Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Samples and Culture Conditions
2.2. Reagents
2.3. Determination of MIC and MBC
2.4. Determination of Growth Curve
2.5. Determination of Biofilm Formation Ability
2.6. Determination of Biofilm Metabolic Activity
2.7. Determination of Cell Wall Integrity
2.8. Determination of CAT, SOD and ROS
2.9. Determination of MDA Content
2.10. Determination of Nucleic Acid and Protein Leakage
2.11. Determination of Conductivity
2.12. Motility
2.13. RNA Extraction and Gene Expression Analysis
2.14. SEM Observation
2.15. Statistical Analysis
3. Results
3.1. Inhibition of FPPPs on V. alginolyticus
3.2. Inhibition of FPPPs on Biofilm Formation of V. alginolyticus
3.3. Inhibition of FPPPs on Biofilm Metabolic Activity of V. alginolyticus
3.4. Effect of FPPPs on AKP Activity of V. alginolyticus
3.5. Effect of FPPPs on Oxidative Stress Indexes of V. alginolyticus
3.6. Effects of FPPPs on Protein and Nucleic Acid Leakage of V. alginolyticus
3.7. Effect of FPPPs on the Conductivity of V. alginolyticus Culture Medium
3.8. Inhibition of FPPPs on the Motility of V. alginolyticus
3.9. Effect of FPPPs on Cell Morphology of V. alginolyticus Under SEM
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Baker-Austin, C.; Oliver, J.D.; Alam, M.; Ali, A.; Waldor, M.K.; Qadri, F.; Martinez-Urtaza, J. Vibrio spp. infections. Nat. Rev. Dis. Primers 2018, 4, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Zhou, K.; Tian, K.-Y.; Liu, X.-Q.; Liu, W.; Zhang, X.-Y.; Liu, J.-Y.; Sun, F. Characteristic and Otopathogenic Analysis of a Vibrio alginolyticus Strain Responsible for Chronic Otitis Externa in China. Front. Microbiol. 2021, 12, 750642. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, H.A.; El Bayomi, R.M.; Hussein, M.A.; Khedr, M.H.E.; Abo Remela, E.M.; El-Ashram, A.M.M. Molecular characterization, antibiotic resistance pattern and biofilm formation of Vibrio parahaemolyticus and V. cholerae isolated from crustaceans and humans. Int. J. Food Microbiol. 2018, 274, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Lipový, B.; Mager, R.; Raška, F.; Hanslianová, M.; Blažek, J.; Křemečková, H.; Suchánek, I.; Hladík, M. Vibrio vulnificus-Induced Necrotizing Fasciitis Complicated by Multidrug-Resistant Acinetobacter baumannii Infection: Efficacy of Chemical Necrectomy Using 40% Benzoic Acid. Int. J. Low. Extrem. Wounds 2021, 22, 200–207. [Google Scholar] [CrossRef]
- Yang, B.; Zhai, S.; Zhang, F.; Wang, H.; Ren, L.; Li, Y.; Li, Q.; Liu, S. Genome-wide association study toward efficient selection breeding of resistance to Vibrio alginolyticus in Pacific oyster, Crassostrea gigas. Aquaculture 2022, 548, 737592. [Google Scholar] [CrossRef]
- Mohamad, N.; Mohd Roseli, F.A.; Azmai, M.N.A.; Saad, M.Z.; Md Yasin, I.S.; Zulkiply, N.A.; Nasruddin, N.S. Natural Concurrent Infection of Vibrio harveyi and V. alginolyticus in Cultured Hybrid Groupers in Malaysia. J. Aquat. Anim. Health 2019, 31, 88–96. [Google Scholar] [CrossRef]
- Yin, X.; Zhuang, X.; Liao, M.; Huang, L.; Cui, Q.; Liu, C.; Dong, W.; Wang, F.; Liu, Y.; Wang, W. Transcriptome analysis of Pacific white shrimp (Litopenaeus vannamei) hepatopancreas challenged by Vibrio alginolyticus reveals lipid metabolic disturbance. Fish Shellfish Immunol. 2022, 123, 238–247. [Google Scholar] [CrossRef]
- Mao, F.; Liu, K.; Wong, N.-K.; Zhang, X.; Yi, W.; Xiang, Z.; Xiao, S.; Yu, Z.; Zhang, Y. Virulence of Vibrio alginolyticus Accentuates Apoptosis and Immune Rigor in the Oyster Crassostrea hongkongensis. Front. Immunol. 2021, 12, 746017. [Google Scholar] [CrossRef]
- Jones, E.H.; Feldman, K.A.; Palmer, A.; Butlera, E.; Blythe, D.; Mitchell, C.S. Vibrio Infections and Surveillance in Maryland, 2002–2008. Public Health Rep. 2013, 128, 537–545. [Google Scholar] [CrossRef]
- Reilly, G.D.; Reilly, C.A.; Smith, E.G.; Baker-Austin, C. Vibrio alginolyticus-associated wound infection acquired in British waters, Guernsey, July 2011. Eurosurveillance 2011, 16, 19994. [Google Scholar] [CrossRef]
- Jacobs Slifka, K.M.; Newton, A.E.; Mahon, B.E. Vibrio alginolyticus infections in the USA, 1988–2012. Epidemiol. Infect. 2017, 145, 1491–1499. [Google Scholar] [CrossRef] [PubMed]
- Osunla, C.A.; Okoh, A.I. Vibrio Pathogens: A Public Health Concern in Rural Water Resources in Sub-Saharan Africa. Int. J. Environ. Res. Public Health 2017, 14, 1188. [Google Scholar] [CrossRef] [PubMed]
- Kang, C.-H.; Shin, Y.; Jang, S.; Jung, Y.; So, J.-S. Antimicrobial susceptibility of Vibrio alginolyticus isolated from oyster in Korea. Environ. Sci. Pollut. Res. 2016, 23, 21106–21112. [Google Scholar] [CrossRef] [PubMed]
- Nurhafizah, W.W.I.; Lee, K.L.; Razak, L.A.A.; Nadirah, M.; Danish-Daniel, M.; Zainathan, S.C.; Najiah, M. Virulence properties and pathogenicity of multidrug-resistant Vibrio harveyi associated with luminescent vibriosis in Pacific white shrimp, Penaeus vannamei. J. Invertebr. Pathol. 2021, 186, 107594. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Wang, H.; Ma, Z.; Liu, Y.; Wu, Z.; Xu, H.; Qiao, M. Characterization of Proteus vulgaris Strain P3M, a Foodborne Multidrug-Resistant Bacterium Isolated from Penaeus vannamei in China. Microb. Drug Resist. 2021, 27, 1360–1370. [Google Scholar] [CrossRef]
- Faleye, O.S.; Sathiyamoorthi, E.; Lee, J.-H.; Lee, J. Inhibitory Effects of Cinnamaldehyde Derivatives on Biofilm Formation and Virulence Factors in Vibrio Species. Pharmaceutics 2021, 13, 2176. [Google Scholar] [CrossRef]
- Soowannayan, C.; Boonmee, S.; Puckcharoen, S.; Anatamsombat, T.; Yatip, P.; Ng, W.-K.; Thitamadee, S.; Tuchinda, P.; Munyoo, B.; Chabang, N.; et al. Ginger and its component shogaol inhibit Vibrio biofilm formation in vitro and orally protect shrimp against acute hepatopancreatic necrosis disease (AHPND). Aquaculture 2019, 504, 139–147. [Google Scholar] [CrossRef]
- Sun, X.-h.; Hao, L.-r.; Xie, Q.-c.; Lan, W.-q.; Zhao, Y.; Pan, Y.-j.; Wu, V.C.H. Antimicrobial effects and membrane damage mechanism of blueberry (Vaccinium corymbosum L.) extract against Vibrio parahaemolyticus. Food Control 2020, 111, 107020. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhao, Y.; Cai, J.; Wang, T.; Song, Y.; Lu, J.; Du, H.; Wang, W.; Zhao, Y.; Guo, L. Optimized Extraction, Identification and Anti-Biofilm Action of Wu Wei Zi (Fructus Schisandrae Chinensis) Extracts against Vibrio parahaemolyticus. Molecules 2023, 28, 2268. [Google Scholar] [CrossRef]
- Tan, X.; Sun, Z.; Ye, C.; Lin, H. The effects of dietary Lycium barbarum extract on growth performance, liver health and immune related genes expression in hybrid grouper (Epinephelus lanceolatus♂ × E. fuscoguttatus♀) fed high lipid diets. Fish Shellfish Immunol. 2019, 87, 847–852. [Google Scholar] [CrossRef]
- Chen, Z.; Liu, L.; Gao, C.; Chen, W.; Vong, C.T.; Yao, P.; Yang, Y.; Li, X.; Tang, X.; Wang, S.; et al. Astragali Radix (Huangqi): A promising edible immunomodulatory herbal medicine. J. Ethnopharmacol. 2020, 258, 112895. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Zhang, W.; Xu, Y.; Chen, L.; Cao, J.; Jiang, W. An advance on nutritional profile, phytochemical profile, nutraceutical properties, and potential industrial applications of lemon peels: A comprehensive review. Trends Food Sci. Technol. 2022, 124, 219–236. [Google Scholar] [CrossRef]
- Elumalai, P.; Kurian, A.; Lakshmi, S.; Faggio, C.; Esteban, M.A.; Ringø, E. Herbal Immunomodulators in Aquaculture. Rev. Fish. Sci. Aquac. 2020, 29, 33–57. [Google Scholar] [CrossRef]
- Van Hai, N. The use of medicinal plants as immunostimulants in aquaculture: A review. Aquaculture 2015, 446, 88–96. [Google Scholar] [CrossRef]
- Shi, H.; Li, X.; Hou, C.; Chen, L.; Zhang, Y.; Li, J. Effects of Pomegranate Peel Polyphenols Combined with Inulin on Gut Microbiota and Serum Metabolites of High-Fat-Induced Obesity Rats. J. Agric. Food Chem. 2023, 71, 5733–5744. [Google Scholar] [CrossRef]
- Song, B.; Li, J.; Li, J. Pomegranate peel extract polyphenols induced apoptosis in human hepatoma cells by mitochondrial pathway. Food Chem. Toxicol. 2016, 93, 158–166. [Google Scholar] [CrossRef]
- Smaoui, S.; Hlima, H.B.; Mtibaa, A.C.; Fourati, M.; Sellem, I.; Elhadef, K.; Ennouri, K.; Mellouli, L. Pomegranate peel as phenolic compounds source: Advanced analytical strategies and practical use in meat products. Meat Sci. 2019, 158, 107914. [Google Scholar] [CrossRef]
- Colantuono, A.; Ferracane, R.; Vitaglione, P. In vitro bioaccessibility and functional properties of polyphenols from pomegranate peels and pomegranate peels-enriched cookies. Food Funct. 2016, 7, 4247–4258. [Google Scholar] [CrossRef]
- Suručić, R.; Travar, M.; Petković, M.; Tubić, B.; Stojiljković, M.P.; Grabež, M.; Šavikin, K.; Zdunić, G.; Škrbić, R. Pomegranate peel extract polyphenols attenuate the SARS-CoV-2 S-glycoprotein binding ability to ACE2 Receptor: In silico and in vitro studies. Bioorg. Chem. 2021, 114, 105145. [Google Scholar] [CrossRef]
- Chen, X.; Zhang, H.; Li, J.; Chen, L. Analysis of chemical compounds of pomegranate peel polyphenols and their antibacterial action against Ralstonia solanacearum. S. Afr. J. Bot. 2021, 140, 4–10. [Google Scholar] [CrossRef]
- Ma, G.-Z.; Wang, C.-M.; Li, L.; Ding, N.; Gao, X.-L. Effect of pomegranate peel polyphenols on human prostate cancer PC-3 cells in vivo. Food Sci. Biotechnol. 2015, 24, 1887–1892. [Google Scholar] [CrossRef]
- Saparbekova, A.A.; Kantureyeva, G.O.; Kudasova, D.E.; Konarbayeva, Z.K.; Latif, A.S. Potential of phenolic compounds from pomegranate (Punica granatum L.) by-product with significant antioxidant and therapeutic effects: A narrative review. Saudi J. Biol. Sci. 2023, 30, 103553. [Google Scholar] [CrossRef] [PubMed]
- Zhao, R.; Long, X.; Yang, J.; Du, L.; Zhang, X.; Li, J.; Hou, C. Pomegranate peel polyphenols reduce chronic low-grade inflammatory responses by modulating gut microbiota and decreasing colonic tissue damage in rats fed a high-fat diet. Food Funct. 2019, 10, 8273–8285. [Google Scholar] [CrossRef] [PubMed]
- Lv, O.; Wang, L.; Li, J.; Ma, Q.; Zhao, W. Effects of pomegranate peel polyphenols on lipid accumulation and cholesterol metabolic transformation in L-02 human hepatic cells via the PPARγ-ABCA1/CYP7A1 pathway. Food Funct. 2016, 7, 4976–4983. [Google Scholar] [CrossRef] [PubMed]
- Ruan, J.-H.; Li, J.; Adili, G.; Sun, G.-Y.; Abuduaini, M.; Abdulla, R.; Maiwulanjiang, M.; Aisa, H.A. Phenolic Compounds and Bioactivities from Pomegranate (Punica granatum L.) Peels. J. Agric. Food Chem. 2022, 70, 3678–3686. [Google Scholar] [CrossRef]
- Peanparkdee, M.; Iwamoto, S. Encapsulation for Improving in Vitro Gastrointestinal Digestion of Plant Polyphenols and Their Applications in Food Products. Food Rev. Int. 2022, 38, 335–353. [Google Scholar] [CrossRef]
- Yang, F.; Chen, C.; Ni, D.; Yang, Y.; Tian, J.; Li, Y.; Chen, S.; Ye, X.; Wang, L. Effects of Fermentation on Bioactivity and the Composition of Polyphenols Contained in Polyphenol-Rich Foods: A Review. Foods 2023, 12, 3315. [Google Scholar] [CrossRef]
- Yadav, M.K.; Chae, S.-W.; Im, G.J.; Chung, J.-W.; Song, J.-J. Eugenol: A Phyto-Compound Effective against Methicillin-Resistant and Methicillin-Sensitive Staphylococcus aureus Clinical Strain Biofilms. PLoS ONE 2015, 10, e0119564. [Google Scholar] [CrossRef]
- García-Heredia, A.; García, S.; Merino-Mascorro, J.Á.; Feng, P.; Heredia, N. Natural plant products inhibits growth and alters the swarming motility, biofilm formation, and expression of virulence genes in enteroaggregative and enterohemorrhagic Escherichia coli. Food Microbiol. 2016, 59, 124–132. [Google Scholar] [CrossRef]
- Liu, M.; Yang, K.; Wang, J.; Zhang, J.; Qi, Y.; Wei, X.; Fan, M. Young astringent persimmon tannin inhibits methicillin-resistant Staphylococcus aureus isolated from pork. LWT 2019, 100, 48–55. [Google Scholar] [CrossRef]
- Qian, W.; Zhang, J.; Wang, W.; Wang, T.; Liu, M.; Yang, M.; Sun, Z.; Li, X.; Li, Y. Antimicrobial and antibiofilm activities of paeoniflorin against carbapenem-resistant Klebsiella pneumoniae. J. Appl. Microbiol. 2020, 128, 401–413. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zhu, W.; Cao, Y.; Gao, J.; Jin, T.; Qin, N.; Xia, X. Punicalagin inhibits biofilm formation and virulence gene expression of Vibrio parahaemolyticus. Food Control 2022, 139, 109045. [Google Scholar] [CrossRef]
- An, J.; Ding, N.; Zhang, Z. Mechanical and antibacterial properties of polymethyl methacrylate modified with zinc dimethacrylate. J. Prosthet. Dent. 2022, 128, 100.e1–100.e8. [Google Scholar] [CrossRef] [PubMed]
- Vartika; Chaudhary, M.; Bhagyawant, S.S.; Srivastava, N. Effects of Prednisolone Derivative and Panaxydol: Biosurfactants on Cell Wall Integrity of Acne-Causing Resistant Bacteria. Cell Biochem. Biophys. 2022, 80, 229–243. [Google Scholar] [CrossRef]
- Shivaprasad, D.P.; Taneja, N.K.; Lakra, A.; Sachdev, D. In vitro and in situ abrogation of biofilm formation in E. coli by vitamin C through ROS generation, disruption of quorum sensing and exopolysaccharide production. Food Chem. 2021, 341, 128171. [Google Scholar] [CrossRef]
- Li, R.; Lu, J.; Duan, H.; Yang, J.; Tang, C. Biofilm inhibition and mode of action of epigallocatechin gallate against Vibrio mimicus. Food Control 2020, 113, 107148. [Google Scholar] [CrossRef]
- Lan, W.; Du, J.; Sun, Y.; Xie, J. Insight into the antibacterial activity and mechanism of chitosan caffeic acid graft against Pseudomonas fluorescens. Int. J. Food Sci. Technol. 2023, 58, 1317–1325. [Google Scholar] [CrossRef]
- Liu, M.; Guo, W.; Feng, M.; Bai, Y.; Huang, J.; Cao, Y. Antibacterial, anti-biofilm activity and underlying mechanism of garlic essential oil in water nanoemulsion against Listeria monocytogenes. LWT 2024, 196, 115847. [Google Scholar] [CrossRef]
- Lee, H.J.; Choi, G.J.; Cho, K.Y. Correlation of Lipid Peroxidation in Botrytis cinerea Caused by Dicarboximide Fungicides with Their Fungicidal Activity. J. Agric. Food Chem. 1998, 46, 737–741. [Google Scholar] [CrossRef]
- Wang, L.; Ling, Y.; Jiang, H.; Qiu, Y.; Qiu, J.; Chen, H.; Yang, R.; Zhou, D. AphA is required for biofilm formation, motility, and virulence in pandemic Vibrio parahaemolyticus. Int. J. Food Microbiol. 2013, 160, 245–251. [Google Scholar] [CrossRef]
- Zhu, Z.; Yang, L.; Yu, P.; Wang, Y.; Peng, X.; Chen, L. Comparative Proteomics and Secretomics Revealed Virulence and Antibiotic Resistance-Associated Factors in Vibrio parahaemolyticus Recovered From Commonly Consumed Aquatic Products. Front. Microbiol. 2020, 11, 1453. [Google Scholar] [CrossRef] [PubMed]
- Garzoli, S.; Maggio, F.; Vinciguerra, V.; Rossi, C.; Donadu, M.G.; Serio, A. Chemical Characterization and Antimicrobial Properties of the Hydroalcoholic Solution of Echinacea purpurea (L.) Moench. and Propolis from Northern Italy. Molecules 2023, 28, 1380. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Wang, Q.; Liu, Q.; Rui, H.; Liu, H.; Zhang, Y. Identification of a luxO-regulated extracellular protein Pep and its roles in motility in Vibrio alginolyticus. Microb. Pathog. 2011, 50, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Cheng, H.; Lu, M.; Fang, Y.; Jiao, Y.; Li, W.; Zhao, G.; Wang, S. Dextranase from Arthrobacter oxydans KQ11-1 inhibits biofilm formation by polysaccharide hydrolysis. Biofouling 2016, 32, 1223–1233. [Google Scholar] [CrossRef]
- Krupesha Sharma, S.R.; Shankar, K.M.; Sathyanarayana, M.L.; Patil, R.R.; Narayana Swamy, H.D.; Rao, S. Development of biofilm of Vibrio alginolyticus for oral immunostimulation of shrimp. Aquac. Int. 2011, 19, 421–430. [Google Scholar] [CrossRef][Green Version]
- Yildiz, F.H.; Visick, K.L. Vibrio biofilms: So much the same yet so different. Trends in Microbiology 2009, 17, 109–118. [Google Scholar] [CrossRef]
- Kumar, S.; Lekshmi, M.; Stephen, J.; Ortiz-Alegria, A.; Ayitah, M.; Varela, M.F. Dynamics of efflux pumps in antimicrobial resistance, persistence, and community living of Vibrionaceae. Arch. Microbiol. 2023, 206, 7. [Google Scholar] [CrossRef]
- Lee, Y.; Choi, Y.; Lee, S.; Lee, H.; Kim, S.; Ha, J.; Lee, J.; Oh, H.; Kim, Y.; Yoon, Y. Occurrence of pathogenic Vibrio parahaemolyticus in seafood distribution channels and their antibiotic resistance profiles in S. Korea. Lett. Appl. Microbiol. 2019, 68, 128–133. [Google Scholar] [CrossRef]
- Zhao, Y.; Li, H.; Zhang, Z.; Ren, Z.; Yang, F. Extraction, preparative monomer separation and antibacterial activity of total polyphenols from Perilla frutescens. Food Funct. 2022, 13, 880–890. [Google Scholar] [CrossRef]
- Wang, N.; Liu, X.; Ma, Y.; Huang, X.; Song, L.; Guo, H.; Sun, X.; Sun, X.; Hai, D.; Zhao, P.; et al. Identification of polyphenol extracts from flaxseed and study on its bacteriostatic mechanism. Food Biosci. 2024, 58, 103618. [Google Scholar] [CrossRef]
- Belgacem, I.; Schena, L.; Teixidó, N.; Romeo, F.V.; Ballistreri, G.; Abadias, M. Effectiveness of a pomegranate peel extract (PGE) in reducing Listeria monocytogenes in vitro and on fresh-cut pear, apple and melon. Eur. Food Res. Technol. 2020, 246, 1765–1772. [Google Scholar] [CrossRef]
- Yemis, G.P.; Bach, S.; Delaquis, P. Antibacterial activity of polyphenol-rich pomegranate peel extract against Cronobacter sakazakii. Int. J. Food Prop. 2019, 22, 985–993. [Google Scholar] [CrossRef]
- Liu, H.; Xiao, M.; Zuo, J.; He, X.; Lu, P.; Li, Y.; Zhao, Y.; Xia, F. Vanillic acid combats Vibrio alginolyticus by cell membrane damage and biofilm reduction. J. Fish Dis. 2021, 44, 1799–1809. [Google Scholar] [CrossRef] [PubMed]
- Yi, X.; Xu, X.; Chen, Y.; Xu, G.; Zhu, Z.; Li, H.; Shen, H.; Lin, M.; Zhao, W.; Zheng, J.; et al. Genetic analysis of Vibrio alginolyticus challenged by Fructus schisandrae reveals the mechanism of virulence genes. Gene 2023, 870, 147421. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Xu, X.; Huang, J.; Xu, G.; Liu, S.; Hong, F.; Chen, Y.; Yi, X.; Li, H.; Li, J. Transcriptomic analysis of Vibrio alginolyticus challenged by Rhizoma coptidis reveals mechanisms of virulence genes. Gene 2024, 905, 148188. [Google Scholar] [CrossRef]
- Liu, H.; Wang, Y.; Cao, J.; Jiang, H.; Yao, J.; Gong, G.; Chen, X.; Xu, W.; He, X. Antimicrobial activity and virulence attenuation of citral against the fish pathogen Vibrio alginolyticus. Aquaculture 2020, 515, 734578. [Google Scholar] [CrossRef]
- Gatto, L.J.; Veiga, A.; Gribner, C.; Moura, P.F.; Rech, K.S.; Murakami, F.S.; Dias, J.d.F.G.; Miguel, O.G.; Miguel, M.D. Myrcia hatschbachii: Antifungal activity and structural elucidation of ellagic and 3-O-methyl ellagic acids. Nat. Prod. Res. 2021, 35, 5540–5543. [Google Scholar] [CrossRef]
- Gomes, F.M.S.; da Cunha Xavier, J.; dos Santos, J.F.S.; de Matos, Y.M.L.S.; Tintino, S.R.; de Freitas, T.S.; Coutinho, H.D.M. Evaluation of antibacterial and modifying action of catechin antibiotics in resistant strains. Microb. Pathog. 2018, 115, 175–178. [Google Scholar] [CrossRef]
- Yang, L.; Zhang, C.; Su, Z.; Zhao, L.; Wu, J.; Sun, X.; Zhang, X.; Hu, X. Inactivation of Salmonella typhimurium SL1344 by Chlorogenic Acid and the Impairment of Cellular Integrity. Front. Microbiol. 2022, 13, 887950. [Google Scholar] [CrossRef]
- Huang, B.; Zhang, Z.; Ding, N.; Wang, B.; Zhang, G.; Fei, P. Investigation of the pectin grafting with gallic acid and propyl gallate and their antioxidant activities, antibacterial activities and fresh keeping performance. Int. J. Biol. Macromol. 2021, 190, 343–350. [Google Scholar] [CrossRef]
- Echazarreta, M.A.; Klose, K.E. Vibrio Flagellar Synthesis. Front. Cell. Infect. Microbiol. 2019, 9, 131. [Google Scholar] [CrossRef] [PubMed]
- Ono, H.; Takashima, A.; Hirata, H.; Homma, M.; Kojima, S. The MinD homolog FlhG regulates the synthesis of the single polar flagellum of ibrio alginolyticus. Mol. Microbiol. 2015, 98, 130–141. [Google Scholar] [CrossRef] [PubMed]
- Borges, A.; Saavedra, M.J.; Simões, M. The activity of ferulic and gallic acids in biofilm prevention and control of pathogenic bacteria. Biofouling 2012, 28, 755–767. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.; Jin, W.; Wang, J.; Sun, Y.; Wu, X.; Liu, L. Antibacterial and anti-biofilm activities of peppermint essential oil against Staphylococcus aureus. LWT 2019, 101, 639–645. [Google Scholar] [CrossRef]
- Cao, J.; Liu, H.; Wang, Y.; He, X.; Jiang, H.; Yao, J.; Xia, F.; Zhao, Y.; Chen, X. Antimicrobial and antivirulence efficacies of citral against foodborne pathogen Vibrio parahaemolyticus RIMD2210633. Food Control 2021, 120, 107507. [Google Scholar] [CrossRef]
- Gupta, A.; Imlay, J.A. How a natural antibiotic uses oxidative stress to kill oxidant-resistant bacteria. Proc. Natl. Acad. Sci. USA 2023, 120, e2312110120. [Google Scholar] [CrossRef]
- Vatansever, F.; de Melo, W.C.M.A.; Avci, P.; Vecchio, D.; Sadasivam, M.; Gupta, A.; Chandran, R.; Karimi, M.; Parizotto, N.A.; Yin, R.; et al. Antimicrobial strategies centered around reactive oxygen species—Bactericidal antibiotics, photodynamic therapy, and beyond. FEMS Microbiol. Rev. 2013, 37, 955–989. [Google Scholar] [CrossRef]
- Wu, Y.; Duan, X.; Jing, G.; OuYang, Q.; Tao, N. Cinnamaldehyde inhibits the mycelial growth of Geotrichum citri-aurantii and induces defense responses against sour rot in citrus fruit. Postharvest Biol. Technol. 2017, 129, 23–28. [Google Scholar] [CrossRef]
- Farooqui, A.; Suhail, S.; Zeeshan, M. Cadmium induced oxidative stress and biochemical responses in cyanobacterium Nostoc muscorum. Russ. J. Plant Physiol. 2017, 64, 124–132. [Google Scholar] [CrossRef]
- Alvarez, L.; Hernandez, S.B.; Cava, F. Cell Wall Biology of Vibrio cholerae. Annu. Rev. Microbiol. 2021, 75, 151–174. [Google Scholar] [CrossRef]
- Nguyen, A.H.; Hood, K.S.; Mileykovskaya, E.; Miller, W.R.; Tran, T.T. Bacterial cell membranes and their role in daptomycin resistance: A review. Front. Mol. Biosci. 2022, 9, 1035574. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Zou, L.; Wu, D.-T.; Zhuang, Q.-G.; Li, H.-B.; Mavumengwana, V.; Corke, H.; Gan, R.-Y. Discovery of 1′-acetoxychavicol acetate (ACA) as a promising antibacterial compound from galangal (Alpinia galanga (Linn.) Willd). Ind. Crops Products 2021, 171, 113883. [Google Scholar] [CrossRef]
- Palamae, S.; Mittal, A.; Buatong, J.; Zhang, B.; Hong, H.; Benjakul, S. Chitooligosaccharide-catechin conjugate: Antimicrobial mechanisms toward Vibrio parahaemolyticus and its use in shucked Asian green mussel. Food Control 2023, 151, 109794. [Google Scholar] [CrossRef]
- Ren, F.; Li, Y.; Chen, W.; Chen, W.; Chen, H.; Zhang, M. Antimicrobial mechanism of linalool against Vibrio parahaemolyticus and its application in black tiger shrimp (Penaeus monodon). Food Biosci. 2024, 60, 104283. [Google Scholar] [CrossRef]
- Yu, H.; Pei, J.; Qiu, W.; Mei, J.; Xie, J. The Antimicrobial Effect of Melissa officinalis L. Essential Oil on Vibrio parahaemolyticus: Insights Based on the Cell Membrane and External Structure. Front. Microbiol. 2022, 13, 812792. [Google Scholar] [CrossRef]






| Primer Name | Forward Primers (5′-3′) | Reverse Primers (5′-3′) | Source |
|---|---|---|---|
| 16s | AAAGCACTTTCAGTCGTGAGGAA | TGCGCTTTACGCCCAGTAAT | [45] |
| lafA | CGCAGGTATCGGTGAAATCA | CCGAAGTCTGCACGAGAGCTA | [45] |
| lafK | GAATCGGGAACGGGTAAAGAA | GGTGAACGCGCCTTTTACAT | [45] |
| fliS | CTGGTGCGATTGAGCGCCTTATTCA | CGTCGATCAGCTGAGGCTCATTTTG | [45] |
| flaK | GTATCAAACACGGAAGCAAACG | TTCTAGGAGCTCAGGCGGTATT | [45] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, Z.; Hong, Y.; Zhao, S.; Zhou, M.; Tan, X. Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism. Biology 2024, 13, 934. https://doi.org/10.3390/biology13110934
Yu Z, Hong Y, Zhao S, Zhou M, Tan X. Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism. Biology. 2024; 13(11):934. https://doi.org/10.3390/biology13110934
Chicago/Turabian StyleYu, Zhoulin, Yucong Hong, Shuyan Zhao, Meng Zhou, and Xiaohong Tan. 2024. "Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism" Biology 13, no. 11: 934. https://doi.org/10.3390/biology13110934
APA StyleYu, Z., Hong, Y., Zhao, S., Zhou, M., & Tan, X. (2024). Antibacterial Effect of Fermented Pomegranate Peel Polyphenols on Vibrio alginolyticus and Its Mechanism. Biology, 13(11), 934. https://doi.org/10.3390/biology13110934

