Next Article in Journal
A Systematic Review of Uremic Toxin Concentrations and Cardiovascular Risk Markers in Pediatric Chronic Kidney Disease
Next Article in Special Issue
Future of Uremic Toxin Management
Previous Article in Journal
Adverse Effects of Intravesical OnabotulinumtoxinA Injection in Patients with Idiopathic Overactive Bladder or Neurogenic Detrusor Overactivity: A Systematic Review and Meta-Analysis of Randomized Controlled Studies
Previous Article in Special Issue
Qualitative Profiling of Venom Toxins in the Venoms of Several Bothrops Species Using High-Throughput Venomics and Coagulation Bioassaying
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Modulation of Growth and Mycotoxigenic Potential of Pineapple Fruitlet Core Rot Pathogens during In Vitro Interactions

1
CIRAD, UMR Qualisud, F-97410 Saint-Pierre, Réunion, France
2
Qualisud, Univ Montpellier, Avignon Université, CIRAD, Institut Agro, IRD, Université de La Réunion, Montpellier, France
3
CIRAD, UMR Qualisud, F-34398 Montpellier, France
*
Author to whom correspondence should be addressed.
Toxins 2024, 16(8), 344; https://doi.org/10.3390/toxins16080344
Submission received: 9 July 2024 / Revised: 3 August 2024 / Accepted: 5 August 2024 / Published: 7 August 2024
(This article belongs to the Special Issue Toxins: 15th Anniversary)

Abstract

Pineapple Fruitlet Core Rot (FCR) is a fungal disease characterized by a multi-pathogen pathosystem. Recently, Fusarium proliferatum, Fusarium oxysporum, and Talaromyces stollii joined the set of FCR pathogens until then exclusively attributed to Fusarium ananatum. The particularity of FCR relies on the presence of healthy and diseased fruitlets within the same infructescence. The mycobiomes associated with these two types of tissues suggested that disease occurrence might be triggered by or linked to an ecological chemical communication-promoting pathogen(s) development within the fungal community. Interactions between the four recently identified pathogens were deciphered by in vitro pairwise co-culture bioassays. Both fungal growth and mycotoxin production patterns were monitored for 10 days. Results evidenced that Talaromyces stollii was the main fungal antagonist of Fusarium species, reducing by 22% the growth of Fusarium proliferatum. A collapse of beauvericin content was observed when FCR pathogens were cross-challenged while fumonisin concentrations were increased by up to 7-fold. Antagonism between Fusarium species and Talaromyces stollii was supported by the diffusion of a red pigmentation and droplets of red exudate at the mycelium surface. This study revealed that secondary metabolites could shape the fungal pathogenic community of a pineapple fruitlet and contribute to virulence promoting FCR establishment.
Key Contribution: Fusarium ananatum, Fusarium proliferatum, Fusarium oxysporum, and Talaromyces stollii constitute the fungal pathogenic cortege inducing Pineapple Fruitlet Core Rot. Talaromyces stollii was a strong antagonist of Fusarium spp. Confrontations between pathogens regulate their mycotoxin production as exemplified by a reduction in beauvericin production and an increase in fumonisins by Fusarium spp.

1. Introduction

Pineapple Fruitlet Core Rot (FCR) is a major issue in the export market, causing severe fruit quality depreciation [1]. The particularity of the FCR pathosystem is that healthy and diseased fruitlets coexist in the same pineapple fruit with no external symptoms. For several years, FCR was studied considering Fusarium ananatum as the main causal agent even though other species, Fusarium proliferatum, Fusarium oxysporum, and Talaromyces stollii, were identified in both healthy and infected fruitlets [2,3,4]. The pathogen(s) benefit from pineapple sugar accumulation and in some cases, successfully counter host defenses, leading to fruitlet flesh browning, a so-called ‘black spot’ [5]. Recently, F. proliferatum, F. oxysporum, and T. stollii were found to induce similar symptoms to those caused by the infection of F. ananatum, thereby confirming their implication in the FCR pathosystem [6]. The mycobiomes of healthy and diseased fruitlets contain the four FCR pathogens as the most abundant fungal species, suggesting that pathogenesis does not rely solely on fruitlet contamination. Additionally, in planta studies of FCR pathogens found significant changes in fungal community structure that are induced following inoculation with the pathogenic Fusarium spp. [6]. This requires a transition from an endophytic to a pathogenic behavior related to the increase in fungal biomass in the host tissues.
In plant diseases, strains of F. proliferatum and F. oxysporum species are widely studied for their ability to produce mycotoxins, which are harmful to human health [7,8,9,10,11]. The biohazard of these compounds led to the establishment of maximum levels in food and feed products by the European Food Safety Authority (EFSA) [12]. Considering FCR incidence across several pineapple production countries, isolates of Fusarium species obtained from FCR-diseased fruits were identified as producers of fumonisin B1 (FB1), fumonisin B2 (FB2), fumonisin B3 (FB3), moniliformin (MON), and beauvericin (BEA) under in vitro culture conditions [13]. Thereafter, FB1 and BEA were measured at higher concentrations in naturally diseased or Fusarium-inoculated fruitlets when compared to healthy fruitlets, suggesting that these toxins could be implicated in FCR fungal virulence [14]. In pineapple, pre- and post-harvest conditions are defined as influent parameters for both FCR pathogenesis and the introduction of mycotoxins in the food chains [6,15,16,17]. In fruit production and processing schemes, the main safety issues related to mycotoxins are patulin, ochratoxin A, aflatoxins, and Alternaria toxins [18,19]. For example, Penicillium expansum causes the blue mold disease in apples and pears and is an important producer of patulin, leading to the contamination of fruit and their co-products (juices, mash, and freshly cut) [20,21,22].
In plant–pathogen dialogs, some mycotoxins are suspected to play a role in the modulation of defense signals transduced in the host [23]. For example, the deletion of the Fusarium verticillioides SET1 gene reduced growth and fumonisin accumulation and limited the colonization process of the pathogen in maize stalks and kernels [24]. A F. verticillioides FUG1 (Fungal Unknown Gene 1) deletion mutant produced fewer microconidia and no macroconidia. Following inoculation on kernels, FUG1 mutants did not produce FB1 but produced more FB2 than in the wild type [25]. These studies demonstrated that toxins could support fungal virulence and the bypass of plant defenses [26].
Plant microbiomes are being explored to gain insight into the structure and function of microbial communities [27]. Previous studies on microbial interactions implicate fungal secondary metabolites as defense against other microorganisms [28,29,30]. Specifically, mycotoxins may have a role during interspecific competition related to the colonization of a habitat [31]. These interactions can be based on an exploitation competition, which is characterized by an extensive use of resources by one of the competing species and thereby limiting nutrient availability for competitors [32,33]. Alternatively, interference competition could occur if a competitor inhibits the growth and the spread of the competing species by the secretion of antibiotic metabolites in a given space [34,35]. Some microbial species are known to interact with or antagonize Fusarium species. These interactions modulate Fusarium toxin accumulation in host cellular compartments and decrease fungal virulence. For example, bacterial species such as Pseudomonas fluorescens can degrade and detoxify deoxynivalenol (DON) excreted by Fusarium culmorum [36]. Interestingly, fungi can also display similar behaviors, such as Fusarium culmorum and Alternaria tenuissima. Dual confrontations on wheat kernels showed A. tenuissima toxin production reduced to less than 5% while the biosynthesis of DON and zearalenone (ZEA) by F. culmorum increased 11- and 36-fold, respectively [37]. In vitro co-culture of Fusarium graminearum and Aspergillus ochraceus led to more accumulation of DON and ZEA during the early stages of interaction than observed in unchallenged cultures of F. graminearum [38]. Given their broad host range, Fusarium species can also interact with each other within a microbial community. For example, under in vitro conditions, Fusarium poae reduced the fumonisin production of F. proliferatum by more than 95% [39]. Similarly, Fusarium temperatum decreased to 32% the content of fumonisins accumulated by F. verticillioides. Beauvericin is considered a virulence factor for plants and is a growth inhibitor for the endophyte Paraconiothyrium variabile [40]. However, when interacting with F. oxysporum, P. variabile can metabolize beauvericin produced by F. oxysporum to protect its ecological niche [41]. These inter- and intra-species interactions emphasize the importance of considering fungi secondary metabolite production in the structure of microbial networks and the role of toxins in the pathogenesis [42].
The objective of the present study was to generate data on the behavior of interacting FCR pathogens under in vitro co-culture bioassays based on the hypothesis that a specific structure of the fungal–pathogenic community may favor FCR establishment. First, changes in fungal growth were monitored and the corresponding growth inhibition profiles were defined. Second, we characterized the influence of cross-challenged FCR pathogens on mycotoxin accumulation for 10 days. The data provide new insights into the microbial communication that may directly influence the occurrence of FCR disease and mycotoxin content in pineapple.

2. Results

2.1. Dynamic Evolution of Fungal Colonies

On Reunion Island, F. ananatum, F. proliferatum, F. oxysporum, and T. stollii were identified in diseased pineapple tissues and characterized as prevalent species of the fruit-associated mycobiome. Their ability to promote black spot symptoms was confirmed and all four fungal species are considered as FCR pathogens [6,43]. Searching for microbial interactions and chemical communication as potential drivers of the FCR pathogenic mycobiome (pathobiome) structure, one isolated strain of each species previously validated for Koch’s postulates was selected for co-culture bioassays [6,14].
According to single-conidia purification and molecular characterization, sequencing confirmed the identity of BP429 as F. proliferatum, BP369 as F. oxysporum, and BP462 as T. stollii, respectively, based on the targeted reference regions (Table S1).
Thereafter, both single and co-cultures were monitored at five time points to detect changes in mycelial growth and coloration. In single cultures, all studied Fusarium species showed a white mycelium after 2 days of incubation. From day 4, fungal colonies harbored pigmentation ranging from salmon pink (F. ananatum) to violet (F. oxysporum) and beige (F. proliferatum) on a PDA medium (Figure 1A–C and Figure S1A–C). F. oxysporum and F. proliferatum produced aerial mycelia, while F. ananatum was characterized by a short and dense mycelium. From this time on, no phenotypic variation was noticed until the end of the monitoring. Moreover, Fusarium species covered the entire surface of the wells within 6 days of incubation (Figure 1A–C). T. stollii showed a spotted white and light green colored mycelium at day 2 (Figure 1D and Figure S1D). T. stollii fully colonized the medium surface after 6 days of incubation, similarly to the Fusarium species. These colonies had a short and powdery dark green mycelium. Important changes in mycelial morphotypes were observed with the co-cultivation of the FCR pathogens. Following the culture of cross-challenged pathogenic Fusarium spp., the contact between mycelia was reported on day 4 and hyphae aerial profiles remained unchanged for the entire incubation period of F. ananatum versus F. proliferatum, F. oxysporum versus F. proliferatum, and F. ananatum versus F. oxysporum interaction conditions (Figure 1E–G and Figure S1E–G). Colony growth morphologies were similar to the single cultures of the corresponding species (Figure 1A–C,E–G and Figure S1A–C,E–G).
The most visible changes during co-culture evolution were observed between Fusarium spp. and T. stollii (Figure 1H–J). Growth antagonism was reported for all pairwise interactions combining T. stollii and Fusarium species. A zone line characterized by appearance of a red pigmentation occurred at the mycelial contact area for each pathogenic Fusarium spp. in the presence of T. stollii at day 4 and 6. At the subsequent time points, the intense red pigmentation spread all over the growth surface. In these conditions and from day 8, the F. proliferatum colony surface accumulated droplets of red exudate (Figure 1J). Co-culture of F. ananatum and T. stollii also led to the appearance of a red pigment. However, this was the only species combination with an inhibition zone line from day 4 to the end of the monitoring (Figure 1H). Finally, the red pigmentation highlighted over the set of FusariumTalaromyces co-cultures was localized and highly intense in the bottom side of the Fusarium colonies as shown in Figure S1 (Figure S1H–J).

2.2. Influence of FCR Pathogen Co-Cultivation on Growth and Inhibition Patterns

Growth profiles of isolate strains were monitored over 10 days to track substrate prospection in single or co-cultures, and then define the associated inhibition rates. In single cultures, all four species grew rapidly until day 4 (Figure 2A–D). At day 6, the plate surface was completely colonized and slower growth was then observed until day 10. In co-cultures, the initial rapid growth phase occurred until day 6 for all experimental conditions. The data are consistent with antagonistic interactions in co-cultures of Fusarium spp. and T. stollii. Actually, T. stollii was the prevalent competitor with average inhibition ratios of 5%, 8%, and 22% against F. ananatum, F. oxysporum, and F. proliferatum, respectively (Figure 2E–G).
T. stollii had a high inhibition effect on the growth of F. oxysporum as compared to F. ananatum (p = 0.004) or F. proliferatum (p < 0.001; Figure 2F). The growth of F. proliferatum was also significantly reduced by T. stollii compared to co-cultures with F. ananatum (p < 0.001) and F. oxysporum (p < 0.001; Figure 2G). Interestingly, no significant difference was observed between inhibition potentials of F. proliferatum, F. oxysporum, and T. stollii on the mycelial growth of F. ananatum. Thus, all FusariumFusarium co-cultures resulted in the equal occupation of the wells corresponding to half the surface (area of 1.57 cm2), indicating a low if not absent inhibition effect or competition (gray dashed line on Figure 2A–C). In contrast with the other Fusarium species, F. ananatum presented a slight, but significant, reduction in T. stollii growth with an inhibition by about 2% of the medium coverage compared to co-cultures with F. oxysporum (p = 0.02) and F. proliferatum (p = 0.02) (Figure 2H).

2.3. Modulation of Mycotoxin Production during Co-Culture Bioassays

The Fusarium strains used in this study present contrasting toxigenic patterns in single cultures. In the sample set corresponding to F. ananatum, BEA was the only mycotoxin detected with a consistent maximum average concentration (av. ± sd) of 19,623 ± 7712 µg kg−1 recorded at day 8 (Figure 3A and Figure 4A,B). Similarly, F. oxysporum exclusively produced BEA quantified at its highest amount at 15,815 ± 4962 µg kg−1 at day 10 (Figure 3B and Figure 4A,C). The tested strain of F. proliferatum is a consistent producer of BEA with a peak of production at 10,998 ± 7741 µg kg−1 after 4 days of incubation. However, its biosynthesis patterns of FB1 and FB2 were slightly pronounced and correspond at their maximum to 171 ± 127 and 14 ± 11 µg kg−1, respectively (Figure 3C and Figure 4B,C). No toxins were identified or quantified from T. stollii single cultures even after 10 days of incubation (Figure 3A–C).
When compared to the single culture of F. ananatum (5173 ± 1384 µg kg−1), the co-culture of F. ananatum and T. stollii (28 ± 5 µg kg−1) significantly reduced the synthesis of BEA by 99.5% after 6 days of incubation (p < 0.001, Figure 3A). During the confrontation between F. oxysporum and T. stollii (8741 ± 1463 µg kg−1), the most significant change was also recorded at day 6 with a 2-fold increase in the BEA amount when compared to the F. oxysporum control condition (3945 ± 2260 µg kg−1, p = 0.02, Figure 3B). Across F. proliferatum versus T. stollii, BEA concentrations were significantly reduced when compared to the single culture of F. proliferatum. Indeed, BEA concentrations were close to the limit of detection (LOD) and limit of quantification (LOQ) (Figure 3C). Interestingly, the confrontation with T. stollii significantly raised both FB1 and FB2 productions by F. proliferatum. The most significant differences occurred at day 6 with a 5- and 7-fold increase in FB1 (p < 0.001) and FB2 (p < 0.001) concentrations in F. proliferatum versus T. stollii (FB1 = 890 ± 48 µg kg−1, FB2 = 95 ± 16 µg kg−1) when compared to the F. proliferatum single culture, respectively (FB1 = 167 ± 125 µg kg−1, FB2 = 14 ± 11 µg kg−1). Interestingly, this is the sole fungal confrontation for which, over several time points, significantly higher Fusarium toxin concentrations occurred by comparison to the production in single cultures.
Interactions between Fusarium–FCR pathogen species also regulated mycotoxin content. At day 8, F. proliferatum versus F. ananatum co-culture (FB1 = 404 ± 48 µg kg−1, FB2 = 46 ± 6 µg kg−1) exhibited a 5- (p < 0.001) and 7-fold increase (p < 0.001) in FB1 and FB2 concentration in comparison to the F. proliferatum single culture (FB1 = 79 ± 61 µg kg−1, FB2 = 6 ± 5 µg kg−1, Figure 4B). By contrast, during this confrontation, the BEA amount dropped by 94%, 98%, and 97% at day 6, 8, and 10, respectively, according to the production recorded for the F. ananatum control condition (p ≤ 0.007). At day 2 of the F. ananatum versus F. oxysporum confrontation, an increase by 73% of BEA content was recorded (1327 ± 86 µg kg−1) against 767 ± 300 µg kg−1 synthetized by F. ananatum in the single culture (p = 0.01, Figure 4A). The subsequent time points demonstrated no significant change in BEA production for this co-culture condition. Finally, the interaction between F. oxysporum and F. proliferatum showed no significant differences in toxin production over the 10-day monitoring compared to the corresponding single cultures (Figure 4C).

3. Discussion

Exploring microbial interactions is crucial for the definition of the host–pathogens dialog especially in a multi-partite pathosystem such as pineapple FCR. Previously, species belonging to the Fusarium fujikuroi (FFSC) [44] and Talaromyces purpureogenus species complexes [45] as well as F. oxysporum were identified as the main risk of FCR occurrence in pineapple. Considering the relative abundance of species that composed the mycobiomes of healthy and diseased fruitlets, T. stollii corresponded to the third most frequent species, F. proliferatum and F. ananatum being the most abundant. T. stollii occurrence was 2-fold higher in diseased tissues than in healthy ones [6]. Thus, specific structure(s) of the pathobiome were hypothesized to determine the balance between healthy and diseased pineapple fruitlets. Considering the known toxinogenicity of Fusarium species, the impact of such interactions on the mycotoxin production in pineapple needed to be investigated to estimate potential consumer health problems.
The approach by co-culture of fungal pathogens highlighted important changes in the evolution of mycelial growth. First, the growth curves and the relative inhibition ratios show that T. stollii is a major competitor of Fusarium species in the FCR complex, with the highest inhibitory effect on the growth and colonization of the three Fusarium species assayed. In fact, similar antagonistic patterns were observed following the challenged cultivation of F. proliferatum and F. oxysporum with T. stollii, suggesting an interference competition beneficial to T. stollii. By comparison, the co-cultivation of F. ananatum and T. stollii differs with the presence of an inhibition zone as previously defined by Bertrand et al. [46]. Growth patterns showed that F. ananatum partially limited the colonization of the culture medium surface by T. stollii. This is the only Fusarium species that, although being inhibited, succeeded in challenging T. stollii. The underlying mechanism remains to be elucidated.
These results are consistent with those of Losada et al., which demonstrated that secondary metabolites are critical determinants of fungal competitive fitness [47]. Interestingly, the main growth inhibition ratio obtained from T. stollii is used against F. proliferatum, which was previously described as the most abundant species in relation to the proximal environment of pineapple plots [6]. The confrontation patterns facilitate the exploitation of resources from an artificial medium by T. stollii and suggested that its biomass may be highly abundant in the blossom cup of fruitlets. Fusarium species would then be restricted in host tissues in the form of conidia but remain detectable by classical microbiological approaches. Potential strategies of germination inhibition or mycelial proliferation delays still need to be elucidated. These antagonistic interactions are associated with a red pigmentation that could result from a pigment secretion. Particularly, when Fusarium species were confronted with T. stollii, the appearance of a red pigment was noticeable from day 4. Across the single cultures of the four species assayed, only a spotted red pigmentation was observed from the bottom of T. stollii wells (Figure S1D). This suggests that the expansion of a red coloration specifically resulted from the antagonistic interaction between Fusarium spp. and T. stollii. Fungi are widely known for their ability to produce bioactive compounds that support an interconnecting microbial network within an ecological niche [48,49]. Amongst the diverse secondary metabolites accumulated by fungi, some pigments were described for having antimicrobial, antifungal, antiviral, and other biological activities [50]. Although T. stollii was not previously studied in confrontation procedures, data are available for other Talaromyces species such as T. purpureogenus and T. amestolkiae, producing and diffusing red azaphilone polyketide pigments (‘Monascus pigments’) [51]. Alternatively, in vitro cultures of F. fujikuroi, F. proliferatum, and F. oxysporum can be associated with the excretion of pigments such as bikaverin, also defined as a mycotoxin [52,53,54]. Fusarium species are also major producers of secondary red-colored metabolites such as bostrycoidin, norjavanicin, and 8-O-methylfusarubin under conditions of environmental stress [55,56]. Thus, under antagonistic conditions, FCR pathogens, Fusarium species, could produce red pigments to manage their competitors. This conclusion is consistent with the study of Son et al., which demonstrated the efficient biocontrol activity of bikaverin and fusaric acid produced by F. oxysporum upon growth and development of Phytophtora infestans [57]. The red exudate on the mycelial surface of F. proliferatum after 8 days of co-cultivation with T. stollii could assign the red pigment biosynthesis to Fusarium species. In spite of the multiple mycotoxin standards used in this study (see Section Standard Solution), this specific secondary metabolite was not identified. This would help in defining the ecological balance between interference and exploitative competition [32,33,34,35]. This red exudate could also support an active detoxification of mycelium to reduce toxicity of reaction products released from the metabolization of compounds from the antagonist [58]. Therefore, we cannot conclude that this compound has a key role in the pathobiome structure and de facto in the occurrence of FCR. This still remains to be elucidated.
FB1, FB2, and BEA were the only identifiable and quantifiable mycotoxin compounds in our samples. In accordance with previous studies, the Fusarium strains isolated from diseased pineapple grown in Reunion Island can produce FB1, FB2, and BEA. Although not included in the set of mycotoxins searched for this study, the excretion of fumonisin B3 and moniliformin by pineapple-associated Fusarium spp. is also reported describing the wide toxigenic spectrum of these species [13,14,59,60]. Therefore, screening of FB3 and MON seems necessary for future studies on this ecological context. The combination of all studies demonstrate that pineapple fruit constitutes a paradigm to study Fusarium toxins contaminating fresh fruits. Mycotoxin risks associated with Fusarium species are mainly reported for cereals with less data focusing on fruit and vegetable productions. The study of FCR pathogen toxigenicity across in vitro confrontation demonstrated that the patterns of fumonisins and beauvericin production were drastically affected by fungal pairwise interactions. While the BEA content dropped in three of the six co-culture conditions tested, FB1 and FB2 produced by F. proliferatum rose significantly when challenged by T. stollii or F. ananatum. This increase highlighted that the chemical dialog is species-dependent [61]. Future studies are needed to determine whether the drop in beauvericin contents in species interactions results from a lack of biosynthesis or a detoxification process as reported for competition between Paraconiothyrium variabile and F. oxysporum [30]. Interestingly, most of the significant changes in mycotoxin concentrations occurred after six (or eight) days of interaction. This timing is consistent with the growth profiles observed in single cultures where the studied species fully colonized the medium surface within 6 days. Thus, fungal species development appeared to be regulated by the competitor. This was already observed in Aspergillus fumigatus for which the switch from vegetative growth to conidiation is regulated by phenazine-derived metabolites from Pseudomonas aeruginosa [62].
In the present study, we showed that T. stollii can compete with Fusarium species by reducing their growth and/or toxin production. These results are consistent with those of Camardo Leggieri et al., who found that the in vitro co-cultivation of F. verticillioides and Aspergillus flavus resulted in significant reductions in colony diameter. Moreover, the production of aflatoxin B1 and fumonisins B1 and B2 was significantly affected by culture conditions (single or dual) and the temperature of incubation [63]. Since mycotoxins can be considered in some cases as virulence factors, such changes could decrease the pathogenicity of F. proliferatum, F. ananatum, and F. oxysporum, thus enabling pineapple infection escape. Similarly, the co-culture of F. verticillioides with Ustilago maydis resulted in the secretion of fusaric acid by F. verticillioides that inhibited the growth of U. maydis and significantly decreased Corn Smut disease symptoms [64,65,66]. The molecular and biochemical mechanisms that characterize the FCR pathosystem also depend on the biomass of each protagonist. Thus, a low amount of T. stollii biomass may result in only the weak inhibition of Fusarium species. As a consequence, host tissues are colonized together with an increase in BEA accumulation by F. ananatum, F. proliferatum, and/or F. oxysporum. If toxins act as virulence factors, they could promote host susceptibility and disease expression [67]. Such a hypothesis is consistent with the levels of FB1 and BEA being higher in infected fruitlets than in healthy ones [14]. Fumonisins can act as a systemic signal with the accumulation of FB1 in maize leaf during root colonization by F. verticillioides [68]. Spatial and temporal patterns of pathogen species contamination are also important. Fungal spread is defined by landscape contextualization (i.e., configuration of host in its environment, proximal crops) and meteorological factors (i.e., wind, temperatures, and hygrometry) resulting in asynchronous species dispersions [69,70]. Environmental factors are also crucial, determining both plant resistance and fungal growth and virulence [71]. Thus, FCR occurrence could be supported by a specific temporal sequence of contamination. This sequence of fungal progression in the blossom cup probably determines, through the modulation of pathogen interactions, the growth of fungal biomass and defines the future pineapple resistance or susceptibility. This process was previously proposed for Gibberella and Fusarium ear rots of maize by demonstrating that infection partly relied on the combination of competitive and facilitative interactions between F. graminearum and F. verticillioides pathogens [72]. Moreover, Fusarium pathogens are well known for their ability to spread over fruit crops via irrigation water or wind [73,74]. Thus, initial contamination by one of the Fusarium species could result in elevated amounts of mycotoxins and, once again, in the susceptibility of pineapple fruit to FCR disease. Environmental conditions may significantly influence mycotoxigenic potentials of FCR pathogens especially in Reunion Island where production areas of the ‘Queen Victoria’ pineapple cultivar are characterized by an important diversity of microclimates [17]. Actually, pineapple presents important pH variations within the same infructescence due to the gradual maturation (from basal section to upper section) corresponding to the shell’s color [43]. For a mature infructescence, the mean pH of pineapple cv. Queen Victoria grown in Reunion Island is 3.4 [75]. Therefore, future studies are needed to determine the influence of pH on the toxigenicity of interacting FCR pathogens. In addition to the economic loss, FCR could be a hazard for human health in derivative products such as juice or canned pineapple.
In Reunion Island, F. ananatum and F. proliferatum were identified as prevalent species in accordance with the numerous production areas present on the island [17]. When challenged by T. stollii, the toxin production profile of F. proliferatum differed from other Fusarium species–T. stollii combinations. Even if growth rates were the most impacted by T. stollii competition (growth inhibition of 22%), F. proliferatum still produced similar or higher levels of FB1 and FB2 over the 10 days of monitoring. F. ananatum was the only studied Fusarium species that could limit the growth of T. stollii. Thus, in interactions with T. stollii, F. proliferatum was the only FCR pathogen capable of partially preserving its mycotoxigenic potential while F. ananatum was the main growth challenger. In vivo, these two Fusarium species could combine to limit T. stollii but with an impact on quality due to their mycotoxin production. This hypothesis is in concordance with their respective distribution and abundance profiles across Reunion Island. These data demonstrated that interspecific interactions within the fungal community constitute key factors for the understanding of FCR etiology.

4. Conclusions

Our study provides a novel hypothesis on interspecific competition between F. proliferatum, F. ananatum, F. oxysporum, and T. stollii, the four fungal pathogens recently described as contributors to FCR epidemics in pineapple. We found that T. stollii is the main antagonist within the FCR fungal pathobiome. It appears that regulatory mechanisms of colonization profiles specifically rely on interactions between T. stollii and Fusarium FCR pathogens. This could therefore constitute a key determinant of biomass production in host tissues. Identifying the influence of temporal and environmental factors on fungal virulence would help more precisely define the scenario of FCR expression. Data are also necessary for deciphering the molecular crosstalk stimulating the biosynthesis of fumonisins B1 and B2 during interactions between FCR pathogenic species. Defining the modulations of a fungal network could contribute to the development of accurate prediction and prevention models. With climate change, such ecological and toxigenic mapping would promote effective risk management for food and feed safety.

5. Materials and Methods

5.1. Microbial Material

5.1.1. Fungal Strains

Four fungal strains previously isolated from black spots (naturally diseased fruitlets) of pineapple grown in Reunion Island were selected for their pathogenicity in FCR: Fusarium ananatum (clp001), Fusarium proliferatum (BP429), Fusarium oxysporum (BP369), and Talaromyces stollii (BP462) [6,14]. The following procedure was performed on strains BP429, BP369, and BP462. The fungal strain clp001 was obtained by Barral et al. [14].
For identification, single conidia isolation was carried out for each strain by cultivation on Malt agar (pH 5.5, BD DifcoTM, Le Pont-de-Claix, France) for seven days at 27 °C in the dark. Consequently, a conidia solution was prepared by adding 2 mL of Saline Peptone Water (Biokar diagnostic, Solabia, Allonne, France) to the Petri dish and gently scratching the mycelium surface with a sterile spreader. From the conidia suspension, 1 mL was transferred into sterile cryovials with the addition of an equal volume of 40% glycerol (Honeywell Riedel-de-Haën™, Seelze, Germany) and stored at −80 °C in the fungi collection at CIRAD Ligne-Paradis, La Réunion, France. Another volume of 750 µL was recovered for the molecular identification procedure and stored at −20 °C.
DNA Extraction
For each fungal strain, 500 µL of conidia suspension was collected in 2 mL sterile tubes and centrifuged at 14,000× g for 2 min. DNA extractions were performed on the biomass pellets with the FastDNA SPIN kit and the FastPrep-24 Instrument (MP Biomedicals®, Illkirch, France) using Lysing Matrix A and Lysis Buffer CLS-Y in accordance with the manufacturer’s instructions.
Molecular Characterization
For Fusarium sp. isolates, the Translation Elongation Factor-1α (TEF-1α), Internal Transcribed Spacer (ITS), and β-tubulin reference gene regions were amplified by PCR while ITS and β-tubulin regions were targeted for Talaromyces stollii. Primer sequences used in this study are shown in Table 1.
PCR amplification reactions were performed in a final volume of 50 µL containing 0.3 µM of each primer, all the deoxyribonucleotide triphosphates (dNTPs) at 0.2 mM, 2 mM MgCl2, 10 µL of 5X GoTaq Flexi buffer, 1.25 U of the GoTaq® G2 Flexi DNA polymerase (Promega, Charbonnières-les-Bains, France), and 2 µL of the fungal DNA extract. Conditions for the PCR amplification of the TEF-1α region were an initial denaturation at 95 °C for 3 min; 33 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min; and a final extension stage of 5 min at 72 °C. Similarly, PCR amplification reactions for the β-tubulin region were established as follows: an initial denaturation at 95 °C for 2 min; 30 cycles at 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for 5 min. PCR amplification reactions for the ITS region were carried out as follows: an initial denaturation at 95 °C for 2 min; 40 cycles at 95 °C for 15 s, 53 °C for 30 s, and 72 °C for 45 s; and a final extension at 72 °C for 5 min. The PCR reactions were performed in a thermal cycler (GS1, G-Storm, Braintree, UK). PCR products were analyzed with the Qiaxcel® Advanced System (Qiagen, Hilden, Germany) using size markers, 250 bp–4 kb. PCR products were sent to Macrogen (Amsterdam, the Netherlands) for purification and sequencing. The DNA sequences obtained were aligned with SnapGene v5.0 software, and identification was performed using a BLASTn similarity search. Sequences having a percentage of identity of at least 98% and those with the lowest E-values were considered as belonging to the same species.

5.1.2. Co-Culture Bioassays

Prior to co-culture experiments, pre-cultures of each strain were grown in triplicate in Petri dishes on potato dextrose agar (PDA, pH 5.6, VWR International, Fontenay-Sous-Bois, France) for 9 days at 27 °C in the dark.
The procedure was adapted from Bertrand et al. [82], where 2 mL of PDA was distributed into 12-well culture plates with an internal diameter of 2 cm (ThermoFisher Scientific, Illkirch, France). In co-culture assays, strains were challenged as follows: F. ananatum (clp001) versus F. oxysporum (BP369), F. ananatum (clp001) versus F. proliferatum (BP429), F. oxysporum (BP369) versus F. proliferatum (BP429), F. ananatum (clp001) versus T. stollii (BP462), F. oxysporum (BP369) versus T. stollii (BP462), and F. proliferatum (BP429) versus T. stollii (BP462). Wells were inoculated with agar plugs of a 2 mm diameter obtained from pre-cultures and removed from the center of the colonies. For the co-culture condition, agar plugs were deposited at, respectively, 1- and 3-quarter positions along the well diameter (i.e., at 0.5 cm distance from the margin of the well). Control wells were inoculated with single strains. Both confronted and control conditions were performed in triplicate. Thus, a plate was devoted to one co-culture condition and contained 3 wells of single cultures of both strain A and B, 3 wells of co-culture of strain A versus strain B, and 3 non-inoculated wells (Figure S2). Incubation was performed for 2, 4, 6, 8, or 10 days at 27 °C in the dark. At each time point, the three replicate wells were sampled (mycelium and growth medium were collected), pooled, frozen in liquid nitrogen, and stored at −80 °C for further analyses. Three technical replicates were performed corresponding to a total of 90 plates (1 plate per co-culture condition and per time point, 6 co-culture conditions, 5 time points, and 3 biological replicates).

5.2. Mycotoxin Identification and Quantification

5.2.1. Extraction Procedure

The contents of the three pooled wells were ground at 5 m s−1 for 15 s with two ceramic beads using the FastPrep-24 Instrument (MP Biomedicals®, Illkirch, France). From the homogenized matrix, 2.5 g was weighed and 14 mL of acetonitrile/H2O/acetic acid (79:5:1, v/v/v) added. Samples were vortexed and placed in a shaking incubator for 30 min at 200 rpm (Gerhardt Analytical Systems, Königswinter, Germany). After 3 min of centrifugation at 1000× g, 1 mL of the supernatant was transferred to an amber glass vial and dried at 40 °C under nitrogen flow. After evaporation, 1 mL of a 99.5/0.5% (v/v) H2O/acetic acid solution of an internal standard (IS) mix (see Section Standard Solution) was added and the solution was filtered with a 0.45 μm PTFE (polytetrafluoroethylene) syringe filter (ClearLine, Issy-les-Moulineaux, France). The filtrate was used for the determination of mycotoxin content.

5.2.2. Tandem Mass Spectrometry Assay

UHPLC MS/MS Analysis
For all samples, mycotoxins were detected and confirmed by Ultra High-Performance Liquid Chromatography (UHPLC, Shimadzu, Tokyo, Japan) coupled with a mass spectrometer (8040, Shimadzu, Tokyo, Japan) and quantified by isotope-labeled internal standards (ISs) following the protocol of Capodanno et al. and Moreau and Levi [83,84]. The data were analyzed using LabSolutions software (v5.91/2017, Shimadzu, Tokyo, Japan, 2017). The limit of detection (LOD) and limit of quantification (LOQ) were, respectively, 0.03/0.1 ng mL−1 for FB1, 0.01/0.05 ng mL−1 for FB2, and 0.05/0.15 ng mL−1 for BEA.
UHPLC Conditions
Chromatographic separation was carried out with a Kinetex 2.6 μm C18 100A 50 × 2.1 mm ID column (Phenomenex, Torrance, CA, USA). The column temperature was maintained at 50 °C and injection was performed with a volume of 50 μL. The mobile phase A consisted of 99.5% water and 0.5% acetic acid (HPLC MS Grade, Sigma-Aldrich, Darmstadt, Germany). Mobile phase B consisted of 99.5% isopropanol (HPLC MS Grade, Biosolve, Dieuze, France) and 0.5% acetic acid (HPLC MS Grade, Sigma-Aldrich, Darmstadt, Germany). A mobile phase gradient program was started at 90% A (0.01 min), 45% A at 1.5 min, 15% A at 3.5 min, 20% A at 4 min, 98% A at 4.01 min, and finally 98% A at 11 min. The flow rate was 0.4 mL min−1.
MS/MS Conditions
The mass spectrometer was operated in electrospray ionization, and positive (ESI+) and negative (ESI−) ionization modes. Two multiple reaction monitoring (MRM) transitions for each analyte were monitored for Quantification (Q) and Qualification (q). The parameters of the mass spectrometer were as follows: desolvation line—250 °C; heater block—400 °C; nebulizing gas—3 L min−1; drying gas—15 L min−1; CID gas pressure—270 kPa (Argon).
Standard Solution
The certified isotope-labeled standard solutions were purchased from Romer Labs Diagnostic GmbH (Tulln, Austria). The certified standard solutions of aflatoxins (B1, B2, G1, and G2), fumonisins (B1 and B2), trichothecenes (DON, nivalenol, 15ADON, 3ADON, HT-2 toxin, T2 toxin), zearalenone (ZEA), citrinin, ochratoxin A (OTA), and beauvericin (BEA) were purchased from R-Biopharm (Saint-Didier-au-Mont-d’Or, France). A composite standard and internal standard (IS) working solution of all the mycotoxins was prepared by dissolving appropriate volumes of each compound in a mobile phase A: 99.5% water and 0.5% acetic acid. Stock solutions were diluted with mobile phase A, to obtain working solutions for calibration. All solutions were stored at −20 °C in amber glass vials and darkness before use.

5.3. Computational Analysis

5.3.1. Calculations of Areas and Inhibition Ratios

The colony growth rates were determined by an image analysis with the ImageJ software (v.1.53.a, U.S. National Institutes of Health, Bethesda, MD, USA, 2020) considering the mycelium area in each well for both single and co-cultures [85].
Patterns of inhibition growth were calculated for each co-culture condition after 10 days of incubation with the formula
I % = [ [ ( R 1 R 2 ) / R 1 ] × 100 ] 50
where R1 corresponds to the mycelial area of the studied species in the control condition (single culture) and R2 to the mycelial area of the studied species in co-culture [86].

5.3.2. Statistical Analysis

Data were analyzed with programs available in R v4.0.3 (R Core Team, 2020). First, significant differences between inhibition ratios for each studied species in the condition of co-culture were tested with a Deviance test and a Tukey’s multiple comparison test.
The effect of species culture conditions on toxin accumulation was tested for each identified mycotoxin and at each time point with a Deviance test on independent generalized linear models. Multiple comparisons between means of mycotoxin concentrations at the different incubation times and for the different culture conditions were tested with the Tukey’s test.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/toxins16080344/s1, Figure S1: FCR pathogen colony aspects on PDA view from bottom of culture plates after 10 days of incubation in single culture of (A) Fusarium ananatum (Fa), (B) Fusarium oxysporum (Fo), (C) Fusarium proliferatum (Fp), and (D) Talaromyces stollii (Ts) or in condition of co-culture corresponding to (E) F. ananatum versus F. proliferatum (Fa vs. Fp), (F) F. oxysporum versus F. proliferatum (Fo vs. Fp), (G) F. ananatum versus F. oxysporum (Fa vs. Fo), (H) F. ananatum versus T. stollii (Fa vs. Ts), (I) F. oxysporum versus T. stollii (Fo vs. Ts), and (J) F. proliferatum versus T. stollii (Fp vs. Ts), well diameter = 2 cm; Figure S2: Co-culture procedure performed with fungal species defined as FCR pathogens of pineapple on 12-well culture plates. 1,2: single cultures, 3: co-cultures, 4: non-inoculated wells; Table S1: Identification of fungal species isolated from naturally infected pineapple fruitlets and selected for co-culture bioassays.

Author Contributions

Conceptualization, M.V.; methodology, M.V. and N.D.; formal analysis, M.V.; investigation, M.V., C.S., N.D. and C.P.; data curation, M.V.; writing—original draft preparation, M.V.; writing—review and editing, M.V., J.-C.M., M.C. and S.S.-G.; visualization, M.V.; supervision, M.C. and S.S.-G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a grant from the European Regional Development Fund (ERDF) and the Conseil Régional de La Réunion, as part of the CIRAD DPP COSAQ agronomical research program (https://cosaq.cirad.fr/).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the analysis or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Gu, H.; Zhan, R.L.; Zhang, L.B.; Gong, D.Q.; Jia, Z.W. First Report of Fusarium Ananatum Causing Pineapple Fruitlet Core Rot in China. Plant Dis. 2015, 99, 1653. [Google Scholar] [CrossRef]
  2. Jacobs, A.; Wyk, P.S.; Marasas, W.F.O.; Wingfield, B.D.; Wingfield, M.J.; Coutinho, T.A. Fusarium Ananatum Sp. Nov. in the Gibberella Fujikuroi Species Complex from Pineapples with Fruit Rot in South Africa. Fungal Biol. 2010, 114, 515–527. [Google Scholar] [CrossRef] [PubMed]
  3. Barral, B.; Chillet, M.; Minier, J.; Léchaudel, M.; Schorr-Galindo, S. Evaluating the response to Fusarium ananatum inoculation and antifungal activity of phenolic acids in pineapple. Fungal Biol. 2017, 121, 1045–1053. [Google Scholar] [CrossRef]
  4. Barral, B.; Chillet, M.; Léchaudel, M.; Lartaud, M.; Verdeil, J.-L.; Conéjéro, G. An Imaging Approach to Identify Mechanisms of Resistance to Pineapple Fruitlet Core Rot. Front. Plant Sci. 2019, 10, 1065. [Google Scholar] [CrossRef] [PubMed]
  5. Mourichon, X. Pineapple Fruitlet Core Rot (Black Spot) and Leathery Pocket: Review and Prospects. Acta Hortic. 1997, 425, 501–508. [Google Scholar] [CrossRef]
  6. Vignassa, M.; Meile, J.-C.; Chiroleu, F.; Soria, C.; Leneveu-Jenvrin, C.; Schorr-Galindo, S. Pineapple Mycobiome Related to Fruitlet Core Rot Occurrence and the Influence of Fungal Species Dispersion Patterns. JoF 2021, 7, 175. [Google Scholar] [CrossRef]
  7. Li, Z.F.; He, C.L.; Wang, Y.; Li, M.J.; Dai, Y.J.; Wang, T. Enhancement of trichothecene mycotoxins of Fusarium oxysporum by ferulic acid aggravates oxidative damage in Rehmannia glutinosa Libosch. Sci. Rep. 2016, 6, 33962. [Google Scholar] [CrossRef]
  8. Gálvez, L.; Urbaniak, M.; Waśkiewicz, A.; Stępień, Ł.; Palmero, D. Fusarium proliferatum—Causal Agent of Garlic Bulb Rot in Spain: Genetic Variability and Mycotoxin Production. Food Microbiol. 2017, 67, 41–48. [Google Scholar] [CrossRef] [PubMed]
  9. Li, T.; Gong, L.; Jiang, G.; Wang, Y.; Gupta, V.K.; Qu, H. Carbon sources influence fumonisin production in Fusarium proliferatum. Proteomics 2017, 17, 1700070. [Google Scholar] [CrossRef]
  10. Shao, C.; Xiang, D.; Wei, H.; Liu, S.; Yi, G.; Lyu, S. Predicting Virulence of Fusarium Oxysporum f. Sp. Cubense Based on the Production of Mycotoxin Using a Linear Regression Model. Toxins 2020, 12, 254. [Google Scholar] [CrossRef]
  11. Hussein, H.S.; Brasel, J.M. Toxicity, Metabolism, and Impact of Mycotoxins on Humans and Animals. Toxicology 2001, 167, 101–134. [Google Scholar] [CrossRef] [PubMed]
  12. European Food Safety Authority Mycotoxins. Available online: https://www.efsa.europa.eu/en/topics/topic/mycotoxins (accessed on 1 July 2024).
  13. Stępień, Ł.; Koczyk, G.; Waśkiewicz, A. Diversity of Fusarium species and mycotoxins contaminating pineapple. J. Appl. Genet. 2013, 54, 367–380. [Google Scholar] [CrossRef] [PubMed]
  14. Barral, B.; Chillet, M.; Doizy, A.; Grassi, M.; Ragot, L.; Léchaudel, M. Diversity and Toxigenicity of Fungi That Cause Pineapple Fruitlet Core Rot. Toxins 2020, 12, 339. [Google Scholar] [CrossRef] [PubMed]
  15. Jackson, L.S.; Al-Taher, F. Factors Affecting Mycotoxin Production in Fruits. In Mycotoxins in Fruits and Vegetables; Elsevier: Amsterdam, The Netherlands, 2008; pp. 75–104. [Google Scholar]
  16. Kumar, D.; Barad, S.; Sionov, E.; Keller, N.; Prusky, D. Does the Host Contribute to Modulation of Mycotoxin Production by Fruit Pathogens? Toxins 2017, 9, 280. [Google Scholar] [CrossRef]
  17. Fournier, P.; Benneveau, A.; Hardy, C.; Chillet, M.; Léchaudel, M. A Predictive Model Based on a Pluviothermic Index for Leathery Pocket and Fruitlet Core Rot of Pineapple cv. ‘Queen’. Eur. J. Plant Pathol. 2015, 142, 449–460. [Google Scholar] [CrossRef]
  18. Moss, M.O. Fungi, Quality and Safety Issues in Fresh Fruits and Vegetables. J. Appl. Microbiol. 2008, 104, 1239–1243. [Google Scholar] [CrossRef] [PubMed]
  19. Fernández-Cruz, M.L.; Mansilla, M.L.; Tadeo, J.L. Mycotoxins in Fruits and Their Processed Products: Analysis, Occurrence and Health Implications. J. Adv. Res. 2010, 1, 113–122. [Google Scholar] [CrossRef]
  20. Spadaro, D.; Ciavorella, A.; Frati, S.; Garibaldi, A.; Gullino, M.L. Incidence and Level of Patulin Contamination in Pure and Mixed Apple Juices Marketed in Italy. Food Control 2007, 18, 1098–1102. [Google Scholar] [CrossRef]
  21. Puel, O.; Galtier, P.; Oswald, I. Biosynthesis and Toxicological Effects of Patulin. Toxins 2010, 2, 613–631. [Google Scholar] [CrossRef]
  22. Coton, M.; Bregier, T.; Poirier, E.; Debaets, S.; Arnich, N.; Coton, E. Production and Migration of Patulin in Penicillium Expansum Molded Apples during Cold and Ambient Storage. Int. J. Food Microbiol. 2020, 313, 108377. [Google Scholar] [CrossRef]
  23. Diamond, M.; Reape, T.J.; Rocha, O.; Doyle, S.M.; Kacprzyk, J.; Doohan, F.M. The Fusarium Mycotoxin Deoxynivalenol Can Inhibit Plant Apoptosis-like Programmed Cell Death. PLoS ONE 2013, 8, 69542. [Google Scholar] [CrossRef] [PubMed]
  24. Gu, Q.; Tahir, H.; Zhang, H.; Huang, H.; Ji, T.; Sun, X. Involvement of FvSet1 in Fumonisin B1 Biosynthesis, Vegetative Growth, Fungal Virulence, and Environmental Stress Responses in Fusarium Verticillioides. Toxins 2017, 9, 43. [Google Scholar] [CrossRef] [PubMed]
  25. Ridenour, J.B.; Bluhm, B.H. The Novel Fungal-specific Gene FUG1 Has a Role in Pathogenicity and Fumonisin Biosynthesis in Fusarium verticillioides. Mol. Plant Pathol. 2017, 18, 513–528. [Google Scholar] [CrossRef] [PubMed]
  26. Ma, L.-J.; Geiser, D.M.; Proctor, R.H.; Rooney, A.P.; O’Donnell, K.; Trail, F. Fusarium Pathogenomics. Annu. Rev. Microbiol. 2013, 67, 399–416. [Google Scholar] [CrossRef] [PubMed]
  27. Banerjee, S.; Schlaeppi, K.; Heijden, M.G.A. Keystone Taxa as Drivers of Microbiome Structure and Functioning. Nat. Rev. Microbiol. 2018, 16, 567–576. [Google Scholar] [CrossRef] [PubMed]
  28. Vinale, F.; Marra, R.; Scala, F.; Ghisalberti, E.L.; Lorito, M.; Sivasithamparam, K. Major Secondary Metabolites Produced by Two Commercial Trichoderma Strains Active against Different Phytopathogens. Lett. Appl. Microbiol. 2006, 43, 143–148. [Google Scholar] [CrossRef]
  29. You, F.; Han, T.; Wu, J.; Huang, B.; Qin, L. Antifungal Secondary Metabolites from Endophytic Verticillium sp. Biochem. Syst. Ecol. 2009, 37, 162–165. [Google Scholar] [CrossRef]
  30. Combès, A.; Ndoye, I.; Bance, C.; Bruzaud, J.; Djediat, C.; Dupont, J. Chemical Communication between the Endophytic Fungus Paraconiothyrium Variabile and the Phytopathogen Fusarium Oxysporum. PLoS ONE 2012, 7, 47313. [Google Scholar] [CrossRef] [PubMed]
  31. Knowles, S.L.; Raja, H.A.; Wright, A.J.; Lee, A.M.L.; Caesar, L.K.; Cech, N.B. Mapping the Fungal Battlefield: Using in Situ Chemistry and Deletion Mutants to Monitor Interspecific Chemical Interactions between Fungi. Front. Microbiol. 2019, 10, 285. [Google Scholar] [CrossRef]
  32. Sarrocco, S.; Mauro, A.; Battilani, P. Use of Competitive Filamentous Fungi as an Alternative Approach for Mycotoxin Risk Reduction in Staple Cereals: State of Art and Future Perspectives. Toxins 2019, 11, 701. [Google Scholar] [CrossRef]
  33. Pellan, L.; Durand, N.; Martinez, V.; Fontana, A.; Schorr-Galindo, S.; Strub, C. Commercial biocontrol agents reveal contrasting comportments against two mycotoxigenic fungi in cereals: Fusarium graminearum and Fusarium verticillioides. Toxins 2020, 12, 152. [Google Scholar] [CrossRef] [PubMed]
  34. Wicklow, D.T. The Fungal Community: Its Organization and Role in the Ecosystem. In Supplied by U.S. Department of Agriculture, National Center 624 for Agricultural Utilization Research; CRC Press: Peoria, IL, USA, 1992; p. 11. [Google Scholar]
  35. Ghoul, M.; Mitri, S. The Ecology and Evolution of Microbial Competition. Trends Microbiol. 2016, 24, 833–845. [Google Scholar] [CrossRef] [PubMed]
  36. Khan, M.R.; Doohan, F.M. Bacterium-Mediated Control of Fusarium Head Blight Disease of Wheat and Barley and Associated Mycotoxin Contamination of Grain. Biol. Control 2009, 48, 42–47. [Google Scholar] [CrossRef]
  37. Müller, M.E.H.; Steier, I.; Köppen, R.; Siegel, D.; Proske, M.; Korn, U. Cocultivation of Phytopathogenic Fusarium and Alternaria Strains Affects Fungal Growth and Mycotoxin Production. J. Appl. Microbiol. 2012, 113, 874–887. [Google Scholar] [CrossRef] [PubMed]
  38. Milles, J.; Krämer, J.; Prange, A. In vitro competitive interactions of Fusarium graminearum with Aspergillus ochraceus and Penicillium verrucosum with regard to mycotoxin production. J. Food Agric. Environ. 2007, 5, 384–388. [Google Scholar]
  39. Ridout, M.E.; Godfrey, B.; Newcombe, G. Effects of Antagonists on Mycotoxins of Seedborne Fusarium spp. in Sweet Corn. Toxins 2019, 11, 438. [Google Scholar] [CrossRef] [PubMed]
  40. López-Berges, M.S.; Hera, C.; Sulyok, M.; Schäfer, K.; Capilla, J.; Guarro, J. The Velvet Complex Governs Mycotoxin Production and Virulence of Fusarium oxysporum on Plant and Mammalian Hosts: Velvet Governs Mycotoxins and Virulence in Fusarium. Mol. Microbiol. 2013, 87, 49–65. [Google Scholar] [CrossRef] [PubMed]
  41. Bärenstrauch, M.; Mann, S.; Jacquemin, C.; Bibi, S.; Sylla, O.-K.; Baudouin, E. Molecular Crosstalk between the Endophyte Paraconiothyrium variabile and the Phytopathogen Fusarium oxysporum—Modulation of Lipoxygenase Activity and Beauvericin Production during the Interaction. Fungal Genet. Biol. 2020, 139, 103383. [Google Scholar] [CrossRef]
  42. Marmann, A.; Aly, A.; Lin, W.; Wang, B.; Proksch, P. Co-Cultivation—A Powerful Emerging Tool for Enhancing the Chemical Diversity of Microorganisms. Mari. Drugs 2014, 12, 1043–1065. [Google Scholar] [CrossRef]
  43. Barral, B. Maladie des Taches Noires de L’ananas: Étude des Relations Hôte-Pathogène et Compréhension des Mécanismes Physiologiques de Résistance; Université de Montpellier: Saint-Pierre, France, 2017. [Google Scholar]
  44. Wigmann, É.F.; Behr, J.; Vogel, R.F.; Niessen, L. MALDI-TOF MS Fingerprinting for Identification and Differentiation of Species within the Fusarium fujikuroi Species Complex. Appl. Microbiol. Biotechnol. 2019, 103, 5323–5337. [Google Scholar] [CrossRef]
  45. Yilmaz, N.; Houbraken, J.; Hoekstra, E.S.; Frisvad, J.C.; Visagie, C.M.; Samson, R.A. Delimitation and Characterisation of Talaromyces purpurogenus and Related Species. Pers.-Int. Mycol. J. 2012, 29, 39–54. [Google Scholar] [CrossRef] [PubMed]
  46. Bertrand, S.; Schumpp, O.; Bohni, N.; Bujard, A.; Azzollini, A.; Monod, M. Detection of Metabolite Induction in Fungal Co-Cultures on Solid Media by High-Throughput Differential Ultra-High Pressure Liquid Chromatography–Time-of-Flight Mass Spectrometry Fingerprinting. J. Chromatogr. A 2013, 1292, 219–228. [Google Scholar] [CrossRef] [PubMed]
  47. Losada, L.; Ajayi, O.; Frisvad, J.C.; Yu, J.; Nierman, W.C. Effect of Competition on the Production and Activity of Secondary Metabolites in Aspergillus Species. Med. Mycol. 2009, 47, 88–96. [Google Scholar] [CrossRef] [PubMed]
  48. Fox, E.M.; Howlett, B.J. Secondary Metabolism: Regulation and Role in Fungal Biology. Curr. Opin. Microbiol. 2008, 11, 481–487. [Google Scholar] [CrossRef] [PubMed]
  49. Costa Souza, P.; Luiza Bim Grigoletto, T.; Moraes, L.; Abreu, L.M.; Henrique Souza Guimarães, L.; Santos, C. Production and Chemical Characterization of Pigments in filamentous fungi. Microbiology 2016, 162, 12–22. [Google Scholar] [CrossRef] [PubMed]
  50. Sánchez-Muñoz, S.; Mariano-Silva, G.; Leite, M.O.; Mura, F.B.; Verma, M.L.; Silva, S.S. Production of Fungal and Bacterial Pigments and Their Applications. In Biotechnological Production of Bioactive Compounds; Elsevier: Amsterdam, The Netherlands, 2020; pp. 327–361. ISBN 978-0-444-64323-0. [Google Scholar]
  51. Yilmaz, N.; Visagie, C.M.; Houbraken, J.; Frisvad, J.C.; Samson, R.A. Polyphasic taxonomy of the genus Talaromyces. Stud. Mycol. 2014, 78, 175–341. [Google Scholar] [CrossRef]
  52. Lebeau, J.; Petit, T.; Clerc, P.; Dufossé, L.; Caro, Y. Isolation of Two Novel Purple Naphthoquinone Pigments Concomitant with the Bioactive Red Bikaverin and Derivates Thereof Produced by Fusarium oxysporum. Biotechnol. Prog. 2019, 35, 2738. [Google Scholar] [CrossRef]
  53. Lebeau, J.; Petit, T.; Dufossé, L.; Caro, Y. Putative Metabolic Pathway for the Bioproduction of Bikaverin and Intermediates Thereof in the Wild Fusarium oxysporum LCP531 Strain. AMB Express 2019, 9, 186. [Google Scholar] [CrossRef]
  54. Gasser, K.; Sulyok, M.; Spangl, B.; Krska, R.; Steinkellner, S.; Hage-Ahmed, K. Fusarium proliferatum Secondary Metabolite Profile in Vitro Depends on the Origin of the Isolates and Is Clearly Reduced in Stored Garlic. Postharvest Biol. Technol. 2023, 200, 112312. [Google Scholar] [CrossRef]
  55. Studt, L.; Wiemann, P.; Kleigrewe, K.; Humpf, H.-U.; Tudzynski, B. Biosynthesis of fusarubins accounts for pigmentation of Fusarium fujikuroi perithecia. Appl. Environ. Microbiol. 2012, 78, 4468–4480. [Google Scholar] [CrossRef]
  56. Lagashetti, A.C.; Dufossé, L.; Singh, S.K.; Singh, P.N. Fungal Pigments and Their Prospects in Different Industries. Microorganisms 2019, 7, 604. [Google Scholar] [CrossRef]
  57. Son, S.W.; Kim, H.Y.; Choi, G.J.; Lim, H.K.; Jang, K.S.; Lee, S.O. Bikaverin and Fusaric Acid from Fusarium oxysporum Show Antioomycete Activity against Phytophthora infestans. J. Appl. Microbiol. 2008, 104, 692–698. [Google Scholar] [CrossRef] [PubMed]
  58. Dullah, S.; Hazarika, D.J.; Goswami, G.; Borgohain, T.; Ghosh, A.; Barooah, M.; Bhattacharyya, A.; Boro, R.C. Melanin Production and Laccase Mediated Oxidative Stress Alleviation during Fungal-Fungal Interaction among Basidiomycete Fungi. IMA Fungus 2021, 12, 33. [Google Scholar] [CrossRef] [PubMed]
  59. Stępień, Ł.; Waśkiewicz, A. Sequence Divergence of the Enniatin Synthase Gene in Relation to Production of Beauvericin and Enniatins in Fusarium Species. Toxins 2013, 5, 537–555. [Google Scholar] [CrossRef] [PubMed]
  60. Ibrahim, N.F.; Mohd, M.H.; Mohamed Nor, N.M.I.; Zakaria, L. Mycotoxigenic Potential of Fusarium Species Associated with Pineapple Diseases. Arch. Phytopathol. Plant Prot. 2020, 53, 217–229. [Google Scholar] [CrossRef]
  61. Venkatesh, N.; Keller, N.P. Mycotoxins in Conversation with Bacteria and Fungi. Front. Microbiol. 2019, 10, 403. [Google Scholar] [CrossRef]
  62. Zheng, H.; Kim, J.; Liew, M.; Yan, J.K.; Herrera, O.; Bok, J.W. Redox metabolites signal polymicrobial biofilm development via the NapA oxidative stress cascade in Aspergillus. Curr. Biol. 2015, 25, 29–37. [Google Scholar] [CrossRef]
  63. Camardo Leggieri, M.; Giorni, P.; Pietri, A.; Battilani, P. Aspergillus flavus and Fusarium verticillioides Interaction: Modeling the Impact on Mycotoxin Production. Front. Microbiol. 2019, 10, 2653. [Google Scholar] [CrossRef]
  64. Lee, K.; Pan, J.J.; May, G. Endophytic Fusarium Verticillioides Reduces Disease Severity Caused by Ustilago Maydis on Maize. FEMS Microbiol. Lett. 2009, 299, 31–37. [Google Scholar] [CrossRef]
  65. Rodriguez Estrada, A.E.; Hegeman, A.; Corby Kistler, H.; May, G. In Vitro Interactions between Fusarium verticillioides and Ustilago maydis through Real-Time PCR and Metabolic Profiling. Fungal Genet. Biol. 2011, 48, 874–885. [Google Scholar] [CrossRef]
  66. Jonkers, W.; Rodriguez Estrada, A.E.; Lee, K.; Breakspear, A.; May, G.; Kistler, H.C. Metabolome and Transcriptome of the Interaction between Ustilago maydis and Fusarium verticillioides In Vitro. Appl. Environ. Microbiol. 2012, 78, 3656–3667. [Google Scholar] [CrossRef] [PubMed]
  67. Perincherry, L.; Lalak-Kańczugowska, J.; Stępień, Ł. Fusarium-Produced Mycotoxins in Plant-Pathogen Interactions. Toxins 2019, 11, 664. [Google Scholar] [CrossRef]
  68. Baldwin, T.T.; Zitomer, N.C.; Mitchell, T.R.; Zimeri, A.-M.; Bacon, C.W.; Riley, R.T. Maize Seedling Blight Induced by Fusarium verticillioides: Accumulation of Fumonisin B1 in Leaves without Colonization of the Leaves. J. Agric. Food Chem. 2014, 62, 2118–2125. [Google Scholar] [CrossRef] [PubMed]
  69. Parnell, S.; Gottwald, T.R.; Gilligan, C.A.; Cunniffe, N.J.; Bosch, F. The effect of landscape pattern on the optimal eradication zone of an invading epidemic. Phytopathology® 2010, 100, 638–644. [Google Scholar] [CrossRef] [PubMed][Green Version]
  70. Almaguer, M.; Aira, M.-J.; Rodríguez-Rajo, F.J.; Rojas, T.I. Temporal Dynamics of Airborne Fungi in Havana (Cuba) during Dry and Rainy Seasons: Influence of Meteorological Parameters. Int. J. Biometeorol. 2014, 58, 1459–1470. [Google Scholar] [CrossRef] [PubMed]
  71. Velásquez, A.C.; Castroverde, C.D.M.; He, S.Y. Plant–Pathogen Warfare under Changing Climate Conditions. Curr. Biol. 2018, 28, 619–634. [Google Scholar] [CrossRef]
  72. Picot, A.; Hourcade-Marcolla, D.; Barreau, C.; Pinson-Gadais, L.; Caron, D.; Richard-Forget, F. Interactions between Fusarium verticillioides and Fusarium graminearum in Maize Ears and Consequences for Fungal Development and Mycotoxin Accumulation: Fusarium spp. Interactions in Maize Ears. Plant Pathol. 2012, 61, 140–151. [Google Scholar] [CrossRef]
  73. Dita, M.; Barquero, M.; Heck, D.; Mizubuti, E.S.G.; Staver, C.P. Fusarium Wilt of Banana: Current Knowledge on Epidemiology and Research Needs toward Sustainable Disease Management. Front. Plant Sci. 2018, 9, 1468. [Google Scholar] [CrossRef] [PubMed]
  74. Ou, Y.; Penton, C.R.; Geisen, S.; Shen, Z.; Sun, Y.; Lv, N. Deciphering underlying drivers of disease suppressiveness against pathogenic Fusarium oxysporum. Front. Microbiol. 2019, 10, 2535. [Google Scholar] [CrossRef]
  75. Leneveu-Jenvrin, C.; Quentin, B.; Assemat, S.; Hoarau, M.; Meile, J.-C.; Remize, F. Changes of Quality of Minimally-Processed Pineapple (Ananas Comosus, Var. ‘Queen Victoria’) during Cold Storage: Fungi in the Leading Role. Microorganisms 2020, 8, 185. [Google Scholar] [CrossRef]
  76. O’Donnell, K.; Cigelnik, E.; Nirenberg, H.I. Molecular Systematics and Phylogeography of the Gibberella fujikuroi Species Complex. Mycologia 1998, 90, 465–493. [Google Scholar] [CrossRef]
  77. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple Evolutionary Origins of the Fungus Causing Panama Disease of Banana: Concordant Evidence from Nuclear and Mitochondrial Gene Genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
  78. Liu, X.; Xing, M.; Kong, C.; Fang, Z.; Yang, L.; Zhang, Y. Genetic Diversity, Virulence, Race Profiling, and Comparative Genomic Analysis of the Fusarium oxysporum f. sp. conglutinans Strains Infecting Cabbages in China. Front. Microbiol. 2019, 10, 1373. [Google Scholar] [CrossRef]
  79. Glass, N.L.; Donaldson, G.C. Development of Primer Sets Designed for Use with the PCR to Amplify Conserved Genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [PubMed]
  80. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols; Elsevier: Amsterdam, The Netherlands, 1990; pp. 315–322. [Google Scholar]
  81. Gardes, M.; Bruns, T.D. ITS Primers with Enhanced Specificity for Basidiomycetes—Application to the Identification of Mycorrhizae and Rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [PubMed]
  82. Bertrand, S.; Azzollini, A.; Schumpp, O.; Bohni, N.; Schrenzel, J.; Monod, M. Multi-Well Fungal Co-Culture for de Novo Metabolite-Induction in Time-Series Studies Based on Untargeted Metabolomics. Mol. BioSyst. 2014, 10, 2289–2298. [Google Scholar] [CrossRef] [PubMed]
  83. Capodanno, E.; Moreau, S.; Levi, M.; Shimadzu Corporation. Rapid Simultaneous Assay of 23 Mycotoxines in a Variety of Food Samples by UHPLC-MS/MS Using Fast Polarity Switching. PO-CON1350E. 2013. [Google Scholar]
  84. Moreau, S.; Levi, M.; Shimadzu Corporation. Highly Sensitive and Rapid Simultaneous Method for 45 Mycotoxins in Baby Food Samples by HPLC-MS/MS Using Fast Polarity Switching. PO-CON1480E. 2014. [Google Scholar]
  85. Abràmoff, M.D.; Magalhães, P.J.; Ram, S.J. Image Processing with ImageJ. Biophotonics Int. 2004, 11, 36–42. [Google Scholar]
  86. Hamzah, T.N.T.; Lee, S.Y.; Hidayat, A.; Terhem, R.; Faridah-Hanum, I.; Mohamed, R. Diversity and Characterization of Endophytic Fungi Isolated from the Tropical Mangrove Species, Rhizophora Mucronata, and Identification of Potential Antagonists against the Soil-Borne Fungus, Fusarium solani. Front. Microbiol. 2018, 9, 1707. [Google Scholar] [CrossRef]
Figure 1. FCR pathogen colony aspects on PDA after 10 days of incubation in single culture of (A) Fusarium ananatum (Fa), (B) Fusarium oxysporum (Fo), (C) Fusarium proliferatum (Fp), and (D) Talaromyces stollii (Ts) or in condition of co-culture corresponding to (E) F. ananatum versus F. proliferatum (Fa vs. Fp), (F) F. oxysporum versus F. proliferatum (Fo vs. Fp), (G) F. ananatum versus F. oxysporum (Fa vs. Fo), (H) F. ananatum versus T. stollii (Fa vs. Ts), (I) F. oxysporum versus T. stollii (Fo vs. Ts), and (J) F. proliferatum versus T. stollii (Fp vs. Ts), well diameter = 2 cm.
Figure 1. FCR pathogen colony aspects on PDA after 10 days of incubation in single culture of (A) Fusarium ananatum (Fa), (B) Fusarium oxysporum (Fo), (C) Fusarium proliferatum (Fp), and (D) Talaromyces stollii (Ts) or in condition of co-culture corresponding to (E) F. ananatum versus F. proliferatum (Fa vs. Fp), (F) F. oxysporum versus F. proliferatum (Fo vs. Fp), (G) F. ananatum versus F. oxysporum (Fa vs. Fo), (H) F. ananatum versus T. stollii (Fa vs. Ts), (I) F. oxysporum versus T. stollii (Fo vs. Ts), and (J) F. proliferatum versus T. stollii (Fp vs. Ts), well diameter = 2 cm.
Toxins 16 00344 g001
Figure 2. Influence of FCR pathogen interactions on colony growth parameters. (AD) panels show fungal growth evolution over 10 days for co-cultures and corresponding single cultures. Gray dashed lines represent 50% of well area (1.57 cm2). (EH) panels indicate associated growth inhibition ratio calculated from data at day 10 for each co-culture condition. (A,E); (B,F); (C,G) and (D,H) show growth profiles and inhibition potential on F. ananatum, F. oxysporum, F. proliferatum, and T. stollii, respectively. Vertical bars represent standard error of means (n = 9). Letters show significantly different inhibition ratios for each species following Tukey’s multiple comparison test at p < 0.05. Fa: Fusarium ananatum, Fo: Fusarium oxysporum, Fp: Fusarium proliferatum, and Ts: Talaromyces stollii.
Figure 2. Influence of FCR pathogen interactions on colony growth parameters. (AD) panels show fungal growth evolution over 10 days for co-cultures and corresponding single cultures. Gray dashed lines represent 50% of well area (1.57 cm2). (EH) panels indicate associated growth inhibition ratio calculated from data at day 10 for each co-culture condition. (A,E); (B,F); (C,G) and (D,H) show growth profiles and inhibition potential on F. ananatum, F. oxysporum, F. proliferatum, and T. stollii, respectively. Vertical bars represent standard error of means (n = 9). Letters show significantly different inhibition ratios for each species following Tukey’s multiple comparison test at p < 0.05. Fa: Fusarium ananatum, Fo: Fusarium oxysporum, Fp: Fusarium proliferatum, and Ts: Talaromyces stollii.
Toxins 16 00344 g002
Figure 3. Dynamics of fumonisin B1 (FB1), fumonisin B2 (FB2), and beauvericin (BEA) during co-culture bioassays between Fusarium spp. and Talaromyces stollii. (A) F. ananatum versus T. stollii (Fa vs. Ts), (B) F. oxysporum vs. T. stollii (Fo vs. Ts), and (C) F. proliferatum versus T. stollii (Fp vs. Ts). Vertical bars represent standard deviation (n = 3). Differences between single and co-cultures were either significant at p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) or non-significant (ns) for each toxin and each time point. Dot colors indicate significant differences according to Tukey’s multiple comparison test at p < 0.05 and correspond to ‘a’ (yellow dots), ‘b’ (red dots), ‘ab’ (blue dots), and ‘c’ (green dots).
Figure 3. Dynamics of fumonisin B1 (FB1), fumonisin B2 (FB2), and beauvericin (BEA) during co-culture bioassays between Fusarium spp. and Talaromyces stollii. (A) F. ananatum versus T. stollii (Fa vs. Ts), (B) F. oxysporum vs. T. stollii (Fo vs. Ts), and (C) F. proliferatum versus T. stollii (Fp vs. Ts). Vertical bars represent standard deviation (n = 3). Differences between single and co-cultures were either significant at p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) or non-significant (ns) for each toxin and each time point. Dot colors indicate significant differences according to Tukey’s multiple comparison test at p < 0.05 and correspond to ‘a’ (yellow dots), ‘b’ (red dots), ‘ab’ (blue dots), and ‘c’ (green dots).
Toxins 16 00344 g003
Figure 4. Dynamics of fumonisin B1 (FB1), fumonisin B2 (FB2), and beauvericin (BEA) during co-culture bioassays between Fusarium spp. reported as FCR pathogens. (A) F. oxysporum versus F. ananatum (Fo vs. Fa), (B) F. ananatum vs. F. proliferatum (Fa vs. Fp), and (C) F. oxysporum versus F. proliferatum (Fo vs. Fp). Vertical bars represent standard deviation (n = 3). Differences between single and co-cultures were either significant at p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) or non-significant (ns) for each toxin and each time point. Dot colors indicate significant differences according to Tukey’s multiple comparison test at p < 0.05 and correspond to ‘a’ (yellow dots), ‘b’ (red dots), and ‘ab’ (blue dots).
Figure 4. Dynamics of fumonisin B1 (FB1), fumonisin B2 (FB2), and beauvericin (BEA) during co-culture bioassays between Fusarium spp. reported as FCR pathogens. (A) F. oxysporum versus F. ananatum (Fo vs. Fa), (B) F. ananatum vs. F. proliferatum (Fa vs. Fp), and (C) F. oxysporum versus F. proliferatum (Fo vs. Fp). Vertical bars represent standard deviation (n = 3). Differences between single and co-cultures were either significant at p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) or non-significant (ns) for each toxin and each time point. Dot colors indicate significant differences according to Tukey’s multiple comparison test at p < 0.05 and correspond to ‘a’ (yellow dots), ‘b’ (red dots), and ‘ab’ (blue dots).
Toxins 16 00344 g004
Table 1. DNA primer sequences (forward and reverse) used for fungal strain identification.
Table 1. DNA primer sequences (forward and reverse) used for fungal strain identification.
Sequence ID of Primer PairTarget LocusForward Sequence (5′→3′)Reverse Sequence (5′→3′)Product Length (bp)References
ef1/ef2Translation Elongation Factor-1αATGGGTAAGGAAGACAAGACGGAAGTACCAGTGATCATGTT380–680[76,77,78]
Bt2a/Bt2bβ-TubulinGGTAACCAAATCGGTGCTGCTTTCACCCTCAGTGTAGTGACCCTTGGC250–500[79]
ITS1F/ITS4Entire Internal Transcribed SpacerCTTGGTCATTTAGAGGAAGTAATCCTCCGCTTATTGATATGC600–800[80,81]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Vignassa, M.; Soria, C.; Durand, N.; Poss, C.; Meile, J.-C.; Chillet, M.; Schorr-Galindo, S. Modulation of Growth and Mycotoxigenic Potential of Pineapple Fruitlet Core Rot Pathogens during In Vitro Interactions. Toxins 2024, 16, 344. https://doi.org/10.3390/toxins16080344

AMA Style

Vignassa M, Soria C, Durand N, Poss C, Meile J-C, Chillet M, Schorr-Galindo S. Modulation of Growth and Mycotoxigenic Potential of Pineapple Fruitlet Core Rot Pathogens during In Vitro Interactions. Toxins. 2024; 16(8):344. https://doi.org/10.3390/toxins16080344

Chicago/Turabian Style

Vignassa, Manon, Christian Soria, Noël Durand, Charlie Poss, Jean-Christophe Meile, Marc Chillet, and Sabine Schorr-Galindo. 2024. "Modulation of Growth and Mycotoxigenic Potential of Pineapple Fruitlet Core Rot Pathogens during In Vitro Interactions" Toxins 16, no. 8: 344. https://doi.org/10.3390/toxins16080344

APA Style

Vignassa, M., Soria, C., Durand, N., Poss, C., Meile, J.-C., Chillet, M., & Schorr-Galindo, S. (2024). Modulation of Growth and Mycotoxigenic Potential of Pineapple Fruitlet Core Rot Pathogens during In Vitro Interactions. Toxins, 16(8), 344. https://doi.org/10.3390/toxins16080344

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop