Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1
Abstract
1. Introduction
2. Results and Discussion
2.1. The Analysis of Alginate-Degrading Activity of Vibrio sp. Ni1
2.2. The LC-MS/MS Analysis of Crude Alginate Lyase
2.3. The Characterization of the Full Length algB Gene
2.4. Purification of the Recombinant Enzyme AlgB
2.5. Characteristics of the Recombinant Enzyme AlgB
2.6. Substrate Specificity of AlgB
2.7. Analysis of AlgB Degradation Products
3. Materials and Methods
3.1. Bacteria and Substrate
3.2. Screening of Alginate-Degrading Activity
3.3. Extraction of Crude Alginate Lyase
3.4. Identification of Alginate Lyase Fragments
3.5. Cloning and Sequence Analysis of the Alginate Lyase Gene
3.6. Purification of the Alginate Lyase
3.7. Assay of the Recombinant Alginate Lyase Activity
3.8. Characterization of the Recombinant Alginate Lyase Activity
3.9. Substrate Specificity of the Recombinant Alginate Lyase Activity
3.10. Analysis of Reaction Mode and Products
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gacesa, P. Enzymic degradation of alginates. Int. J. Biochem. 1992, 24, 545–552. [Google Scholar] [CrossRef] [Scilit]
- Wong, T.Y.; Preston, L.A.; Schiller, N.L. Alginate Lyase: Review of Major Sources and Enzyme Characteristics, Structure-Function Analysis, Biological Roles, and Applications. Annu. Rev. Microbiol. 2000, 54, 289–340. [Google Scholar] [CrossRef] [Scilit]
- Cheng, D.; Jiang, C.; Xu, J.; Liu, Z.; Mao, X. Characteristics and applications of alginate lyases: A review. Int. J. Biol. Macromol. 2020, 164, 1304–1320. [Google Scholar] [CrossRef] [Scilit]
- Gacesa, P. Alginate-modifying enzymes: A proposed unified mechanism of action for the lyases and epimerases. FEBS Lett. 1987, 212, 199–202. [Google Scholar] [CrossRef] [Scilit]
- Boyd, A.; Ghosh, M.; May, T.B.; Shinabarger, D.; Keogh, R.; Chakrabarty, A. Sequence of the algL gene of Pseudomonas aeruginosa and purification of its alginate lyase product. Gene 1993, 131, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Schiller, N.L.; Monday, S.R.; Boyd, C.M.; Keen, N.T.; Ohman, D.E. Characterization of the Pseudomonas aeruginosa alginate lyase gene (algL): Cloning, sequencing, and expression in Escherichia coli. J. Bacteriol. 1993, 175, 4780–4789. [Google Scholar] [CrossRef] [Scilit]
- Boyd, A.; Chakrabarty, A.M. Role of alginate lyase in cell detachment of Pseudomonas aeruginosa. Appl. Environ. Microbiol. 1994, 60, 2355–2359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, B.W.; Yin, H. Alginate lyase: Review of major sources and classification, properties, structure-function analysis and applications. Bioengineered 2015, 6, 125–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hicks, S.J.; Gacesa, P. Chemical modification of the alginate lyase from Klebsiella pneumoniae. Biochem. Soc. Trans. 1994, 22, 309S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gimmestad, M.; Ertesvåg, H.; Heggeset, T.M.B.; Aarstad, O.; Svanem, B.I.G.; Valla, S. Characterization of Three New Azotobacter vinelandii Alginate Lyases, One of Which Is Involved in Cyst Germination. J. Bacteriol. 2009, 191, 4845–4853. [Google Scholar] [CrossRef] [Scilit]
- Nakagawa, A.; Ozaki, T.; Chubachi, K.; Hosoyama, T.; Okubo, T.; Iyobe, S.; Suzuki, T. An effective method for isolating alginate lyase-producing Bacillus sp. ATB-1015 strain and purification and characterization of the lyase. J. Appl. Microbiol. 1998, 84, 328–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryu, M.; Lee, E.Y. Saccharification of alginate by using exolytic oligoalginate lyase from marine bacterium Sphingomonas sp. MJ-3. J. Ind. Eng. Chem. 2011, 17, 853–858. [Google Scholar] [CrossRef] [Scilit]
- Lavín, P.; Atala, C.; Gallardo-Cerda, J.; Gonzalez-Aravena, M.; De La Iglesia, R.; Oses, R.; Torres-Díaz, C.; Trefault, N.; Molina-Montenegro, M.; Iv, H.D.L. Isolation and characterization of an Antarctic Flavobacterium strain with agarase and alginate lyase activities. Pol. Polar Res. 2016, 37, 403–419. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Hu, F.; Wang, M.; Zhu, B.; Ni, F.; Yao, Z. Elucidation of degradation pattern and immobilization of a novel alginate lyase for preparation of alginate oligosaccharides. Int. J. Biol. Macromol. 2020, 146, 579–587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barzkar, N.; Sheng, R.; Sohail, M.; Jahromi, S.T.; Babich, O.; Sukhikh, S.; Nahavandi, R. Alginate Lyases from Marine Bacteria: An Enzyme Ocean for Sustainable Future. Molecules 2022, 27, 3375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eftekharzadeh, B.; Khodagholi, F.; Abdi, A.; Maghsoudi, N. Alginate protects NT2 neurons against H2O2-induced neurotoxicity. Carbohydr. Polym. 2010, 79, 1063–1072. [Google Scholar] [CrossRef] [Scilit]
- Zhou, R.; Shi, X.-Y.; Bi, D.-C.; Fang, W.-S.; Wei, G.-B.; Xu, X. Alginate-Derived Oligosaccharide Inhibits Neuroinflammation and Promotes Microglial Phagocytosis of β-Amyloid. Mar. Drugs 2015, 13, 5828–5846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Hu, Y.; Zhang, L.; Wang, Y.; Wang, S.; Zhang, Y.; Guo, H.; Ji, D.; Wang, Y. Alginate Oligosaccharide DP5 Exhibits Antitumor Effects in Osteosarcoma Patients following Surgery. Front. Pharmacol. 2017, 8, 623. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.; Zhang, L.; Yu, X.; Wang, S.; Xu, C.; Yin, H.; Wang, S. RETRACTED ARTICLE: Alginate oligosaccharide attenuates α2,6-sialylation modification to inhibit prostate cancer cell growth via the Hippo/YAP pathway. Cell Death Dis. 2019, 10, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Wan, J.; Zhang, J.; Chen, D.; Yu, B.; Mao, X.; Zheng, P.; Yu, J.; Luo, J.; He, J. Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis modifications have beneficial effects on the growth performance of weaned pigs. J. Anim. Sci. Biotechnol. 2018, 9, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Li, T.; Huang, S.; Wang, J.; Yin, P.; Liu, H.; Sun, C. Alginate oligosaccharides protect against fumonisin B1-induced intestinal damage via promoting gut microbiota homeostasis. Food Res. Int. 2021, 152, 110927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iacob, A.-T.; Drăgan, M.; Ionescu, O.-M.; Profire, L.; Ficai, A.; Andronescu, E.; Confederat, L.G.; Lupașcu, D. An Overview of Biopolymeric Electrospun Nanofibers Based on Polysaccharides for Wound Healing Management. Pharmaceutics 2020, 12, 983. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamasaki, M.; Ogura, K.; Hashimoto, W.; Mikami, B.; Murata, K. A Structural Basis for Depolymerization of Alginate by Polysaccharide Lyase Family-7. J. Mol. Biol. 2005, 352, 11–21. [Google Scholar] [CrossRef] [Scilit]
- Xu, F.; Wang, P.; Zhang, Y.-Z.; Chen, X.-L. Diversity of Three-Dimensional Structures and Catalytic Mechanisms of Alginate Lyases. Appl. Environ. Microbiol. 2018, 84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Badur, A.H.; Jagtap, S.S.; Yalamanchili, G.; Lee, J.-K.; Zhao, H.; Rao, C.V. Alginate Lyases from Alginate-Degrading Vibrio splendidus 12B01 Are Endolytic. Appl. Environ. Microbiol. 2015, 81, 1865–1873. [Google Scholar] [CrossRef] [Scilit]
- Zhuang, J.; Zhang, K.; Liu, X.; Liu, W.; Lyu, Q.; Ji, A. Characterization of a Novel PolyM-Preferred Alginate Lyase from Marine Vibrio splendidus OU02. Mar. Drugs 2018, 16, 295. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.-H.; Yu, G.-L.; Wang, X.-M.; Lv, Z.-H.; Zhao, X.; Wu, Z.-H.; Ji, W.-S. Purification and Characterization of Alginate Lyase from Marine Vibrio sp. YWA. Acta Biochim. Biophys. Sin. 2006, 38, 633–638. [Google Scholar] [CrossRef] [Scilit]
- Fu, X.T.; Lin, H.; Kim, S.M. Purification and characterization of a Na+/K+ dependent alginate lyase from turban shell gut Vibrio sp. YKW-34. Enzym. Microb. Technol. 2007, 41, 828–834. [Google Scholar] [CrossRef] [Scilit]
- Zhu, B.; Tan, H.; Qin, Y.; Xu, Q.; Du, Y.; Yin, H. Characterization of a new endo-type alginate lyase from Vibrio sp. W13. Int. J. Biol. Macromol. 2015, 75, 330–337. [Google Scholar] [CrossRef] [Scilit]
- Zhu, B.; Ni, F.; Ning, L.; Sun, Y.; Yao, Z. Cloning and characterization of a new pH-stable alginate lyase with high salt tolerance from marine Vibrio sp. NJ-04. Int. J. Biol. Macromol. 2018, 115, 1063–1070. [Google Scholar] [CrossRef] [Scilit]
- Chao, Y.X.; Wang, S.Y.; Wu, S.Q.; Wei, J.Q.; Chen, H. Cloning and characterization of a new endo-type polyG-specific alginate lyase from bacteria Vibrio sp. QD-5. Acta Oceanol. Sin. 2019, 38, 65–74. [Google Scholar] [CrossRef] [Scilit]
- Fineberg, S.J.; Nandyala, S.V.; Marquez-Lara, A. Preparation of trisaccharides from alginate by a novel alginate lyase Alg7A from marine bacterium Vibrio sp. W13. Int. J. Biol. Macromol. 2019, 139, 879–885. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Chen, L.; Zhang, Z.; Wang, X.; Qin, S.; Yan, P. Screening of alginate lyase-excreting microorganisms from the surface of brown algae. AMB Express 2017, 7, 74–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, G.; Gao, Y.; Shi, M.; Zhang, X.; He, S.; Chen, Z.; An, C. SiteFinding-PCR: A simple and efficient PCR method for chromosome walking. Nucleic Acids Res. 2005, 33, e122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ping, L.; Vogel, H.; Boland, W. Cloning of prokaryotic genes by a universal degenerate primer PCR. FEMS Microbiol. Lett. 2008, 287, 192–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, B.B.; Liu, S.L.; Zhang, J.Y.; Bao, H.F.; Ding, Y.T. Optimization of alginate-degrading bacterial fermentation process for alginate lyase production. Fish. Sci. 2009, 28, 667–670. (In Chinese) [Google Scholar]
- Lyu, Q.; Zhang, K.; Shi, Y.; Li, W.; Diao, X.; Liu, W. Structural insights into a novel Ca2+-independent PL-6 alginate lyase from Vibrio OU02 identify the possible subsites responsible for product distribution. Biochim. et Biophys. Acta (BBA)-Gen. Subj. 2019, 1863, 1167–1176. [Google Scholar] [CrossRef] [Scilit]
- Kobayashi, T.; Uchimura, K.; Miyazaki, M.; Nogi, Y.; Horikoshi, K. A new high-alkaline alginate lyase from a deep-sea bacterium Agarivorans sp. Extremophiles 2008, 13, 121–129. [Google Scholar] [CrossRef] [Scilit]
- Zhu, B.W.; Hu, F.; Yuan, H.; Sun, Y.; Yao, Z. Biochemical characterization and degradation pattern of a unique pH-stable polyM-specific alginate lyase from newly isolated Serratia marcescens NJ-07. Mar. Drugs 2018, 16, 129. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Chen, P.; Zeng, Y.; Men, Y.; Mu, S.; Zhu, Y.; Chen, Y.; Sun, Y. The Characterization and Modification of a Novel Bifunctional and Robust Alginate Lyase Derived from Marinimicrobium sp. H1. Mar. Drugs 2019, 17, 545. [Google Scholar] [CrossRef] [Scilit]
- Inoue, A.; Anraku, M.; Nakagawa, S.; Ojima, T. Discovery of a Novel Alginate Lyase from Nitratiruptor sp. SB155-2 Thriving at Deep-sea Hydrothermal Vents and Identification of the Residues Responsible for Its Heat Stability. J. Biol. Chem. 2016, 291, 15551–15563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoon, H.-J.; Hashimoto, W.; Miyake, O.; Okamoto, M.; Mikami, B.; Murata, K. Overexpression in Escherichia coli, Purification, and Characterization of Sphingomonas sp. A1 Alginate Lyases. Protein Expr. Purif. 2000, 19, 84–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hashimoto, W.; Miyake, O.; Ochiai, A.; Murata, K. Molecular identification of Sphingomonas sp. A1 alginate lyase (A1-IV’) as a member of novel polysaccharide lyase family 15 and implications in alginate lyase evolution. J. Biosci. Bioeng. 2005, 99, 48–54. [Google Scholar] [CrossRef] [Scilit]
- Inoue, A.; Nishiyama, R.; Ojima, T. The alginate lyases FlAlyA, FlAlyB, FlAlyC, and FlAlex from Flavobacterium sp. UMI-01 have distinct roles in the complete degradation of alginate. Algal Res. 2016, 19, 355–362. [Google Scholar] [CrossRef] [Scilit]
- Rahman, M.M.; Inoue, A.; Tanaka, H.; Ojima, T. Isolation and characterization of two alginate lyase isozymes, AkAly28 and AkAly33, from the common sea hare Aplysia kurodai. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2010, 157, 317–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]















| No. | Colony Diameter/cm | Alginate-Degraded Circle Diameter/cm | Ratio |
|---|---|---|---|
| 1 | 1.13 | 4.58 | 4.05 |
| 2 | 1.02 | 4.82 | 4.72 |
| 3 | 0.86 | 4.62 | 5.37 |
| Average value | 1.00 | 4.67 | 4.67 |
| No. | Peptides Seq. | Candidate Protein ID | Length |
|---|---|---|---|
| 1 | NSITGHYWAVVK | AIY22661.1 | 12 |
| 2 | AGVYNQFENGEAK | AIY22661.1 | 13 |
| 3 | LLWEGDNKPVR | AIY22661.1 | 11 |
| 4 | VVWEQER | WP_118120558.1 | 7 |
| 5 | AGVYNQFENGEAK | WP_118120558.1 | 13 |
| 6 | ADMGYGTSTENSSYIR | WP_118120558.1 | 16 |
| Protein Name | Molecular Mass (kDa) | Optimal pH/Temperature (°C) | Substrate Specificity | Enzymatic Product | Activating Cation | Reference |
|---|---|---|---|---|---|---|
| AlyA | 67.4 | 8.5/25 | alginate, polyM | DP1–4 | Na+, Ca2+ | [25] |
| AlyB | 57.5 | 7.5/20–25 | polyG | DP1–5 | Na+, Ca2+ | [25] |
| AlyA-OU02 | 65 | 8.0/30 | polyM | DP2–4 | Mg2+, Fe2+ | [26] |
| alginate lyase | 62.5 | 7.0/25 | polyM | / | Zn2+ | [27] |
| alginate lyase | 60 | 7.0/40 | polyMG | / | Na+, K+ | [28] |
| Algb | 55 | 8.0/30 | polyMG, | DP2–5 | Na+, Mg2+ Ca2+, Fe2+ Co2+ | [29] |
| AlgNJ04 | 50 | 7.0/40 | polyG | DP2–5 | Na+, K+, Ca2+ | [30] |
| Aly-IV | 62 | 8.9/35 | alginate | DP2–3 | K+, Mg2+ | [31] |
| Alg7A | 56 | 7.0/30 | polyMG, alginate | DP2–6 | Ca2+, K+, Na+, Ba2+, Co2+, Mn2+ | [32] |
| AlgB | 67.7 | 8.0/35 | polyM | DP2–3 | Not found | This study |
| Name | Sequence | Product |
|---|---|---|
| algB-F0 | GTGGTBTGGGAACARGAR | Partial algB fragment |
| algB-R0 | YGGTTTRTTATCRCCYTCCCA | |
| SP1 | CTCCACCCGTCCCATACCAAGAAT | Upstream flank sequences |
| SP2 | GCACCTTCGCCTCGCCATTTTCAA | |
| SP3 | AGTTGTCGAGGTCAGCTTCACCT | |
| P1 | ACCCATTACTGCGGGTTGTTTGGGA | Downstream flank sequences |
| P2 | AATGGCGAGGCGAAGGTGCAATTTA | |
| P3 | AGACCCAGATTGTAGCACCAGTGATG | |
| algB-QF | CGCGGATCCATGAATTCAGCAAAACTTATTTTGGT | Full algB gene |
| algB-QR | CCGCTCGAGCTACAGATGATTTACGTTCAAAGAGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sha, L.; Huang, M.; Huang, X.; Huang, Y.; Shao, E.; Guan, X.; Huang, Z. Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1. Mar. Drugs 2022, 20, 479. https://doi.org/10.3390/md20080479
Sha L, Huang M, Huang X, Huang Y, Shao E, Guan X, Huang Z. Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1. Marine Drugs. 2022; 20(8):479. https://doi.org/10.3390/md20080479
Chicago/Turabian StyleSha, Li, Minghai Huang, Xiaonan Huang, Yongtong Huang, Ensi Shao, Xiong Guan, and Zhipeng Huang. 2022. "Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1" Marine Drugs 20, no. 8: 479. https://doi.org/10.3390/md20080479
APA StyleSha, L., Huang, M., Huang, X., Huang, Y., Shao, E., Guan, X., & Huang, Z. (2022). Cloning and Characterization of a Novel Endo-Type Metal-Independent Alginate Lyase from the Marine Bacteria Vibrio sp. Ni1. Marine Drugs, 20(8), 479. https://doi.org/10.3390/md20080479

