Integrative Analysis of VSMC, Macrophage, and Fibroblast Responses to LDLs in Aortic Pathologies

Abstract

Cardiovascular diseases (CVDs) remain the leading cause of global mortality, with aortic pathologies such as atherosclerosis and thoracic aortic aneurysm posing significant risks due to their asymptomatic nature and potential fatal complications. This study investigates molecular mechanisms underlying CVDs by examining key cellular components of the aortic wall—vascular smooth muscle cells (VSMCs), fibroblasts, and macrophages—and their responses to low-density lipoproteins (LDLs). Using in vitro models, we analyzed phenotypic characteristics, LDL internalization capacity, and secretion/expression of pro-inflammatory mediators (IL-6, IL-8, IL-1β, CCL2) in primary VSMCs (from tunica intima and media), fibroblasts (977hTERT), and THP-1 macrophages. Fluorescence staining with BDP 630/650 revealed that all cell types internalize LDLs, with macrophages showing the highest lipid accumulation. ELISA and RT-qPCR demonstrated cell-specific patterns of cytokine secretion and gene expression, both in control conditions and after LDL exposure. The results indicate that VSMCs and fibroblasts, normally involved in vascular tone maintenance and extracellular matrix (ECM) synthesis, acquire pro-inflammatory features under pathological conditions, including increased secretion of IL-6, IL-8, and CCL2. Macrophages exhibited enhanced expression of the scavenger receptor CD36 and pro-inflammatory cytokines (especially IL-1β) after LDL treatment.

1. Introduction

Cardiovascular diseases (CVDs) remain the leading cause of mortality at the global level, despite significant advances in modern medicine in the fields of diagnosis and therapy. Particularly clinically relevant are pathological conditions of the aorta, notably atherosclerosis and thoracic aortic aneurysm, which are characterized by an asymptomatic course in the early stages and a high risk of fatal complications [1]. In this regard, understanding the mechanisms underlying the development of these diseases necessitates a comprehensive investigation of the cellular composition of the vascular wall and the intricate interactions between various cell types that drive pathological processes.

The aortic wall comprises three main layers, each containing specific cell types. The inner layer, or tunica intima, houses endothelial cells and macrophages [2]; the middle layer, or tunica media, contains vascular smooth muscle cells (VSMCs); and the outer layer, or tunica adventitia, consists of fibroblasts [3]. It is noteworthy that during pathological processes, the cells can migrate between aortic layers [4]. For instance, in the development of atherosclerosis, VSMCs can translocate from the tunica media to the tunica intima under the influence of various factors that are secreted by macrophages or endothelial cells (for example, platelet-derived growth factor (PDGF) and vascular endothelial growth factor (VEGF)) [5].

Macrophages play a pivotal role in the pathogenesis of CVDs by initiating the atherosclerotic process [6]. These cells actively engulf modified low-density lipoproteins (LDLs), transforming into foam cells and thereby contributing to the formation of atherosclerotic plaques. During aneurysm development, macrophages participate in the degradation of the extracellular matrix (ECM), leading to vessel wall thinning and subsequent stratification [7].

VSMCs serve as primary regulators of vascular tone. Under pathological conditions, these cells undergo phenotypic modulation, characterized by the loss of contractile properties and the acquisition of synthetic functions. Notably, when exposed to cholesterol, VSMCs can transform into a macrophage-like state, expressing markers such as Galectin-3, CD11b, CD45, CD68, and CD116 [8].

Fibroblasts play a crucial role in the synthesis of ECM components and the maintenance of the structural integrity of the vascular wall. Dysfunction of these cells results in impaired vascular remodeling and subsequent development of pathological processes [9].

Given the aforementioned considerations, the investigation of molecular mechanisms within these cells holds fundamental significance for the development of novel approaches to CVD diagnosis and treatment. A comprehensive understanding of interactions among various cellular components of the aorta presents promising opportunities for the development of targeted therapies directed at specific molecular targets. Such advancements have the potential to substantially enhance CVD prognoses and reduce mortality rates associated with these pathologies.

The current study was aimed to investigate the molecular mechanisms of CVDs by analysis of key cellular components of the aortic wall—VSMCs, fibroblasts, and macrophages—and their responses to low-density lipoproteins (LDLs).

2. Results

2.1. Phenotyping of VSMCs Isolated from the Human Aorta

During immunofluorescence analysis, it was shown that primary VSMCs possess smooth muscle markers ACTA2, MYH11, and CNN1 (Figure 1).

In addition, during RT-qPCR analysis, it was also shown that primary VSMCs actively express Desmin, CNN1 and MYH11 (Figure 2).

There were no statistically significant differences in the expression of smooth muscle markers (Desmin, CNN1 and MYH11) in VSMCs from the tunica intima and VSMCs from the tunica media.

Our PCR analysis demonstrated that the mRNA expression level of MYH11 in SMCs isolated from the tunica intima and tunica media was notably lower (p < 0.05) than the expression levels of CNN1 and Desmin. This molecular finding is consistent with immunocytochemical observations, where MYH11 protein expression was visibly weaker than the CNN1 protein signal.

2.2. Analysis of Cellular LDL Internalization Ability

When analyzing the ability of cell lines to internalize LDL using BDP dye, it was found that the capacity to form lipid droplets significantly varies between different cell lines (Figure 3).

So, in macrophages without the addition of LDL, the average fluorescence intensity of the BDP dye per µm² in the cell was equal to 8 (6; 8) × 10⁻⁴ a.u.; after incubation with LDL, it was 20 (20; 20) × 10⁻⁴ a.u. (p < 0.001). In fibroblasts without LDL, it was 7 (6; 9) × 10⁻⁴ a.u.; after incubation with LDL, it was 12 (10; 13) × 10⁻⁴ a.u. (p < 0.01). In the control group of primary VSCMs from the tunica intima, the fluorescence intensity of BDP per µm² was equal to 0.8 (0.5; 0.9) × 10⁻⁴ a.u., and after incubation with LDL it was 2 (2; 2) × 10⁻⁴ a.u. (p < 0.01). In primary VSMCs from the tunica media, after incubation with LDL the fluorescence intensity of BDP per µm² was equal to 1 (0.9; 2) × 10⁻⁴ a.u.; it was significantly higher (p < 0.001) than in the control group of cells, which had a fluorescence intensity of 0.2 (0.1; 0.4) × 10⁻⁴ a.u.

The obtained data suggest that during the development of aneurysms, VSMCs may acquire a macrophage-like phenotype, thereby initiating active internalization of LDL.

2.3. Analysis of Proinflammatory Cytokine Secretion by ELISA

Analysis of the culture medium revealed that the ability to secrete pro-inflammatory cytokines (IL-8, IL-6, IL-1β, and CCL2) significantly differed among the studied cell groups. During the study, four cell lines were analyzed, each comprising two experimental groups. For each cytokine, three repeated experiments were performed.

The results of measurements of IL-8, IL-6, IL-1β, and CCL2 secretion in the studied cell lines—both in the groups after incubation with LDL and in the control groups—are presented in

Table 1. The median value of the absolute index of secreted cytokines (IL-8, IL-6, IL-1β and CCL2) in the studied cells (pg/mL) (n = 72), Me (25%; 75%).

Secreted Cytokine	Cell Line	Group		Significance, p
		Control (1)	LDL (2)
IL-8	Macrophages	97,900 (73,280; 115,559)	96,882 (72,372; 113,689)	p > 0.05
	VSMCs from the tunica intima	3880 (2698; 4391)	463 (301; 3391)	p > 0.05
	VSMCs from the tunica media	526 (410; 647)	450 (318; 553)	p > 0.05
	Fibroblasts 977hTERT	12 (86; 228)	296 (219; 331)	p(1–2) < 0.05
IL-6	Macrophages	80 (16; 118)	876 (285; 904)	p(1–2) < 0.01
	VSMCs from the tunica intima	1439 (1027; 1973)	1181 (1107; 1826)	p > 0.05
	VSMCs from the tunica media	1862 (1488; 1995)	1247 (1078; 1874)	p > 0.05
	Fibroblasts 977hTERT	61 (57; 66)	166 (88; 244)	p(1–2) < 0.05
IL-1β	Macrophages	538 (515; 545)	1465 (1374; 1524)	p(1–2) < 0.01
	VSMCs from the tunica intima	57 (54; 61)	57 (56; 59)	p > 0.05
	VSMCs from the tunica media	60 (57; 62)	57 (56; 59)	p > 0.05
	Fibroblasts 977hTERT	111 (108; 12)	82 (81; 83)	p(1–2) < 0.05
CCL2	Macrophages	1123 (798; 1885)	1949 (1295; 2679)	p > 0.05
	VSMCs from the tunica intima	1183 (720; 1551)	412 (351; 827)	p(1–2) < 0.05
	VSMCs from the tunica media	417 (298; 659)	602 (429; 741)	p > 0.05
	Fibroblasts 977hTERT	26 (24; 46)	71 (69; 75)	p(1–2) < 0.01

.

2.3.1. Secretion of IL-8

It was shown that IL-8 secretion by VSMCs from the tunica intima was significantly lower after incubation with LDL than in control group (p < 0.001). It is worth noting that there were no statistically significant differences between the VSMCs from the tunica media after incubation with LDL and the control group. However, in the control group of fibroblasts, IL-8 secretion was significantly lower than in the fibroblasts incubated with LDL (p < 0.01).

The data obtained show that fibroblasts actively secrete the pro-inflammatory cytokine IL-8. However, IL-8 secretion in the macrophage cell line is much higher than in the studied VSMCs and fibroblasts. Thus, IL-8 secretion in macrophages (contr) was significantly higher than in the VSMCs (contr) (p < 0.01) and VSMCs (LDL) (p < 0.001). In addition, in VSMCs from the tunica media without LDL (p < 0.001) and after incubation with LDL (p < 0.001), IL-8 secretion was significantly lower than in the macrophages (contr). It is also worth noting that IL-8 secretion in the macrophages (contr) was higher than in fibroblasts (contr) (p < 0.001) (Figure 4).

2.3.2. Secretion of IL-6

There were no statistically significant differences in IL-6 secretion in VSMCs isolated from the tunica (contr) and (LDL). There were no statistically significant differences in IL-6 secretion in VSMCs from the tunica media. In the fibroblasts (contr), IL-6 secretion was significantly lower than in the fibroblasts (LDL) (p < 0.05). However, despite statistically significant differences between the groups, IL-6 secretion in macrophages was lower than in VSMCs isolated from the tunica intima and in VSMCs from the tunica media. Thus, in VSMCs isolated from the tunica intima (contr) (p < 0.001) and (LDL) (p < 0.001), the level of IL-6 secretion was 15 times higher than in the macrophages (contr). Also, in the control group of VSMCs from the tunica media (p < 0.001) and in the group of cells after incubation with LDL (p < 0.001), IL-6 secretion was significantly higher than in the control group of macrophages. There were no statistically significant differences in IL-6 secretion between the control group of macrophages and the fibroblast groups (Figure 4).

2.3.3. Secretion of IL-1β

The study showed that there were no statistically significant differences in IL-1β secretion after incubation with LDL in VSMCs isolated from the tunica intima and in VSMCs from the tunica media between the (contr) and (LDL) groups. However, in the THP-1 macrophage cell line, IL-1β secretion was significantly higher in the group of cells after incubation with LDL compared with the control group (p < 0.001). When analyzing the fibroblast culture medium, it was found that after incubation with LDL, IL-1β secretion significantly decreased compared to the control group (p < 0.05). It is also worth noting that the level of IL-1β secretion in the macrophage cell line was significantly higher than in the studied VSMCs and fibroblasts. Thus, in VSMCs from the tunica media (conrt) (p < 0.001) and (LDL) (p < 0.001), the level of IL-1β secretion was significantly lower than in the macrophages (contr). Also, as in VSMCs, the level of IL-1β secretion in fibroblasts (contr) (p < 0.01) and (LDL) (p < 0.001) was significantly lower than in the macrophages (contr) (Figure 4).

2.3.4. Secretion of CCL2

During the analysis of CCL2 secretion, it was shown that in VSMCs isolated from the tunica intima, CCL2 secretion was lower in the (LDL) group compared with the control group (p < 0.05). CCL2 secretion in fibroblasts (LDL) was significantly higher than in the fibroblasts (contr) (p < 0.01). It is also worth noting that in the THP-1 cell line (contr), CCL2 secretion was significantly higher than in VSMCs from the tunica intima (LDL) (p < 0.01) and than in VSMCs from the tunica media (contr) (p < 0.01) and (LDL) (p < 0.01), as well as than in the fibroblasts (contr) (p < 0.001) and in fibroblasts (LDL) (p < 0.001) (Figure 4).

2.4. Analysis of Pro-Inflammatory Gene Expression Using RT-qPCR

During the analysis of gene expression in the studied cell lines, it was shown that gene expression and the secretion of corresponding proteins may differ (

Table 2. The median value of the relative expression (2^−ΔΔCt) of genes (LDLR, IL6, IL8, CD36, IL1B and CCL2) in the studied cells (n = 72), Me (25%; 75%).

Gene	Cell Line	Group		Significance, p
		Control (1)	LDL (2)
LDLR	Macrophages	0.25 (0.18; 2.34)	0.10 (0.02; 0.23)	p(1–2) < 0.05
	VSMCs from the tunica intima	7.79 (0.95; 20.02)	12.07 (10.53; 29.63)	p > 0.05
	VSMCs from the tunica media	1.61 (0.52; 12.28)	1.08 (0.61; 1.85)	p > 0.05
	Fibroblasts	30.39 (10.26; 50.34)	24.70 (7.93; 40.88)	p > 0.05
IL6	Macrophages	0.92 (0.45; 1.64)	4.41 (0.55; 9.57)	p > 0.05
	VSMCs from the tunica intima	637.22 (443.61; 784.73)	192.64 (124.11; 259.89)	p(1–2) < 0.05
	VSMCs from the tunica media	77.16 (24.49; 809.33)	108.62 (31.87; 550.67)	p > 0.05
	Fibroblasts	84.96 (30.53; 174.71)	303.44 (46.92; 565.28)	p > 0.05
IL8	Macrophages	1.05 (0.59; 1.16)	2.29 (1.64; 3.34)	p > 0.05
	VSMCs from the tunica intima	0.03 (0.02; 0.07)	0.08 (0.01; 0.09)	p > 0.05
	VSMCs from the tunica media	0.03 (0.01; 0.25)	0.01 (0.01; 0.02)	p(1–2) < 0.001
	Fibroblasts	0	0.02 (0.02; 0.03)	p(1–2) < 0.01
CD36	Macrophages	1.07 (0.62; 1.32)	2.63 (1.12; 3.27)	p(1–2) < 0.01
	VSMCs from the tunica intima	0	0	p > 0.05
	VSMCs from the tunica media	0	0	p > 0.05
	Fibroblasts	0	0	p > 0.05
IL1B	Macrophages	0.77 (0.54; 1.84)	2.12 (0.17; 2.24)	p(1–2) < 0.05
	VSMCs from the tunica intima	0	0	p > 0.05
	VSMCs from the tunica media	0.01 (0.00; 0.03)	0.02 (0.00; 0.03)	p > 0.05
	Fibroblasts	0	0	p > 0.05
CCL2	Macrophages	0.90 (0.33; 1.64)	1.16 (1.04; 1.23)	p > 0.05
	VSMCs from the tunica intima	7.84 (6.27; 16.57)	7.53 (1.80; 35.84)	p > 0.05
	VSMCs from the tunica media	3.53 (1.98; 22.37)	1.84 (0.05; 4.31)	p(1–2) < 0.01
	Fibroblasts	0	0	p > 0.05

).

2.4.1. LDLR Expression

The analysis showed that macrophages exhibited a significant decrease in LDLR expression in the group of cells after incubation with LDL compared with the control group (p < 0.05). There were no statistically significant differences in LDLR expression between the control group of fibroblasts and the group of cells after incubation with LDL.

In addition, it was shown that in the control group of macrophages, LDLR expression was significantly lower than in the control group of VSMCs from the tunica intima (p < 0.01) and in VSMCs from the tunica intima after incubation with LDL (p < 0.001). Furthermore, in the control group of VSMCs from the tunica media, LDLR expression was significantly higher than in the control group of macrophages (p < 0.05) (Figure 5).

2.4.2. IL6 Expression

In addition, it was shown that in VSMCs isolated from the tunica intima, IL-6 expression decreased after incubation with LDL compared to the control group (p < 0.05). There was no statistically significant increase in IL-6 expression in fibroblasts after incubation with LDL compared with the control. There were no statistically significant differences in IL-6 gene expression among the studied groups within the macrophage cell line.

It is worth noting that the expression of IL-6 in macrophages without the addition of substances was significantly lower than in VSMCs isolated from the tunica intima—both without the addition of substances (p < 0.001) and after incubation with LDL (p < 0.001). In addition, in VSMCs from the tunica media—both without the addition of LDL (p < 0.001) and after incubation with LDL (p < 0.001)—IL-6 expression was significantly higher than in the control group of macrophages (Figure 5).

2.4.3. IL8 Expression

Statistical analysis showed a significant increase in IL-8 expression in the control group of VSMCs from the tunica media compared with the group of cells after incubation with LDL (p < 0.001). No statistically significant differences were found within the cell lines of macrophages and VSMCs from the tunica intima.

A significant increase in IL-8 expression was observed in fibroblasts after incubation with LDL compared with the control group. However, in the group of macrophages without the addition of LDL, IL-8 expression was significantly higher than in VSMCs isolated from the tunica intima—both without the addition of LDL (p < 0.001) and after incubation with LDL (p < 0.01).

Similarly, in VSMCs isolated from the tunica intima and in VSMCs from the tunica media—both without the addition of substances (p < 0.001) and after incubation with LDL (p < 0.001)—IL-8 expression was significantly lower than in the control group of macrophages (Figure 5).

2.4.4. Expression of CD36, IL1B and CCL2

During PCR analysis, we found that the CD36 gene was expressed exclusively in the macrophage cell line. Moreover, its expression increased significantly in the group of cells after incubation with LDL compared with the control group (p < 0.01) (Figure 5).

The study also showed that IL1B is expressed only in the macrophage cell line, whereas its expression was low in VSMCs. No statistically significant differences in IL1B expression were observed between groups within VSMCs isolated from the tunica intima and in fibroblasts. Notably, in the group of macrophages after incubation with LDL, there was a significant increase in IL1B expression compared with the control group of cells (p < 0.05).

Furthermore, IL1B expression in the control group of macrophages was significantly higher than in VSMCs isolated from the tunica intima—both without the addition of LDL (p < 0.001) and after incubation with LDL (p < 0.001). Additionally, IL1B expression in the control group of macrophages exceeded that in both the control group of VSMCs from the tunica media (p < 0.001) and VSMCs from the tunica media after incubation with LDL (p < 0.001) (Figure 5).

Analysis of CCL2 gene expression revealed that its expression in the control group of macrophages was significantly lower than in the control groups of both VSMCs from the tunica intima (p < 0.001) and VSMCs from the tunica media (p < 0.001). Moreover, after incubation with LDL, CCL2 expression in VSMCs from the tunica media was significantly lower than in the control group (p < 0.01) (Figure 5).

3. Discussion

The role of the molecular mechanisms involved in the development of CVDs is still not fully understood. This comprehensive study revealed the putative molecular mechanisms leading to the phenotypic modulation of VSMCs, as well as to the internalization of LDL and changes in the secretory profile between key cell populations of the vascular wall: VSMCs, fibroblasts and macrophages. These data reveal potential cellular and molecular mechanisms leading to the development of CVDs.

In our study, we showed that in CVDs, the cells of the vascular wall can change their functional features. Thus, VSMCs and fibroblasts, which are normally responsible for maintaining vascular tone and secretion of ECM, can actively accumulate LDL during the development of CVDs and, as a result, secrete pro-inflammatory cytokines, namely IL-6, IL-1β, and CCL2.

This may be due to the fact that during the development of an aneurysm, fibroblasts in the vessel wall change their functions and, instead of maintaining the vessel structure, begin to actively participate in the secretion of pro-inflammatory cytokines and chemokines. All these processes lead to degradation of the ECM, vascular remodeling, and further inflammation, contributing to the growth of the aneurysm and its subsequent rupture [10]. One study showed that adventitial fibroblasts exhibited high levels of IL-6 and CCL2 secretion [11]. In our study, we also demonstrate that the secretion of IL-6, CCL2 and IL-8 increases in fibroblasts after incubation with LDL. This facts may indicate that adventitial fibroblasts may be key moderators of inflammation in the vascular wall.

Using PCR analysis, we demonstrated that the expression of IL8 increases in fibroblasts after incubation with LDL, but no increase in the expression of IL6 and CCL2 was detected. In a study on mice with Marfan syndrome, researchers showed that at a late stage of aortic aneurysm development, an increase in IL-6 secretion leads to destruction of the ECM and expansion of the aneurysm, while a decrease in IL-6 secretion, on the contrary, leads to a delay in vessel expansion [12]. However, many studies suggest that an increase in IL-6 secretion does not always lead to an increase in its expression, since IL-6 acts as a signaling molecule, inducing other cells (for example, VSMCs) through paracrine signaling [13,14] or activation of STAT3 protein transcription [15], while fibroblasts themselves can regulate their own output through feedback loops [16] or rely on other factors (e.g., AUF1) to control mRNA stability. That is, IL-6 secretion can increase dramatically without a significant and sustained increase in the transcription of the gene for IL-6, or it can be strictly controlled by the response to damage, rather than just its production. In addition, an increase in CCL2 secretion in fibroblasts, without increasing the expression of the CCL2 gene, may be due to the fact that high concentrations of the CCL2 chemokine molecule activate the expression of various genes associated with the development of inflammation in the vessel wall (for example, the collagen gene) and/or attract cells of the immune system (monocytes, macrophages) to the site of inflammation [17]. At the same time, the expression level of CCL2 in fibroblasts, on the contrary, decreases, which indicates a shift in the normal function of fibroblasts, where CCL2 acts more as a signal for the recruitment of various cells than as a universal activator of all fibroblast genes [18]. One of the main reasons presumably leading to these disorders may be that the secretion of CCL2 by fibroblasts to attract immune response cells to the site of inflammation in the vessel wall can take place via various molecular signaling pathways. For example, the TGF-β signaling pathway is normally responsible for regulating fundamental cellular processes such as cell growth, differentiation, migration, and apoptosis, which are essential for normal tissue development and repair, as well as for the normal functioning of the immune system [19]. However, with the development of an aortic aneurysm, disorders in the functioning of this signaling pathway may occur, which leads to active secretion of CCL2 by fibroblasts and the development of fibrous state of fibroblasts; as a result, their phenotype shifts from normal to pathological, and the expression of many genes, for example, collagen genes (COL1A1, COL3A1) [20] and the CCL2 gene, decreases [21].

In addition, another potential reason leading to an increase in CCL2 secretion and a decrease in CCL2 expression in fibroblasts may be the inhibition of the CCL2/CCR2 signaling pathway, which occurs due to high concentrations of the chemokine CCL2 in the body [22]. Normally, the CCL2/CCR2 signaling pathway is responsible for binding the CCL2 chemokine to its CCR2 receptor, primarily initiating the attraction of monocytes and macrophages to sites of inflammation, infection, or injury, stimulating immune responses and tissue remodeling [23]. This interaction also activates signaling pathways, including PI3K/AKT and MAPK [24], which affects the normal cell cycle. However, inhibition of CCL2/CCR2 can lead to functional disorders of fibroblasts, which may contribute to the development of various pathological conditions.

Thus, the results of the study allow us to suggest that fibroblasts play a key role in the development of inflammation in the vascular wall, and the accumulation of LDL by fibroblasts leads to increased secretion of pro-inflammatory cytokines IL-6 and IL-8 and chemokine CCL2, while the expression of the corresponding genes does not increase. This phenomenon can be explained by a number of mechanisms: activation of paracrine signaling and transcription of the STAT3 protein for IL-6, dysfunction of the TGF-β signaling pathway, leading to a pathological shift in the fibroblast phenotype, and inhibition of the CCL2/CCR2 signaling pathway due to high concentrations of CCL2, which disrupts normal immune responses and tissue remodeling processes.

In the course of this work, immunofluorescence analysis and RT-qPCR confirmed the smooth muscle phenotype of primary aortic VSMCs (expression of smooth muscle markers ACTA2, MYH11 and CNN1). However, when analyzing the internalization of LDL using BDP dye, it was found that VSMCs from the tunica intima and VSMCs from the tunica media actively accumulate LDL compared to the control groups. However, the fluorescence of the BDP dye in VSMCs after incubation with LDL was significantly lower than in macrophages after incubation with LDL. This may indicate that VSMCs are not normally the main cells responsible for LDL internalization, but in pathological conditions (for example, aneurysm) they can acquire a macrophage-like phenotype, initiating the accumulation of cholesterol [4].

We demonstrated significant changes in the secretion and expression of pro-inflammatory cytokines (IL-6, IL-8, CCL2) in VSMCs from both the tunica intima and tunica media during aneurysm development. Specifically, in tunica intima VSMCs, IL6 expression decreased significantly after 24 h of LDL incubation compared to control, though no significant change in IL-6 secretion was observed in primary VSMCs. The results obtained may be due to various molecular and cellular mechanisms [25]. LDL likely disrupts VSMCs metabolism—including lipid pathways and oxidative stress—potentially inhibiting transcription factors that regulate the expression of IL6 [26]. Thus, LDL or certain components of the LDL molecule can trigger inflammatory signaling pathways (such as NF-κB, ROS), which leads to an initial increase in the level of IL6 expression, resulting in an increase in the concentration of the IL-6 cytokine in the body [27,28]. Meanwhile, prolonged exposure to LDL can induce negative regulators (for example, SOCS3 and SHP-2), which leads to repression of the IL6 gene and, consequently, a decrease in its expression level, while the concentration of IL-6 in the body remains high [29]. So, in a recent study on endothelial cells, it was shown that no significant differences in IL-6 secretion were found during incubation with LDL for 3 h; however, after incubation with LDL for 24 h, a significant increase in IL-6 secretion was observed [30]. In our study, incubation of VSMCs with LDL lasted for 24 h, and therefore it can be assumed that the mechanism described above may be one of the key mechanisms in triggering the phenotypic modulation of VSMCs and the further development of inflammation in the vessel wall.

We did not find statistically significant changes in IL-6 secretion and expression in primary VSMCs from the tunica media. However, we showed that after incubation with LDL, there is a decrease in the expression levels of IL8 and CCL2 in VSMCs from the tunica media. This may be due to the fact that with the development of an aneurysm, VSMCs change their phenotype from a normal contractile state to a pathological (macrophage-like or synthetic) one [4], resulting in inhibition of the PI3K/AKT signaling pathway, which is responsible for the normal functioning of the cell and its apoptosis in the presence of functional disorders. In addition, when cholesterol accumulates in vascular VSMCs, alternative metabolic or stress signaling pathways (for example, JAK-STAT and the ECM remodeling pathway) can be activated [31,32], which may inhibit pro-inflammatory signaling cascades, thereby reducing the expression of IL8 and CCL2 genes.

Considering that the IL-8 cytokine is involved in attracting immune cells, namely neutrophils [33], and the CCL2 chemokine recruits monocytes to the site of inflammation [23], which contributes to the development of atherosclerosis and aneurysms, it can be assumed that a decrease in their expression may indicate a restructuring of the inflammatory response in the vessel wall and, consequently, the progression of CVD development.

In our study, we demonstrated that macrophages actively secrete and express the pro-inflammatory cytokine IL-1β at levels exceeding those observed in other cell lines. Notably, both IL-1β expression and secretion by macrophages increased significantly following LDL incubation.

These findings align with the established role of macrophages in vascular inflammation: they produce IL-1β, a key mediator that amplifies the inflammatory response. IL-1β contributes to aneurysm development by promoting VSMC apoptosis, compromising vessel wall integrity, stimulating matrix metalloproteinases (MMPs) to degrade the extracellular matrix, and perpetuating a self-sustaining inflammatory cycle. Consequently, the IL-1β-mediated interaction between macrophages and VSMCs drives vascular remodeling, weakens the vessel wall, and elevates the risk of rupture [34,35,36].

In addition, we have shown that there is an increase in IL-6 and IL-8 secretion in macrophages after incubation with LDL. This may indicate that elevated cholesterol levels promote LDL binding to the cell surface and its subsequent delivery to the endosomes. This activates the NF-κB pathway, which stimulates the synthesis of pro-inflammatory mediators, including cytokines, chemokines, and adhesive molecules. Activation of the NF-κB pathway in macrophages stimulates their transformation into foam cells, which exacerbates inflammation and the development of CVDs.

In a recent study, scientists demonstrated that patients with intracranial aneurysm have an increased concentration of CD36 in blood plasma compared with the control group [37]. In our study, we also demonstrated that increased expression of the CD36 scavenger receptor was observed in macrophages during LDL internalization. This may be due to the fact that CD36 mediates the formation of reactive oxygen species (ROS) and contributes to the development of inflammation in the vascular wall by activating the NLRP3 inflammasome [38]. In addition, it can be assumed that CD36 can also increase the expression and phosphorylation of focal adhesion kinase, thereby promoting the expression of MMPs [39], which, as described above, contribute to the destruction of the ECM and, consequently, to thinning and rupture of the vessel wall. Thus, CD36 can be a marker for the diagnosis of patients with aneurysm or atherosclerosis.

It is worth noting that our study has a number of limitations. The present study was performed mainly on cell cultures (VSMCs, fibroblasts and macrophages) in vitro, which does not fully reflect the complexity of in vivo processes in the vascular wall. The culture lacks key systemic factors: hemodynamic load, neuroendocrine regulation, and intercellular interactions in the three-dimensional architecture of the tissue. This limits the extrapolation of the data obtained to the whole organism and requires validation in experimental animal models or clinical observations.

It is also worth noting that in the framework of this study, we worked with VSMCs isolated from the thoracic aorta. This choice is due to the peculiarities of abdominal aortic aneurysms: patients with this disease often develop atherosclerosis, as a result of which the intima of the abdominal aorta becomes thinner and contains many atherosclerotic plaques and calcifications [40]. This significantly complicates the isolation of VSMCs from the abdominal aorta. Despite the noticeable anatomical similarity of thoracic and abdominal aortic aneurysms, their pathophysiological mechanisms show marked differences [41]. Therefore, VSMCs isolated from the abdominal aorta are also an interesting object for further study.

In our study, we initially tested our hypothesis. However, further research is needed to confirm the molecular data and clarify the specific mechanisms involved in the development of CVDs. For example, Western blotting can be performed to supplement the data obtained on inflammatory cytokines (IL-1β, IL-6, IL-8 and CCL2). In addition, the study focuses on the suspected activation of the NF-κB, TGF-β and CCL2/CCR2 pathways, but does not cover the entire spectrum of mediators (e.g., TNF-α, IL-10) and alternative signaling cascades (JAK-STAT, Nrf2), which are also involved in inflammation and vascular remodeling. Liquid chromatography–mass spectrometry (LC–MS) can help determine which proteins are involved in the development of CVDs. It is also worth mentioning that single-cell sequencing experiments can also be used to confirm our results on the phenotypic modulation of VSMCs.

4. Materials and Methods

4.1. Ethical Expertise

The study protocol was approved by the Local Ethics Committee of Petrovsky National Research Center of Surgery, Moscow, Russia (No. 8, 20 October 2022). The study was conducted in accordance with the Declaration of Helsinki of 1975 and its revised version of 2013. All the participants signed written informed consent to participate in the study.

4.2. Studied Material

The main objects of the study were cell lines of macrophages (PMA-induced THP-1 macrophages (ATCC, Manassas, VA, USA)), fibroblasts 977hTERT (ATCC, Manassas, VA, USA) and primary culture of VSMCs isolated from tunica intima and tunica media of human aorta. All experiments on cell lines were performed in 10 replicates. Thus, 4 cell lines were included in the study.

We selected the THP-1 cell line as the control because it serves as the standard for CVD research and accurately reflects key pathogenetic processes such as transformation into foam cells, inflammatory reactions to lipid metabolism disorders and cytokine secretion. This makes THP-1 an ideal model for investigating the mechanisms of vascular pathology development and testing novel therapeutic approaches [42]. Furthermore, THP-1 exhibits stable cellular characteristics, enabling us to assess the validity and reliability of the employed methods.

The aortic wall samples (n = 10) were obtained during surgical replacement of the thoracic aorta. The study included patients with an aneurysm of atherosclerotic origin. The average age of the patients was 70 years. Taking into account the general nosology of patients, in these groups, there was no statistically significant influence of gender and age or the features of the disease course on the studied parameters.

The isolation of primary VSMCs was carried out according to a previously described protocol [43]. Primary SMCs were isolated via enzymatic digestion of the vessel wall with type I collagenase, followed by incubation at 37 °C in a 5% CO₂ atmosphere. After, VSMCs were seeded on 24-well plates in 0.6 mL DMEM/F12 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) with 10% fetal bovine serum (FBS) (Biowest, Nuaillé, France), Penicillin–Streptomycin (STEMCELL, Cambridge, UK), and 2 mM L-glutamine (Thermo Fisher Scientific, Waltham, MA, USA) in a 5% CO₂ humidified atmosphere at 37 °C. In our study we used cells at passages 2–7.

To study the phagocytic activity, primary VSMCs and fibroblasts were seeded on 24-well plates (600 thousand cells per well) in 0.6 mL DMEM/F12 with 10% FBS. THP-1 cells were grown in RPMI-1640 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and supplemented with 10% FBS, Penicillin–Streptomycin, and 3.6 μL 2-Mercaptoethanol (Merck, Darmstadt, Germany) in a 5% CO₂ humidified atmosphere at 37 °C. THP-1 monocytes were differentiated to macrophages by incubation with 200 ng/mL PMA (Thermo Fisher Scientific, Waltham, MA, USA) for 2 days.

4.3. Immunocytochemistry

The immunophenotyping procedure involved labeling primary VSMCs with specific antibody markers targeting key proteins. The primary antibodies used were directed against the following:

• Smooth muscle actin (ACTA2) (dilution 1:100, provided by Abcam, Cambridge, UK, ab220179);
• Calponin 1 (CNN1) (dilution 1:100, supplied by Cloud-Clone Corp., Houston, TX, USA, PAJ419Hu01);
• Myosin heavy chain 11 (MYH11) (dilution 1:100, provided by Cloud-Clone Corp., Houston, TX, USA, PAD420Hu01).

All antibody applications were performed according to the manufacturers’ recommended protocols.

The detection system utilized secondary antibodies for visualization: Goat Anti-Mouse IgG H + L (PE) (dilution 1:100, Abcam, UK, ab97024) and Goat Anti-Rabbit IgG H + L (FITC) (dilution 1:100, Abcam, UK, ab6717). Nuclear staining was achieved using DAPI (supplied by BioFroxx, Einhausen, Germany, 28718-90-3).

Mounting preparation employed Aqueous Mounting Medium (provided by Abcam, Cambridge, UK, ab128982) for slide preparation.

Fluorescence imaging was conducted using the Leica DM4000 B LED microscopy system (Leica Biosystems, Wetzlar, Germany). Data acquisition and analysis were performed with the accompanying LAS-AF viewer software (version 3.1.0 build 8587).

4.4. Incubation with LDL

The study involved isolation of atherogenic low-density lipoproteins (LDLs) from blood serum samples collected from patients with CVDs. The serum pool was obtained from patients with atherosclerotic CVDs. The serum was obtained from 15 patients, whose average age was 70.5 years.

Sample preparation was performed via ultracentrifugation following an established protocol. The isolated LDL (concentration 100 μg/mL) was introduced into cell cultures maintained in serum-free medium, followed by a 24 h incubation period. A separate control cell population was cultured under identical conditions but without LDL supplementation.

Cells were detached from the culture plates using a 0.25% trypsin solution. Subsequently, the experimental cells were plated onto 3.5 cm glass-bottom dishes at a density of 50,000 cells per dish in 150 μL of culture medium. Cultivation continued for 24 h under standard conditions: 37 °C temperature, 5% CO₂ atmosphere, and controlled humidity.

The fixation procedure utilized a 4% paraformaldehyde solution. To evaluate intracellular lipid accumulation, a specialized fluorescent lipid stain BDP 630/650 (5 mM, Lumiprobe, Moscow, Russia) was employed [44].

Staining methodology consisted of fixing cells in 4% PFA for 20 min at 37 °C in darkness, followed by washing with PBS solution. Fluorescence intensity measurements of the BDP 630/650 dye were conducted in both control and LDL-treated cell groups (n = 50 samples per group) using ImageJ 1.54p software analysis.

In our work, we studied 2 groups of study cells: the control group without LDL (contr) and the group after incubation with LDL (LDL).

4.5. RNA Isolation and Reverse Transcription Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)

The isolation of total RNA from cultured cell lines was carried out using a kit for isolating total RNA based on the Lyra reagent (Biolabmix, Novosibirsk, Russia). To remove genomic DNA residues, the concentration of total nucleic acids was adjusted to 200 μg/mL; after this, a tenfold DNase buffer containing MgCl₂ (Life Technologies, Carlsbad, CA, USA) and 1 μL of DNase (Invitrogen, Thermo Fisher Scientific, USA) was added, and the mixture was incubated at 37 °C for 30 min. The concentration and purity of the obtained RNA were determined using an Implen NanoPhotometer N60 (Implen, Munich, Germany).

For reverse transcription, the M-MuLV–RH First Strand cDNA Synthesis Kit (Biolabmix, Russia) was used. In total, 6 μL (5 μg) of RNA was mixed with 3 μL of oligo (dT) and 3 μL of deionized water and incubated for 3 min at 70 °C. A further 4 μL of 5X × RT buffer mix (Biolabmix, Russia), 1 μL of 10 mM M-MuLV–RH revertase (100 u/μL) (Biolabmix, Russia) and 3 μL of deionized water were used for the reverse transcription reaction. Incubation continued for 60 min at 42 °C.

The expression of genes in the studied cell lines was determined by qPCR (Real-Time PCR) on a LightCycler 96 (ROCHE, Grenzach-Wyhlen, Germany). For amplification, we used gene-specific primers—ACTB (actin beta), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), LDLR (the LDL receptor), IL6 (interleukin-6), IL8 (interleukin-8), CD36 (cluster of differentiation 36), IL1B (interleukin-1 beta), CCL2 (C-C motif chemokine ligand 2), Desmin, MYH11 and CNN1—and the reaction mixture 5X qPCRmix-HS SYBR (Evrogen, Russia). The primers were ordered from Lumiprobe (Lumiprobe, Russia) (

Table 3. The sequences of primers used in the work.

Gene	Forward Primer 5’-3’	Reverse Primer 5’-3’
ACTB	CACCATTGGCAATGAGCGGTTC	AGGTCTTTGCGGATGTCCACGT
GAPDH	ACTTTGGTATCGTGGAAGGACT	GTAGAGGCAGGGATGATGTTCT
LDLR	GGTCCAGTAGATGTTGCTGTGG	GAATCTACTGGTCTGACCTGTCC
IL6	AGACAGCCACTCACCTCTTCAG	TTCTGCCAGTGCCTCTTTGCTG
IL8	GAGAGTGATTGAGAGTGGACCAC	CACAACCCTCTGCACCCAGTTT
CD36	CAGGTCAACCTATTGGTCAAGCC	GCCTTCTCATCACCAATGGTCC
IL1B	AGCTCGCCAGTGAAATGATG	GGTGGTCGGAGATTCGTAGC
CCL2	CAGCCAGATGCAATCAATGCC	TGGAATCCTGAACCCACTTCT
Desmin	TCCAGTCCTACACCTGCGAGAT	CGCAATGTTGTCCTGGTAGCCA
MYH11	GTCCAGGAGATGAGGCAGAAAC	GTCTGCGTTCTCTTTCTCCAGC
CNN1	CCAACGACCTGTTTGAGAACACC	ATTTCCGCTCCTGCTTCTCTGC

).

The specificity of the primers was tested using the Primer-BLAST (NCBI) service (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 27 September 2025).

qPCR reactions were performed in a total volume of 25 μL using 2 μL of cDNA (100 ng), 2 μL of forward and reverse primers (0.4 μM), 5 μL of qPCRmix-HS SYBR and 16 μL of deionized water.

qPCR was performed with pre-denaturation for 5 min at 95 °C; the next 40 cycles included denaturation for 15 s at 95 °C, annealing for 30 s at 62 °C and elongation for 30 s at 72 °C. For each sample, the qPCR reaction was performed at least three times.

The relative expression of target genes (LDLR, IL6, IL8, CD36, IL1B and CCL2) in the studied cell lines was calculated using the formula 2^−ΔΔCt. ACTB and GAPDH were used as reference genes. Expression in different groups of the studied cell lines was calculated relative to expression in the group of macrophages without LDL.

The relative expression of smooth muscle markers (Desmin, CNN1, and MYH11) in the primary VSMCs from tunica intima and VSMCs from tunica media was calculated relative to the household gene, ACTB, using the following formula:

$${\displaystyle \frac{2^{\mathrm{C}\mathrm{t}\left(\mathrm{A}\mathrm{C}\mathrm{T}\mathrm{B}\right)}}{2^{\mathrm{C}\mathrm{t}(\mathrm{T}\mathrm{h}\mathrm{e} \mathrm{g}\mathrm{e}\mathrm{n}\mathrm{e} \mathrm{o}\mathrm{f} \mathrm{i}\mathrm{n}\mathrm{t}\mathrm{e}\mathrm{r}\mathrm{e}\mathrm{s}\mathrm{t})}}} \times 100.$$

4.6. ELISA

The conditioning cell culture media was collected from each well of the plates for enzyme-linked immunosorbent assay (ELISA) analysis. To evaluate inflammatory processes associated with aortic aneurysm, we quantified the levels of key inflammatory markers: IL-6, IL-8, (IL-1β), and monocyte chemoattractant protein-1 (MCP-1/CCL2).

The measurement of proinflammatory cytokine concentrations in the culture supernatants was performed using commercially available DuoSet ELISA kits (R&D Systems, Minneapolis, MN, USA), following the manufacturer’s recommended protocol.

The experimental design included analysis of 4 cell lines, with each line comprising 2 experimental groups. To ensure reliability and reproducibility of the results, all cytokine measurements were conducted in triplicate for each experimental condition.

4.7. Statistical Analysis for BDP Intensity, PCR and ELISA

Statistical data analysis was performed using the Python 3.10.4 programming language and the SciPy 1.15.1 and sci-kit-learn libraries. Statistical significance was assessed using the Kruskal–Wallis test and the Conover multiple-comparison test. A t-test was used for pairwise comparison. For all results, p < 0.05 was considered significant. All values were normalized by scaling to minimum and maximum values (min–max scaler).

5. Conclusions

Thus, the molecular mechanisms of the development of CVDs are characterized by a complex interrelation of cellular and biochemical processes in the vascular wall. Phenotypic changes in smooth muscle cells, fibroblasts, and macrophages play a key role in pathogenesis; these cells acquire pro-inflammatory properties when exposed to LDL.

Thus, fibroblasts, when exposed to LDL, enhance the secretion of pro-inflammatory cytokines (IL-6 and IL-8) and the chemokine CCL2. This secretion does not always correlate with the expression level of the corresponding genes, which indicates the involvement of alternative regulatory mechanisms, such as paracrine signaling, STAT3, TGF-β, and CCL2/CCR2 pathways.

During the development of cardiovascular diseases, VSMCs change their phenotype from contractile to macrophage-like and accumulate cholesterol. This process is accompanied by a decrease in IL8 and CCL2 gene expression, probably due to inhibition of the PI3K/AKT pathway and activation of stress-responsive signaling cascades, such as the JAK-STAT pathway and ECM remodeling pathways.

When incubated with LDL, macrophages actively secrete IL-1β, increasing inflammation, provoking apoptosis of smooth muscle cells and degradation of the extracellular matrix through matrix metalloproteinases. In addition, they increase the expression of the CD36 receptor, which can become a marker of aneurysm and atherosclerosis.

The data obtained deepen the understanding of the molecular basis of cardiovascular diseases, emphasizing the importance of intercellular interactions, signaling pathways, and metabolic disorders. This opens up prospects for the search for new therapeutic targets and diagnostic markers in the fight against cardiovascular diseases.