, P.E. Deletion of the human cytomegalovirus US17 gene increases the ratio of genomes per infectious unit and alters regulation of immune and endoplasmic reticulum stress response genes at early and late times after infection. J. Virol. 2014, 88, 2168–2182. [Google Scholar] [CrossRef][Green Version]
- Guo, Y.W.; Huang, E.S. Characterization of a structurally tricistronic gene of human cytomegalovirus composed of U(s)18, U(s)19, and U(s)20. J. Virol. 1993, 67, 2043–2054. [Google Scholar] [CrossRef] [PubMed]
- Charpak-Amikam, Y.; Kubsch, T.; Seidel, E.; Oiknine-Djian, E.; Cavaletto, N.; Yamin, R.; Schmiedel, D.; Wolf, D.; Gribaudo, G.; Messerle, M.; et al. Human cytomegalovirus escapes immune recognition by NK cells through the downregulation of B7-H6 by the viral genes US18 and US20. Sci. Rep. 2017, 7, 8661. [Google Scholar] [CrossRef] [PubMed]
- Fielding, C.A.; Aicheler, R.; Stanton, R.J.; Wang, E.C.; Han, S.; Seirafian, S.; Davies, J.; McSharry, B.P.; Weekes, M.P.; Antrobus, P.R.; et al. Two novel human cytomegalovirus NK cell evasion functions target MICA for lysosomal degradation. PLoS Pathog. 2014, 10, e1004058. [Google Scholar] [CrossRef]
- Cavaletto, N.; Luganini, A.; Gribaudo, G. Inactivation of the Human Cytomegalovirus US20 Gene Hampers Productive Viral Replication in Endothelial Cells. J. Virol. 2015, 89, 11092–11106. [Google Scholar] [CrossRef]
- Luganini, A.; Di Nardo, G.; Munaron, L.; Gilardi, G.; Fiorio Pla, A.; Gribaudo, G. Human cytomegalovirus US21 protein is a viroporin that modulates calcium homeostasis and protects cells against apoptosis. Proc. Natl. Acad. Sci. USA 2018, 115, E12370–E12377. [Google Scholar] [CrossRef]
- Feng, X.; Schroer, J.; Yu, D.; Shenk, T. Human cytomegalovirus pUS24 is a virion protein that functions very early in the replication cycle. J. Virol. 2006, 80, 8371–8378. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Stegman, J.R.; Margulies, B.J. The human cytomegalovirus chemokine receptor homolog encoded by US27. Virus Genes 2017, 53, 516–521. [Google Scholar] [CrossRef]
- O’Connor, C.M.; Shenk, T. Human cytomegalovirus pUS27 G protein-coupled receptor homologue is required for efficient spread by the extracellular route but not for direct cell-to-cell spread. J. Virol. 2011, 85, 3700–3707. [Google Scholar] [CrossRef]
- Arnolds, K.L.; Lares, A.P.; Spencer, J.V. The US27 gene product of human cytomegalovirus enhances signaling of host chemokine receptor CXCR4. Virology 2013, 439, 122–131. [Google Scholar] [CrossRef] [PubMed]
- Boeck, J.M.; Spencer, J.V. Effect of human cytomegalovirus (HCMV) US27 on CXCR4 receptor internalization measured by fluorogen-activating protein (FAP) biosensors. PLoS ONE 2017, 12, e0172042. [Google Scholar] [CrossRef] [PubMed]
- Boeck, J.M.; Stowell, G.A.; O’Connor, C.M.; Spencer, J.V. The Human Cytomegalovirus US27 Gene Product Constitutively Activates Antioxidant Response Element-Mediated Transcription through Gbetagamma, Phosphoinositide 3-Kinase, and Nuclear Respiratory Factor 1. J. Virol. 2018, 92, e00644-18. [Google Scholar] [CrossRef]
- Tu, C.C.; O’Connor, C.M.; Spencer, J.V. Identification of a novel signaling complex containing host chemokine receptor CXCR4, Interleukin-10 receptor, and human cytomegalovirus US27. Virology 2020, 548, 49–58. [Google Scholar] [CrossRef] [PubMed]
- Tu, C.C.; Spencer, J.V. The DRY box and C-terminal domain of the human cytomegalovirus US27 gene product play a role in promoting cell growth and survival. PLoS ONE 2014, 9, e113427. [Google Scholar] [CrossRef] [PubMed]
- Lares, A.P.; Tu, C.C.; Spencer, J.V. The human cytomegalovirus US27 gene product enhances cell proliferation and alters cellular gene expression. Virus Res. 2013, 176, 312–320. [Google Scholar] [CrossRef]
- Wen, D.Q.; Zhang, Y.Y.; Lv, L.P.; Zhou, X.P.; Yan, F.; Ma, P.; Xu, J.B. Human cytomegalovirus-encoded chemokine receptor homolog US28 stimulates the major immediate early gene promoter/enhancer via the induction of CREB. J. Recept. Signal Transduct. 2009, 29, 266–273. [Google Scholar] [CrossRef]
- Maussang, D.; Verzijl, D.; van Walsum, M.; Leurs, R.; Holl, J.; Pleskoff, O.; Michel, D.; van Dongen, G.A.; Smit, M.J. Human cytomegalovirus-encoded chemokine receptor US28 promotes tumorigenesis. Proc. Natl. Acad. Sci. USA 2006, 103, 13068–13073. [Google Scholar] [CrossRef]
- Maussang, D.; Langemeijer, E.; Fitzsimons, C.P.; Stigter-van Walsum, M.; Dijkman, R.; Borg, M.K.; Slinger, E.; Schreiber, A.; Michel, D.; Tensen, C.P.; et al. The human cytomegalovirus-encoded chemokine receptor US28 promotes angiogenesis and tumor formation via cyclooxygenase-2. Cancer Res. 2009, 69, 2861–2869. [Google Scholar] [CrossRef]
- Heukers, R.; Fan, T.S.; de Wit, R.H.; van Senten, J.R.; De Groof, T.W.M.; Bebelman, M.P.; Lagerweij, T.; Vieira, J.; de Munnik, S.M.; Smits-de Vries, L.; et al. The constitutive activity of the virally encoded chemokine receptor US28 accelerates glioblastoma growth. Oncogene 2018, 37, 4110–4121. [Google Scholar] [CrossRef]
- Noriega, V.M.; Gardner, T.J.; Redmann, V.; Bongers, G.; Lira, S.A.; Tortorella, D. Human cytomegalovirus US28 facilitates cell-to-cell viral dissemination. Viruses 2014, 6, 1202. [Google Scholar] [CrossRef] [PubMed]
- Casarosa, P.; Bakker, R.A.; Verzijl, D.; Navis, M.; Timmerman, H.; Leurs, R.; Smit, M.J. Constitutive signaling of the human cytomegalovirus-encoded chemokine receptor US28. J. Biol. Chem. 2001, 276, 1133–1137. [Google Scholar] [CrossRef] [PubMed]
- Vomaske, J.; Varnum, S.; Melnychuk, R.; Smith, P.; Pasa-Tolic, L.; Shutthanandan, J.I.; Streblow, D.N. HCMV pUS28 initiates pro-migratory signaling via activation of Pyk2 kinase. Herpesviridae 2010, 1, 2. [Google Scholar] [CrossRef] [PubMed]
- Krishna, B.A.; Poole, E.L.; Jackson, S.E.; Smit, M.J.; Wills, M.R.; Sinclair, J.H. Latency-Associated Expression of Human Cytomegalovirus US28 Attenuates Cell Signaling Pathways To Maintain Latent Infection. mBio 2017, 8, e01754-17. [Google Scholar] [CrossRef]
- Kledal, T.N.; Rosenkilde, M.M.; Schwartz, T.W. Selective recognition of the membrane-bound CX3C chemokine, fractalkine, by the human cytomegalovirus-encoded broad-spectrum receptor US28. FEBS Lett. 1998, 441, 209–214. [Google Scholar] [CrossRef]
- Streblow, D.N.; Soderberg-Naucler, C.; Vieira, J.; Smith, P.; Wakabayashi, E.; Ruchti, F.; Mattison, K.; Altschuler, Y.; Nelson, J.A. The human cytomegalovirus chemokine receptor US28 mediates vascular smooth muscle cell migration. Cell 1999, 99, 511–520. [Google Scholar] [CrossRef]
- Randolph-Habecker, J.R.; Rahill, B.; Torok-Storb, B.; Vieira, J.; Kolattukudy, P.E.; Rovin, B.H.; Sedmak, D.D. The expression of the cytomegalovirus chemokine receptor homolog US28 sequesters biologically active CC chemokines and alters IL-8 production. Cytokine 2002, 19, 37–46. [Google Scholar] [CrossRef]
- Guo, G.; Ye, S.; Xie, S.; Ye, L.; Lin, C.; Yang, M.; Shi, X.; Wang, F.; Li, B.; Li, M.; et al. The cytomegalovirus protein US31 induces inflammation through mono-macrophages in systemic lupus erythematosus by promoting NF-kappaB2 activation. Cell Death Dis. 2018, 9, 104. [Google Scholar] [CrossRef]
- Ye, S.; Hu, Y.; Chen, C.; Chen, S.; Tong, X.; Zhu, H.; Deng, B.; Hu, X.; Sun, X.; Chen, X.; et al. The Human Cytomegalovirus US31 Gene Predicts Favorable Survival and Regulates the Tumor Microenvironment in Gastric Cancer. Front. Oncol. 2021, 11, 614925. [Google Scholar] [CrossRef]
- Hakki, M.; Marshall, E.E.; De Niro, K.L.; Geballe, A.P. Binding and nuclear relocalization of protein kinase R by human cytomegalovirus TRS1. J. Virol. 2006, 80, 11817–11826. [Google Scholar] [CrossRef]
- Bierle, C.J.; Semmens, K.M.; Geballe, A.P. Double-stranded RNA binding by the human cytomegalovirus PKR antagonist TRS1. Virology 2013, 442, 28–37. [Google Scholar] [CrossRef] [PubMed]
- Adamo, J.E.; Schroer, J.; Shenk, T. Human cytomegalovirus TRS1 protein is required for efficient assembly of DNA-containing capsids. J. Virol. 2004, 78, 10221–10229. [Google Scholar] [CrossRef] [PubMed]
- Chaumorcel, M.; Lussignol, M.; Mouna, L.; Cavignac, Y.; Fahie, K.; Cotte-Laffitte, J.; Geballe, A.; Brune, W.; Beau, I.; Codogno, P.; et al. The human cytomegalovirus protein TRS1 inhibits autophagy via its interaction with Beclin 1. J. Virol. 2012, 86, 2571–2584. [Google Scholar] [CrossRef] [PubMed]
- Lau, B.; Kerr, K.; Camiolo, S.; Nightingale, K.; Gu, Q.; Antrobus, R.; Suarez, N.M.; Loney, C.; Stanton, R.J.; Weekes, M.P.; et al. Human Cytomegalovirus RNA2.7 Is Required for Upregulating Multiple Cellular Genes to Promote Cell Motility and Viral Spread Late in Lytic Infection. J. Virol. 2021, 95, e0069821. [Google Scholar] [CrossRef]
- Lombrana, R.; Almeida, R.; Alvarez, A.; Gomez, M. R-loops and initiation of DNA replication in human cells: A missing link? Front. Genet. 2015, 6, 158. [Google Scholar] [CrossRef]
- Rossetto, C.C.; Tarrant-Elorza, M.; Verma, S.; Purushothaman, P.; Pari, G.S. Regulation of viral and cellular gene expression by Kaposi’s sarcoma-associated herpesvirus polyadenylated nuclear RNA. J. Virol. 2013, 87, 5540–5553. [Google Scholar] [CrossRef]
- Sinclair, J.H.; Reeves, M.B. Human cytomegalovirus manipulation of latently infected cells. Viruses 2013, 5, 2803–2824. [Google Scholar] [CrossRef]
- Kulesza, C.A.; Shenk, T. Human cytomegalovirus 5-kilobase immediate-early RNA is a stable intron. J. Virol. 2004, 78, 13182–13189. [Google Scholar] [CrossRef][Green Version]
- Han, B.; Chao, J.; Yao, H. Circular RNA and its mechanisms in disease: From the bench to the clinic. Pharmacol. Ther. 2018, 187, 31–44. [Google Scholar] [CrossRef]
- Li, X.; Yang, L.; Chen, L.L. The Biogenesis, Functions, and Challenges of Circular RNAs. Mol. Cell 2018, 71, 428–442. [Google Scholar] [CrossRef]
- Ungerleider, N.; Concha, M.; Lin, Z.; Roberts, C.; Wang, X.; Cao, S.; Baddoo, M.; Moss, W.N.; Yu, Y.; Seddon, M.; et al. The Epstein Barr virus circRNAome. PLoS Pathog. 2018, 14, e1007206. [Google Scholar] [CrossRef] [PubMed]
- Toptan, T.; Abere, B.; Nalesnik, M.A.; Swerdlow, S.H.; Ranganathan, S.; Lee, N.; Shair, K.H.; Moore, P.S.; Chang, Y. Circular DNA tumor viruses make circular RNAs. Proc. Natl. Acad. Sci. USA 2018, 115, E8737–E8745. [Google Scholar] [CrossRef] [PubMed]
- Yetming, K.D.; Lupey-Green, L.N.; Biryukov, S.; Hughes, D.J.; Marendy, E.M.; Miranda, J.L.; Sample, J.T. The BHLF1 Locus of Epstein-Barr Virus Contributes to Viral Latency and B-Cell Immortalization. J. Virol. 2020, 94, e01215-20. [Google Scholar] [CrossRef] [PubMed]
- Gong, L.P.; Chen, J.N.; Dong, M.; Xiao, Z.D.; Feng, Z.Y.; Pan, Y.H.; Zhang, Y.; Du, Y.; Zhang, J.Y.; Bi, Y.H.; et al. Epstein-Barr virus-derived circular RNA LMP2A induces stemness in EBV-associated gastric cancer. EMBO Rep. 2020, 21, e49689. [Google Scholar] [CrossRef]
- Abere, B.; Li, J.; Zhou, H.; Toptan, T.; Moore, P.S.; Chang, Y. Kaposi’s Sarcoma-Associated Herpesvirus-Encoded circRNAs Are Expressed in Infected Tumor Tissues and Are Incorporated into Virions. mBio 2020, 11, e03027-19. [Google Scholar] [CrossRef]
- Tagawa, T.; Gao, S.; Koparde, V.N.; Gonzalez, M.; Spouge, J.L.; Serquina, A.P.; Lurain, K.; Ramaswami, R.; Uldrick, T.S.; Yarchoan, R.; et al. Discovery of Kaposi’s sarcoma herpesvirus-encoded circular RNAs and a human antiviral circular RNA. Proc. Natl. Acad. Sci. USA 2018, 115, 12805–12810. [Google Scholar] [CrossRef]
- Abere, B.; Zhou, H.; Li, J.; Cao, S.; Toptan, T.; Grundhoff, A.; Fischer, N.; Moore, P.S.; Chang, Y. Merkel Cell Polyomavirus Encodes Circular RNAs (circRNAs) Enabling a Dynamic circRNA/microRNA/mRNA Regulatory Network. mBio 2020, 11, e03059-20. [Google Scholar] [CrossRef]
- Zhao, J.; Lee, E.E.; Kim, J.; Yang, R.; Chamseddin, B.; Ni, C.; Gusho, E.; Xie, Y.; Chiang, C.M.; Buszczak, M.; et al. Transforming activity of an oncoprotein-encoding circular RNA from human papillomavirus. Nat. Commun. 2019, 10, 2300. [Google Scholar] [CrossRef]
- Yang, S.; Zhou, H.; Liu, M.; Jaijyan, D.; Cruz-Cosme, R.; Ramasamy, S.; Subbian, S.; Liu, D.; Xu, J.; Niu, X.; et al. SARS-CoV-2, SARS-CoV and MERS-CoV encode circular RNAs of spliceosome-independent origin. J. Med. Virol. 2022, 94, 3203–3222. [Google Scholar] [CrossRef]
- Yang, S.; Cruz-Cosme, R.; Cao, D.; Zhou, H.; Wu, S.; Huang, J.; Luo, Z.; Zhu, H.; Tang, Q. Murine Hepatitis Virus Exoribonuclease nsp14 Is Required for the Biogenesis of Viral Circular RNAs. Microbiol. Spectr. 2023, 11, e0446022. [Google Scholar] [CrossRef]
- Deng, J.; Wang, Q.; Zhang, J.; Ma, Y.; Qi, Y.; Liu, Z.; Li, Y.; Ruan, Q.; Huang, Y. Identification and characterization of human cytomegalovirus-encoded circular RNAs. Front. Cell. Infect. Microbiol. 2022, 12, 980974. [Google Scholar] [CrossRef] [PubMed]
- Meshesha, M.K.; Veksler-Lublinsky, I.; Isakov, O.; Reichenstein, I.; Shomron, N.; Kedem, K.; Ziv-Ukelson, M.; Bentwich, Z.; Avni, Y.S. The microRNA Transcriptome of Human Cytomegalovirus (HCMV). Open Virol. J. 2012, 6, 38–48. [Google Scholar] [CrossRef]
- Kozomara, A.; Griffiths-Jones, S. miRBase: Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Res. 2011, 39, D152–D157. [Google Scholar] [CrossRef] [PubMed]
- Lau, B.; Poole, E.; Krishna, B.; Sellart, I.; Wills, M.R.; Murphy, E.; Sinclair, J. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6. Sci. Rep. 2016, 6, 31205. [Google Scholar] [CrossRef] [PubMed]
- Diggins, N.L.; Hancock, M.H. HCMV miRNA Targets Reveal Important Cellular Pathways for Viral Replication, Latency, and Reactivation. Noncoding RNA 2018, 4, 29. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Li, S.; Lu, Z.; Du, P.; Liu, G.; Li, M.; Ma, C.; Zhou, J.; Bao, J. HCMV-miR-US33-5p promotes apoptosis of aortic vascular smooth muscle cells by targeting EPAS1/SLC3A2 pathway. Cell. Mol. Biol. Lett. 2022, 27, 40. [Google Scholar] [CrossRef]
- Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2019, 47, D155–D162. [Google Scholar] [CrossRef]
- Movassagh, M.; Gozlan, J.; Senechal, B.; Baillou, C.; Petit, J.C.; Lemoine, F.M. Direct infection of CD34+ progenitor cells by human cytomegalovirus: Evidence for inhibition of hematopoiesis and viral replication. Blood 1996, 88, 1277–1283. [Google Scholar] [CrossRef]
- Taylor-Wiedeman, J.; Sissons, J.G.; Borysiewicz, L.K.; Sinclair, J.H. Monocytes are a major site of persistence of human cytomegalovirus in peripheral blood mononuclear cells. J. Gen. Virol. 1991, 72 Pt 9, 2059–2064. [Google Scholar] [CrossRef]
- Goodrum, F. Human Cytomegalovirus Latency: Approaching the Gordian Knot. Annu. Rev. Virol. 2016, 3, 333–357. [Google Scholar] [CrossRef]
- Slobedman, B.; Cao, J.Z.; Avdic, S.; Webster, B.; McAllery, S.; Cheung, A.K.; Tan, J.C.; Abendroth, A. Human cytomegalovirus latent infection and associated viral gene expression. Future Microbiol. 2010, 5, 883–900. [Google Scholar] [CrossRef] [PubMed]
- Goodrum, F.D.; Jordan, C.T.; High, K.; Shenk, T. Human cytomegalovirus gene expression during infection of primary hematopoietic progenitor cells: A model for latency. Proc. Natl. Acad. Sci. USA 2002, 99, 16255–16260. [Google Scholar] [CrossRef]
- Cheung, A.K.; Abendroth, A.; Cunningham, A.L.; Slobedman, B. Viral gene expression during the establishment of human cytomegalovirus latent infection in myeloid progenitor cells. Blood 2006, 108, 3691–3699. [Google Scholar] [CrossRef] [PubMed]
- Poole, E.; Sinclair, J. Sleepless latency of human cytomegalovirus. Med. Microbiol. Immunol. 2015, 204, 421–429. [Google Scholar] [CrossRef]
- Shnayder, M.; Nachshon, A.; Krishna, B.; Poole, E.; Boshkov, A.; Binyamin, A.; Maza, I.; Sinclair, J.; Schwartz, M.; Stern-Ginossar, N. Defining the Transcriptional Landscape during Cytomegalovirus Latency with Single-Cell RNA Sequencing. mBio 2018, 9, e00013-18. [Google Scholar] [CrossRef] [PubMed]
- Shnayder, M.; Nachshon, A.; Rozman, B.; Bernshtein, B.; Lavi, M.; Fein, N.; Poole, E.; Avdic, S.; Blyth, E.; Gottlieb, D.; et al. Single cell analysis reveals human cytomegalovirus drives latently infected cells towards an anergic-like monocyte state. eLife 2020, 9, e52168. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Albright, E.R.; Lee, J.H.; Jacobs, D.; Kalejta, R.F. Cellular defense against latent colonization foiled by human cytomegalovirus UL138 protein. Sci. Adv. 2015, 1, e1501164. [Google Scholar] [CrossRef]
- Kondo, K.; Xu, J.; Mocarski, E.S. Human cytomegalovirus latent gene expression in granulocyte-macrophage progenitors in culture and in seropositive individuals. Proc. Natl. Acad. Sci. USA 1996, 93, 11137–11142. [Google Scholar] [CrossRef]
- Poole, E.; Walther, A.; Raven, K.; Benedict, C.A.; Mason, G.M.; Sinclair, J. The myeloid transcription factor GATA-2 regulates the viral UL144 gene during human cytomegalovirus latency in an isolate-specific manner. J. Virol. 2013, 87, 4261–4271. [Google Scholar] [CrossRef]
- Forte, E.; Swaminathan, S.; Schroeder, M.W.; Kim, J.Y.; Terhune, S.S.; Hummel, M. Tumor Necrosis Factor Alpha Induces Reactivation of Human Cytomegalovirus Independently of Myeloid Cell Differentiation following Posttranscriptional Establishment of Latency. mBio 2018, 9, e01560-18. [Google Scholar] [CrossRef]
- Buehler, J.; Zeltzer, S.; Reitsma, J.; Petrucelli, A.; Umashankar, M.; Rak, M.; Zagallo, P.; Schroeder, J.; Terhune, S.; Goodrum, F. Opposing Regulation of the EGF Receptor: A Molecular Switch Controlling Cytomegalovirus Latency and Replication. PLoS Pathog. 2016, 12, e1005655. [Google Scholar] [CrossRef]
- Kim, J.H.; Collins-McMillen, D.; Buehler, J.C.; Goodrum, F.D.; Yurochko, A.D. Human Cytomegalovirus Requires Epidermal Growth Factor Receptor Signaling to Enter and Initiate the Early Steps in the Establishment of Latency in CD34(+) Human Progenitor Cells. J. Virol. 2017, 91, e01206-16. [Google Scholar] [CrossRef]
- Collins-McMillen, D.; Buehler, J.; Peppenelli, M.; Goodrum, F. Molecular Determinants and the Regulation of Human Cytomegalovirus Latency and Reactivation. Viruses 2018, 10, 444. [Google Scholar] [CrossRef] [PubMed]
- Lau, B.; Poole, E.; Van Damme, E.; Bunkens, L.; Sowash, M.; King, H.; Murphy, E.; Wills, M.; Van Loock, M.; Sinclair, J. Human cytomegalovirus miR-UL112-1 promotes the down-regulation of viral immediate early-gene expression during latency to prevent T-cell recognition of latently infected cells. J. Gen. Virol. 2016, 97, 2387–2398. [Google Scholar] [CrossRef] [PubMed]
- Keller, M.J.; Wu, A.W.; Andrews, J.I.; McGonagill, P.W.; Tibesar, E.E.; Meier, J.L. Reversal of human cytomegalovirus major immediate-early enhancer/promoter silencing in quiescently infected cells via the cyclic AMP signaling pathway. J. Virol. 2007, 81, 6669–6681. [Google Scholar] [CrossRef]
- Gustems, M.; Borst, E.; Benedict, C.A.; Perez, C.; Messerle, M.; Ghazal, P.; Angulo, A. Regulation of the transcription and replication cycle of human cytomegalovirus is insensitive to genetic elimination of the cognate NF-kappaB binding sites in the enhancer. J. Virol. 2006, 80, 9899–9904. [Google Scholar] [CrossRef] [PubMed]




| ORFs | Detail Functions | Functions to Host Cells |
|---|---|---|
| RL1 | Degrades SLFN11 [40] | Immune evasion [40] |
| RNA2.7 (IRL4) | Lytic replication and maintenance of latent [5]; Inhibits apoptosis, maintains ATP production [41]; Inhibits Pol II phosphorylation [42] | Anti-apoptosis [41] Cell transcription [42] |
| RL5A | Unknown | Unknown |
| RL6 | Unknown | Unknown |
| RNA1.2 | Lytic replication and maintenance of latent [5]; Suppresses upregulation of IL-6 by blocking NF-κB activation [43]; Transcripts a new NAT [44] | Immune evasion [43] |
| RL8A | Unknown | Unknown |
| RL9A | Unknown | Unknown |
| RL10 | Unknown | Unknown |
| RL11 | IgG Fc-binding protein, blocks IgG-mediated activation of FcγRs [45,46]; Induces early ADCC [47] | Immune evasion [46] |
| RL12 | IgG Fc-binding protein capacity [48] | Unknown |
| RL13 | IgG Fc-binding protein [48]; Inhibitor of replication [49]; Interacts with NUDT14 [50] | Immune evasion [48] |
| UL1 | Cell type-specific tropism factor [51] | Cell tropism [51] |
| UL2 | Unknown | Unknown |
| UL4 | Represses translation, ribosome stalling [24,25,52] | Unknown |
| UL5 | Induces early ADCC [47]; Interacts with IQGAP1 [53] | Immune evasion [47] |
| UL6 | Unknown | Unknown |
| UL7 | Reduces FOXO3a activity, prevents apoptosis in CD341HPCs [30]; Interferes with proinflammatory responses [54]; CEACAM1-like protein, promotes angiogenesis [55]; Binds to Flt3R triggers HPC and monocyte differentiation [56] | Anti-apoptosis [30] Anti-inflammatory [54] Promotes angiogenesis [55] |
| UL8 | Inhibits the production of proinflammatory cytokine [57] | Anti-inflammatory [57] |
| UL9 | Temperance for fibroblasts [38] | Unknown |
| UL10 | Interference of T cells activation, proliferation, and cytokine production [35]; Temperance for RPE [38] | Anti-cell proliferation, immune evasion [35] |
| UL11 | Inhibits T cell signaling and proliferation via CD45 [36]; Induces T cell IL-10 secretion via CD45 [58] | Anti-inflammatory, Anti-cell proliferation [36,58] |
| UL12 | Unknown | Unknown |
| UL13 | Unknown | Unknown |
| UL14 | Unknown | Unknown |
| UL15A | Unknown | Unknown |
| UL15 | Unknown | Unknown |
| UL16 | Induces early ADCC [47]; Temperance in fibroblasts [38]; Modulation NK cell signaling/function [39,59,60,61,62] | Immune evasion [39,47,59,60,61,62] |
| UL17 | Unknown | Unknown |
| UL18 | MHC-I homologue, LIR-1 ligand, modulation NK cell signaling [29,39,63,64,65,66,67] | Immune evasion [29,39,63,64,65,66,67] |
| UL19 | Unknown | Unknown |
| UL20 | Targets lysosomal degradation [68] | Unknown |
| UL21 | Unknown | Unknown |
| UL21A (UL21.5) | Facilitates virus replication and late gene expression [21,22]; APC regulator [69,70]; Degradation of cyclin A, proteasomal destruction [71,72] | Cell cycle arrest [71,72] |
| UL22A (UL22.5) | Secretory CCL5 receptor [73]; Selective RANTES binding [74] | Immune evasion [74] |
| UL22 | Unknown | Unknown |
| UL23 | Temperance for fibroblasts [38]; Inhibits IFN-γ/IFN-I response [75,76,77] | Immune evasion [75,76,77] |
| UL24 | Downregulates the expression of miR-UL59 [78]; Participates in SAMHD1 subcellular localization [79] | Immune evasion [78] |
| UL25 | Presumably binds to the SH3 domain of NCK-1 [80] | Unknown |
| UL26 | Activator of MIEP [81]; Regulates the phosphorylation of pp28 [82]; Viral tegument assembly [83]; Increases stability of virion proteins [84,85]; Antagonize innate immunity (via NF-κB signaling) [86,87] | Immune evasion [86,87] |
| UL27 | Maribavir resistance [88,89,90,91] | Unknown |
| UL28 | Activator of MIEP (via NuRD complex) [92,93]; Regulates p53 transcriptional activity [94] | Unknown |
| UL29 | Activator of MIEP (via NuRD complex) [92,93]; Regulates p53 transcriptional activity [94] | Unknown |
| UL30 | Unknown | Unknown |
| UL31 | Regulate pre-rRNA levels and nucleolar organization [95]; Inhibitor of cGAS [96] | Immune evasion [96] |
| UL32 (PP150) | Virion maturation, nucleocapsid stabilization [97,98,99]; Cyclin A2–CDK-dependent sensor [100]; Viral DUB main target [101] | Cell cycle arrest [100] |
| UL33 | Orchestrates signaling networks [102]; Modulates chemokine receptors [103,104]; Oncomodulatory properties [105]; Facilitates cell-associated and cell-free spread [106]; Activates CREB, viral reactivation, trophoblast migration [107,108] | Chemokine receptor [103] Cell migration [108] |
| UL34 | Represses US3 expression [109,110]; Transcriptional repression and oriLyt-dependent DNA replication [111,112,113]; Capsid formation and maturation [114] | Unknown |
| UL35 | IE gene expression and virus assembly [115,116]; Promotes viral replication by manipulating host responses [117]; Antagonizes type I IFN response [118] | Immune evasion [118] |
| UL36 | Regulators gene expression [119]; Inhibits caspase-8 activation and apoptosis [31,120,121]; Initiation of replication [122] | Anti-apoptosis [31,120,121] |
| UL37.1 | Regulators gene expression [119]; Initiation of replication [122]; US3 regulator (repressor) [123]; Viral mitochondrion-localized inhibitor of apoptosis (vMIA) [124,125,126,127]; Important for remodeling of host lipid metabolism [128] | Immune evasion, anti-apoptosis [124,125] |
| UL37.3 | Initiation of replication [122]; MHC-like protein [129]; Prerequisites for gpUL37 internal cleavage [130] | Immune evasion [129] |
| UL38 | US3 regulator (repressor) [123]; Anti-apoptotic, facilitates virus replication [26,119,131,132,133]; Regulates p53 transcriptional activity [94]; Induces a pro-viral metabolic environment (via inhibition of TSC2) [134] | Anti-apoptosis [26,119,131,132,133] |
| UL39 | Unknown | Unknown |
| UL40 | Regulator of NK cell signaling [135,136,137,138] | Immune evasion [135,136,137,138] |
| UL41A (UL41.5) | Unknown | Unknown |
| UL42 | Negative regulator of cGAS/MITA [139]; Inhibition of E3 ligase prevents gB degradation [140,141]; Activates c-Jun [142] | Immune evasion [139] |
| UL43 | Downregulates the expression of miR-UL59 [78] | Immune evasion [78] |
| UL44 | DNA-binding nuclear protein, complexed to nucleolin and dsDNA [143]; Natural substrate of UL97 [144]; DNA polymerase accessory protein, increases DNA Pol processivity [145,146,147]; Inhibits p53 transcriptional activity [148]; Inhibits the binding of IRF3 and NF-κB to promoters of antiviral genes [149]; Sumoylation of UL44 attenuates viral replication [150,151] | Immune evasion [149] |
| UL45 | Late virion-associated protein [152]; Homologue of RNR R1, inhibits NF-κB signaling [153,154,155] | Immune evasion [153] |
| UL46 | Capsid constituent [156] | Unknown |
| UL47 | Modulates tegumentation and capsid accumulation [157]; Releases viral DNA from capsid [84,158] | Unknown |
| UL48 | Homologue of RNR R1, inhibits NF-κB signaling [153]; Deubiquitin protease [159]; Regulates the localization of pUL47 in vAC and promotes capsid maturation [84,157]; Releases viral DNA from capsid [158]; Contributes to vAC biogenesis [160]; Contributes to viral growth, virion stability and virus entry [161] | Immune evasion [153] |
| UL48A (UL48.5) | Smallest capsid protein [162]; Locates on tips of hexons in capsids [163] | Unknown |
| UL49 | DNA replication [164,165,166]; Regulates late-stage gene transcription, vPIC member [167] | Unknown |
| UL50 | Recruits UL97, nuclear egress, disruption of nuclear lamina [168]; Negative regulator of protein ISGylation [169]; Recruits UL53 to the nuclear membrane [170]; Induces the loss of VCP/p97 [171] | Unknown |
| UL51 | DNA cleavage packaging [172]; Viral terminase, promotes nuclear localization [173,174] | Unknown |
| UL52 | DNA cleavage packaging [175] | Unknown |
| UL53 | Recruits UL97, nuclear egress, disruption of nuclear lamina [168,176]; Functional virion production [177]; Associates with capsids and myosin Va [178] | Unknown |
| UL54 | DNA polymerase catalytic subunit (POL) [38]; Drug resistance [179]; Increases DNA processivity [145,146,147] | Unknown |
| UL55 | Virion glycoprotein B (gB), virion penetration, cell fusion and spread [180,181,182,183]; Formation of replication compartment [184]; Heparan binding [38,185] | Cell spread and fusion [180,181,182,183] |
| UL56 | Formation of replication compartment [184]; Binds DNA packaging motif, DNA cleavage, nuclease activity [38,186]; Terminase subunits [172,173,187]; ATPase activity [188] | Unknown |
| UL57 | Formation of replication compartment [184]; ssDNA-binding protein (SSB) [189] | Unknown |
| RNA4.9 | Viral latency, binds to PRC2 [190]; Enrichment of the repressive H3K27me3 mark [191]; Regulates viral DNA replication [192] | Cell proliferation [190] |
| UL69 | Pleiotropic transactivator [193]; Facilitates translation [27]; Promotes nuclear export of unspliced RNA [194]; Induces cell cycle block [195,196]; Nucleocytoplasmic shuttling activity [197]; mRNA export and viral replication [198,199] | Cell cycle arrest [195,196] |
| UL70 | Primase [189,200]; Viral DNA synthesis, progeny production [201,202] | Unknown |
| UL71 | Virus spread and release, affects multivesicular bodies [203]; Secondary envelopment [204,205,206] | Unknown |
| UL72 | Transcription-replication machinery [4]; Deoxyuridine triphosphatase homologue (not active) [207] | Unknown |
| UL73 | Envelope component [208]; Virion glycoprotein N (gN), component of gC-II, intracellular transport [209,210]; Virus attachment and cell spread [211] | Cell spread [211] |
| UL74 | Virion glycoprotein (gO), gCIII envelope complex components [212]; Cell fusion [213,214,215]; Promotes secondary envelopment and virus release [216]; Inhibits gH and gB antibodies, promotes focal spread [217]; Promotes gH/gL into the virion [218]; Polymorphisms, antibody neutralization on gH epitopes [219] | Cell fusion [213,214,215]; Immune evasion [217] |
| UL74A | Unknown | Unknown |
| UL75 | Virion glycoprotein (gH), cell fusion [214]; Viral entry, activates gene expression (Sp1 and NF-kappaB) [180,220] | Cell fusion [214] |
| UL76 | Modulates gene expression, inhibits DNA replication [23]; Induces DNA damage and chromosome aberrations [221,222]; Regulates UL77 expression [223]; Aggresome formation [224] | Unknown |
| UL77 | Capsid maturation, DNA packaging [225]; DNA binding capacity [226] | Unknown |
| UL78 | GPCR homologues, chemokine receptor-like protein [103]; Regulates chemokine receptor [104]; Enters cells and delivers virion components [227]; Negatively regulates NF-κB pathway [228] | Immune evasion [228] |
| UL79 | The accumulation of late viral transcripts [229]; Late viral gene expression, infectious virus production [230]; Nuclear-accumulating protein, involved in nuclear import pathway [231] | Unknown |
| UL80 | Serine protease and its substrate [232]; Capsid assembly proteins, involved in nuclear localization signals, virus production [233] | Unknown |
| UL80.5 | Assembly protein precursor (pAP), interacts with MCP via CCD [234,235] | Unknown |
| UL80A | Maturational protease precursor (pPR) [233]; Early capsid formation, interacts with itself through ACD [236] | Unknown |
| UL82 (PP71) | Activator of MIEP [237,238]; Stimulates G1 cell cycle progression, induces cell DNA synthesis [239,240]; Binds and degrades Rb family members [240,241,242]; Regulates IE gene expression and viral replication [243,244]; Interferes with trafficking and cell surface expression of MHC class I [245]; Induces Daxx SUMOylation [246,247]; Inhibits STING-mediated signaling, evades antiviral immunity [248] | Cell proliferation [190] Cell cycle stimulation [239,240] Immune evasion [244,247,248] |
| UL83 (PP65) | Modulates immune response [249]; Prevents IRF3 activation, attenuates the interferon response [250]; Inhibits NK cell activity [251,252]; Degrades HLA-DR α-chain [253,254]; Modulates viral gene expression and IFI16 stability [255,256,257]; Deregulates the activation of AIM2 inflammasome [258]; Inhibits IFN-β production via cGAS [259] | Immune evasion [249,250,254,256,257,258,259] |
| UL84 | Suppresses the transcriptional activation of IE2, UTPase activity [200]; OriLyt-dependent DNA replication, activates oriLyt promoter, initiates lytic replication [260,261,262,263,264]; Component of viral replication compartments [265]; Nucleocytoplasmic essential for viral growth [266,267]; Enhances p53 binding [268] | Unknown |
| UL85 | Minor capsid protein [38,156] | Unknown |
| UL86 | Major capsid protein [38,235,269] | Unknown |
| UL87 | Late gene expression, inhibits MIE genes expression and virus DNA replication [191,230] | Unknown |
| UL88 | Maintains the virion proper tegument composition [270] | Unknown |
| UL89 | Terminase ATPase subunit, promotes terminase complex formation [172,173]; Effects DNA cleavage, produces energy for genome transportation [271,272]; Viral maturation [273,274,275] | Unknown |
| UL90 | Unknown | Unknown |
| UL91 | Regulates late viral gene expression [276] | Unknown |
| UL92 | Regulator of late viral gene expression [277] | Unknown |
| UL93 | Interacts with pUL77, necessary for viral genome encapsidation [225,278]; Viral genome cleavage and packaging [279] | Unknown |
| UL94 | Negative regulator of the innate immune response (via MITA) [280]; Facilitates secondary envelopment [281]; Tegument protein, nucleocytoplasmic shuttling protein [282,283]; pp28 binding partner [284]; Interacts with UL99, protein localization, virus replication [285] | Immune evasion [280] |
| UL95 | Late viral gene expression, infectious virus production [230] | Unknown |
| UL96 | Nucleocapsid stability, maturation of the capsid dense bodies [286] | Unknown |
| UL97 | Viral serine-threonine protein kinase, mimic cdc2/CDK1, DNA packaging [38,287]; Coregulates nuclear export of IFI16 [257,288,289]; Regulates IE gene expression by disrupting HDAC1 binding to the MIEP [290]; The cyclin-dependent kinase ortholog interacts with Cyclin T1 [291]; Involved in DNA replication, DNA encapsidation and/or nuclear egress [292,293,294,295]; Involved in secondary envelopment [296]; Subcellular distribution of cytoplasmic assembly sites [297] | Unknown |
| UL98 | Alkaline nuclease [16,298,299,300,301] | Unknown |
| UL99 (PP28) | Myristylated phosphoprotein, secondary envelopment [3,281,302]; Interacts with UL94, protein localization, virus replication [284,285]; Intracellular trafficking, viral assembly [303,304] | Unknown |
| UL100 | Virion glycoprotein (gM) [305]; gM/gN protein complex [306]; Virus assembly and replication [307]; Interacts with FIP4, recruits Rab11 [308] | Unknown |
| UL102 | Component of DNA helicase-primase [38,309,310] | Unknown |
| UL103 | Contributes to vAC biogenesis, secondary envelopment [160,311]; Antiviral responses, nuclear activities, biogenesis and transport of cytoplasmic vesicles [311]; Regulates virion and dense body egress [312] | Immune evasion [311]; |
| UL104 | DNA encapsidation, essential for DNA insertion into capsid [313,314,315,316]; Self-assemble portal complexes [317]; DNA packaging [318] | Unknown |
| UL105 | Component of DNA helicase-primase [38,319]; Essential for oriLyt-dependent DNA replication [320] | Unknown |
| RNA5.0 | Unknown | Unknown |
| UL108 | Unknown | Unknown |
| UL109 | Unknown | Unknown |
| UL110 | Unknown | Unknown |
| UL111A | Homolog to hIL-10 [321,322]; Inhibits DC maturation and function [323]; Inhibits the recognition of latently infected cells by CD4+ T cells [324]; Immunomodulatory cytokine [325]; Correlates with the number of infiltrating T cells [326]; Enhances the CXCL12/CXCR4 signaling axis [327]; Upregulates hIL-10 expression, amplify its immunosuppressive impact [328] | Immune evasion [323,324,325,326,327,328] |
| UL112- UL113 | Transcriptional activator [329]; Formation of replication compartment, efficient viral replication [320,330,331,332,333,334,335,336] | Unknown |
| UL114 | Uracil DNA glycosylase (UNG), increases DNA synthesis efficiency [337,338,339]; Temporal regulation of DNA replication [340,341]; Interacts with UL54, participates in base excision repair [342] | Unknown |
| UL115 | Virion glycoprotein L (gL), gH/gL/gO complex, cell fusion and entry [214,218,343] | Cell fusion [214] |
| UL116 | Envelope glycoprotein, gH/UL116 complex, chaperone for gH [344,345]; Contributes to viral infectivity [346]; Interacts with UL148, promotes gH/gL complexes into virions [347] | Unknown |
| UL117 | Promotes nuclear replication chamber development to facilitate viral growth [348]; Inhibits MCM accumulation, suppresses host DNA synthesis [349] | Unknown |
| UL119-118 | gp68, Fcγ receptor, antagonizes host FcγR activation [350,351]; Carries IgGs and antibody MSL-109, interferes with IgG-mediated immunity [46,352,353] | Immune evasion [46,351,352,353] |
| UL120 | Unknown | Unknown |
| UL121 | Unknown | Unknown |
| UL122 (IE2) | Immediate early transactivator (IE2); interacts with transcriptional machinery; repression via specific DNA-binding activity [38]; Induces cells into S phase, alters cell cycle, induces cellular proliferation [34,190,354]; Induces TGF-beta expression [190,355]; Negative regulator MIEP [356]; Critical for replication [357]; Downregulates p53 activation [358]; Promiscuous transcriptional activator [359,360]; Regulates macrophage-mediated immune escape [361] | Cell proliferation [34] Immune evasion [361] |
| UL123 (IE1) | Immediate early transactivator (IE1); enhances activation by IE2; indirect effect on transcription machinery; disrupts ND10 [38]; Dysregulation of cyclin E expression; activation of telomerase; induction of IL-1; inhibition of apoptosis; induction of chromosomal aberrations [190]; Induces cells into S phase, alters cell cycle, conducive to proliferation [34,190]; Suppresses p53 and Rb activity, PI3K/AKT activation, induces cellular proliferation [33,190]; Limits nucleosome load, facilitates nucleosome reorganization, targets chromosomes [362,363]; Antagonize histone acetylation, facilitates viral replication [364]; Inhibits IFN-dependent STAT signaling [365,366,367]; Disruption of the dot-like structure of PML-NBs [368] | Cell cycle stimulation, cell proliferation [34,190] Immune evasion [365] |
| UL124 | Unknown | Unknown |
| UL125 | Unknown | Unknown |
| UL126A | Unknown | Unknown |
| UL127 | No transcription [369,370,371,372] | Unknown |
| UL128 | Chemokine analogue [373]; Induces cell PBMC proliferation and inflammation [32,374,375]; Viral entry and assembly, regulation of actin cytoskeleton [376]; Triggers monocyte paralysis, monocyte infection, blocks migration [377]; gH/gL/UL128-131 complex, promotes entry into cells, broadens virus tropism [214,378,379] | Cell proliferation, Induces inflammation [374] Cell migration [377] Cell tropism [380] |
| UL129 | Unknown | Unknown |
| UL130 | Viral entry and assembly [376]; gH/gL/UL128-131 complex, promotes entry into cells, broadens virus tropism [214,378,379]; pUL130 and Snapin interact to modulate DNA synthesis [381]; Cell tropism, promotes EC infection [382,383] | Cell tropism [382,383] |
| UL131A | Viral entry and assembly [376]; gH/gL/UL128-131 complex, promotes entry into cells, broadens virus tropism [214,378,379]; Important for endothelial cells tropism [384]; Virus entry and virus exit [385] | Cell tropism [384] |
| UL132 | Regulates infectious virus production [386]; Viral glycoprotein, important for viral replication [387] | Unknown |
| UL148 | Endoplasmic reticulum (ER)-resident glycoprotein, interacts with SEL1L [388,389]; Activates unfolded protein response [389]; ER reorganization, downmodulation of CD58, inhibits NK and T cell function [376,390,391,392]; Influences cell tropism by regulating gH/gL complex composition [393] | Cell tropism [392,393] Immune evasion [390,391] |
| UL147A | Downregulates MICA*008 to evade NK cell-mediated killing [394] | Immune evasion [394] |
| UL147 | Ablate activity [376]; Viral CXC chemokine-2 (vCXCL2) [395,396,397] | Unknown |
| UL146 | Ablate activity [376]; Viral CXC chemokine-1 (vCXCL1), induces calcium mobilization, chemotaxis, and degranulation of neutrophils [395,398]; Attracts neutrophils, influences viral dissemination [397,399] | Unknown |
| UL145 | Constitutes vDCAF, impedes antiviral immunity [400] | Immune evasion [400] |
| UL144 | Tumor necrosis factor-alpha (TNF-α) receptor [179,401]; Binds BTLA, inhibits T cell proliferation [37]; A potent NF-κB activator, evades immune surveillance [402,403]; HVEM orthologue, binds to B and T cell lymphocyte attenuator [404] | Anti-cell proliferation [37] Immune evasion [402,403] |
| UL142 | Suppresses NK cell activation, inhibits NK cell killing [136,376,405]; Interferes with surface expression of full-length MICA alleles [406,407]; Interacts with Snapin [408]; Downregulates ULBP3, protects cells from NK cytotoxicity [409] | Immune evasion [406,407,409]; |
| UL141 | Regulates NK cell function (via TRAIL/CD155/CD112/ADCC) [47,136,376,410,411,412,413,414]; Interacts with CELF5, affects viral DNA replication [415] | Immune evasion [47,136,376,410,411,412,413,414] |
| UL140 | Unknown | Unknown |
| UL139 | Homologous to CD24, potential immunomodulatory role [416,417] | Unknown |
| UL138 | Enhances modulation of TNF signaling [418,419]; Silences IE1 transcription, promotes viral latency [420,421,422,423]; Induces GC cells apoptosis by binding to HSP70 [424]; Modulation of EGFR signaling feeds back, represses virus replication [425,426,427]; Inhibits STING Pathway and reduces IFN-beta mRNA accumulation [428]; Interacts with USP1 activates STAT1 [429] | Cell apoptosis [424] Immune evasion [428] |
| UL136 | Balances virus replication and latency [427,430,431]; Interacts with ATP1B1 [432]; Secondary envelopment and egress [433]; Golgi localization [434]; Postentry tropism in Endothelial Cells [435]; Regulates IL6/STAT3 pathway [436] | Cell tropism [435] |
| UL135 | Postentry tropism in endothelial cells [435]; Suppresses formation of immunological synapse [65,437]; Promotes viral gene expression [438]; Regulates EGFR and reactivation [427,439,440] | Immune evasion [65,437]; |
| UL133 | Establishes latency, suppresses viral replication during latency [427,441,442] | Unknown |
| UL148A | Downregulates MICA to avoid NK cell attack [65,443] | Immune evasion [65,443] |
| UL148B | Unknown | Unknown |
| UL148C | Unknown | Unknown |
| UL148D | Unknown | Unknown |
| UL150 | Unknown | Unknown |
| UL150A | Unknown | Unknown |
| IRS1 | IE transcriptional activator [38,444]; Blocks shut down of translation [38,445]; Antagonizes PKR, facilitates virus replication [446,447]; Competitively associates with UL44 [448]; Causes AKT to remain active during infection [449] | Immune evasion [445] |
| US2 | Prevents recognition by CD4 T cells [450]; Degradation of MHC-I, escapes recognition by T lymphocytes [451,452,453,454]; Interacts with hCD1d and downregulates iNKT cell activity [455]; Evades MHC- II antigen presentation [456] | Immune evasion [451,452,453,454] |
| US3 | Degradation of MHC-I, evades MHC-II antigen presentation [456,457,458,459,460,461,462] | Immune evasion [456,457,458,459,460,461,462] |
| US6 | Inhibits peptide translocation by TAP, degradation of MHC-I [461,463,464,465] | Immune evasion [461,463,464,465] |
| US7 | US7 is modulated by miRNA [466]; Antagonize innate immunity by targeting TLR signaling [467] | Immune evasion [467] |
| US8 | Antagonize innate immunity by targeting TLR signaling [467]; Binds MHC-I heavy chains [468] | Unknown |
| US9 | Promotes cell-to-cell transmission [469]; Targets MICA*008 to escape NKG2D-mediated attack by NK cells [467,470]; Targets MAVS and STING signaling to evade innate antiviral response [471] | Immune evasion [467,470,471] |
| US10 | NK cell activation [467]; Binds to MHC class I HC, delays MHC class I trafficking [472]; Degrades HLA-G to interfere with NK cell inhibition [473] | Unknown |
| US11 | Suppresses MHC I-restricted recognition [451]; Degrades MHC-I, induce class I heavy chain destruction [474,475,476,477,478]; Escapes CD8+ T-cell immunity by degrading HLA-A and manipulating the HLA-B [479] | Immune evasion [451,474,475,476,477,478,479] |
| US12 | NK cell evasion [480]; Induces autophagy via upregulating ULK1 phosphorylation and LC3-II conversion [481] | Immune evasion [480] Induces autophagy [481] |
| US13 | Unknown | Unknown |
| US14 | NK cell evasion function [480] | Immune evasion [480] |
| US15 | Unknown | Unknown |
| US16 | Virus tropism factor, regulates replication cycle [482,483,484] | Cell tropism [482,483,484] |
| US17 | Control of virion composition to elicit a balanced host immune response [485] | Immune response [485] |
| US18 | Putative transmembrane protein [486]; Downregulates B7-H6 surface expression to escape NK cell attack [480,487]; Promotes MICA degradation by lysosomal degradation [488] | Immune evasion [480,487,488] |
| US19 | Putative transmembrane protein [486] | Unknown |
| US20 | Putative transmembrane protein [486]; Downregulates B7-H6 surface expression to escape NK cell attack [480,487]; Promotes MICA degradation by lysosomal degradation [488]; Endotheliotropism, staged sustain replication cycle [489] | Immune evasion [480,487,488] Cell tropism [489] |
| US21 | TMBIM-derived viroporin, modulates calcium homeostasis, protects cells against apoptosis [490] | Anti-apoptosis [490] |
| US22 | Unknown | Unknown |
| US23 | Unknown | Unknown |
| US24 | Important for IE gene expression in replication cycle [491] | Unknown |
| US25 | Unknown | Unknown |
| US26 | Unknown | Unknown |
| US27 | Chemokine receptor-like protein [103,492]; GPCR homologues, efficient spread by extracellular route [493]; Enhances the CXCL12/CXCR4 signaling axis [327,494,495,496,497,498]; Enhances cell proliferation [498,499] | Chemokine receptor [103] Immune evasion [494,496] Cell proliferation [498,499] |
| US28 | Induces ADCC, immune evasion [47]; Chemokine receptor-like protein [103]; Mediated activation of NFκB and MIEP [228,500]; Promotes angiogenesis and tumor formation, oncomodulatory properties [501,502,503,504,505]; Promotes cell migration, fusion and viral dissemination, maintains latency [506,507,508,509]; Interacts with chemokines: CX3C and IL-8 [508,510] | Immune evasion [47] Chemokine receptor [103] |
| US29 | Unknown | Unknown |
| US30 | Unknown | Unknown |
| US31 | Induces NF-κB-mediated mono-macrophage inflammation [511]; Activates immune response and regulates tumor immune microenvironment [512] | Induces inflammation [511,512] |
| US32 | Unknown | Unknown |
| US33 | Unknown | Unknown |
| US33A | Unknown | Unknown |
| US34 | Unknown | Unknown |
| US34A | Unknown | Unknown |
| TRS1 | Blocks shut down of translation [38,445]; Competitively binds UL44 [448]; Inhibit PKR activity, stimulates translation and replication [28,446,447,513,514]; Produces DNA-filled C-capsids, nuclear reorganization [515]; Inhibition autophagy [516] | Immune evasion [445] Inhibition autophagy [516] |
| LncRNA | Start | End | Length (bp) | Importance |
|---|---|---|---|---|
| RNA2.7 | 2218 | 4695 | 2477 | Essential |
| RNA1.2 | 6368 | 7393 | 1025 | Essential |
| RNA4.9 | 93,570 | 98,453 | 4883 | Essential |
| RNA5.0 | 155,268 | 155,580 | 312 | Essential |
| RNA5.0 | 160,112 | 160,944 | 832 | Dispensable |
| HAN (KJ426589.1) | TB40E (KF297339.1) | Identity % | Alignment Length | Expectation Value |
|---|---|---|---|---|
| 109,182|109,698 | 109,233|109,749 | 95 | 60 | 3.19 × 10−23 |
| 120,844|121,567 | 120,875|121,598 | 96.667 | 60 | 6.86 × 10−25 |
| 163,444|163,728 | 163,469|163,753 | 100 | 60 | 3.17 × 10−28 |
| 188,995|189,549 | 188,940|189,494 | 95 | 60 | 3.19 × 10−23 |
| 45,501|228,554 | 45,541|230,304 | 96.667 | 60 | 6.86 × 10−25 |
| 76,846|194,612 | 76,885|194,534 | 95 | 60 | 3.19 × 10−23 |
| 76,846|228,554 | 76,885|230,304 | 100 | 60 | 3.17 × 10−28 |
| 96,219|96,761 | 96,246|96,785 | 98.333 | 60 | 1.47 × 10−26 |
| 135,586|139,474 | 135,607|139,496 | 98.276 | 58 | 1.91 × 10−25 |
| 135,586|142,000 | 135,607|142,028 | 96.552 | 58 | 8.87 × 10−24 |
| 111,439|113,455 | 111,490|111,700 | 92.683 | 41 | 4.19 × 10−12 |
| 55,623|56,174 | 55,397|56,212 | 92.683 | 41 | 4.19 × 10−12 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeng, J.; Cao, D.; Yang, S.; Jaijyan, D.K.; Liu, X.; Wu, S.; Cruz-Cosme, R.; Tang, Q.; Zhu, H. Insights into the Transcriptome of Human Cytomegalovirus: A Comprehensive Review. Viruses 2023, 15, 1703. https://doi.org/10.3390/v15081703
Zeng J, Cao D, Yang S, Jaijyan DK, Liu X, Wu S, Cruz-Cosme R, Tang Q, Zhu H. Insights into the Transcriptome of Human Cytomegalovirus: A Comprehensive Review. Viruses. 2023; 15(8):1703. https://doi.org/10.3390/v15081703
Chicago/Turabian StyleZeng, Janine, Di Cao, Shaomin Yang, Dabbu Kumar Jaijyan, Xiaolian Liu, Songbin Wu, Ruth Cruz-Cosme, Qiyi Tang, and Hua Zhu. 2023. "Insights into the Transcriptome of Human Cytomegalovirus: A Comprehensive Review" Viruses 15, no. 8: 1703. https://doi.org/10.3390/v15081703
APA StyleZeng, J., Cao, D., Yang, S., Jaijyan, D. K., Liu, X., Wu, S., Cruz-Cosme, R., Tang, Q., & Zhu, H. (2023). Insights into the Transcriptome of Human Cytomegalovirus: A Comprehensive Review. Viruses, 15(8), 1703. https://doi.org/10.3390/v15081703

