The Deficiency of Hypusinated eIF5A Decreases the Putrescine/Spermidine Ratio and Inhibits +1 Programmed Ribosomal Frameshifting during the Translation of Ty1 Retrotransposon in Saccharomyces cerevisiae
Abstract
1. Introduction
2. Results
2.1. Sc-eIF5A Depletion Decreases the Putrescine/Spermidine Ratio
2.2. Sc-eIF5A Depletion Decreases +1 Programmed Ribosomal Frameshifting Efficiency
2.3. The Hypusine Modification of Sc-eIF5A Influences +1 Programmed Ribosomal Frameshifting Efficiency
2.4. The Ty1 Frame 0 Stop Codon Position Confers the Dependency of +1 Programmed Ribosomal Frameshifting on Sc-eIF5A
3. Discussion
4. Materials and Methods
4.1. Yeast Strains and Growth Conditions
4.2. The Generation of Ribosomal Frameshift Reporters
4.3. The Generation of HYP2 Complementarity Strains
4.4. The Generation of HYP2 Hypusination Site Mutant Strains
4.5. The Inhibition of HYP2 Hypusination in WT Strain by GC7 Treatment
4.6. The Generation of Ty1 Frame 0 Stop Codon Mutant Strains
4.7. The Detection of Polyamines in Yeast Strains by High-Performance Liquid Chromatography (HPLC)
4.8. Analysis of Ribosomal Frameshift Efficiency in tif51A-1, tif51A-3 and HYP2 Complementarity Strains
4.9. Analysis of Ribosomal Frameshift Efficiency in HYP2 Hypusination Site Mutant Strains and WT Strain by GC7 Treatment
4.10. Analysis of Ribosomal Frameshift Efficiency in Ty1 Frame 0 Stop Codon Mutant Strains
4.11. Quantitative Real-Time PCR
4.12. Western Blot
4.13. Dual-Luciferase Assays
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Caliskan, N.; Peske, F.; Rodnina, M.V. Changed in translation: mRNA recoding by −1 programmed ribosomal frameshifting. Trends Biochem. Sci. 2015, 40, 265–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, J.; Grosely, R.; Prabhakar, A.; Lapointe, C.P.; Wang, J.; Puglisi, J.D. How messenger RNA and nascent chain sequences regulate translation elongation. Annu. Rev. Biochem. 2018, 87, 421–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinman, J.D. Mechanisms and implications of programmed translational frameshifting. Wiley Interdiscip. Rev. RNA 2012, 3, 661–673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jacks, T.; Varmus, H.E. Expression of the Rous sarcoma virus pol gene by ribosomal frameshifting. Science 1985, 230, 1237–1242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balasundaram, D.; Dinman, J.D.; Wickner, R.B.; Tabor, C.W.; Tabor, H. Spermidine deficiency increases +1 ribosomal frameshifting efficiency and inhibits Ty1 retrotransposition in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 1994, 91, 172–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinman, J.D.; Wickner, R.B. Ribosomal frameshifting efficiency and gag/gag-pol ratio are critical for yeast M1 double-stranded RNA virus propagation. J. Virol. 1992, 66, 3669–3676. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinman, J.D.; Wickner, R.B. Translational maintenance of frame: Mutants of Saccharomyces cerevisiae with altered −1 ribosomal frameshifting efficiencies. Genetics 1994, 136, 75–86. [Google Scholar] [CrossRef] [Scilit]
- Hung, M.; Patel, P.; Davis, S.; Green, S.R. Importance of ribosomal frameshifting for human immunodeficiency virus type 1 particle assembly and replication. J. Virol. 1998, 72, 4819–4824. [Google Scholar] [CrossRef] [Scilit]
- Karacostas, V.; Wolffe, E.J.; Nagashima, K.; Gonda, M.A.; Moss, B. Overexpression of the HIV-1 gag-pol polyprotein results in intracellular activation of HIV-1 protease and inhibition of assembly and budding of virus-like particles. Virology 1993, 193, 661–671. [Google Scholar] [CrossRef] [Scilit]
- Park, J.; Morrow, C.D. Overexpression of the gag-pol precursor from human immunodeficiency virus type 1 proviral genomes results in efficient proteolytic processing in the absence of virion production. J. Virol. 1991, 65, 5111–5117. [Google Scholar] [CrossRef] [Scilit]
- Namy, O.; Rousset, J.P.; Napthine, S.; Brierley, I. Reprogrammed genetic decoding in cellular gene expression. Mol. Cell 2004, 13, 157–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cobucci-Ponzano, B.; Rossi, M.; Moracci, M. Translational recoding in archaea. Extremophiles 2012, 16, 793–803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baranov, P.V.; Gesteland, R.F.; Atkins, J.F. Recoding: Translational bifurcations in gene expression. Gene 2002, 286, 187–201. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawakami, K.; Pande, S.; Faiola, B.; Moore, D.P.; Boeke, J.D.; Farabaugh, P.J.; Strathern, J.N.; Nakamura, Y.; Garfinkel, D.J. A rare tRNA-Arg(CCU) that regulates Ty1 element ribosomal frameshifting is essential for Ty1 retrotransposition in Saccharomyces cerevisiae. Genetics 1993, 135, 309–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atkins, J.F.; Björk, G.R. A gripping tale of ribosomal frameshifting: Extragenic suppressors of frameshift mutations spotlight P-site realignment. Microbiol. Mol. Biol. Rev. 2009, 73, 178–210. [Google Scholar] [CrossRef] [Scilit]
- Tuohy, T.M.; Thompson, S.; Gesteland, R.F.; Atkins, J.F. Seven, eight and nine-membered anticodon loop mutants of tRNA(2Arg) which cause +1 frameshifting. Tolerance of DHU arm and other secondary mutations. J. Mol. Biol. 1992, 228, 1042–1054. [Google Scholar] [CrossRef] [Scilit]
- Higashi, K.; Kashiwagi, K.; Taniguchi, S.; Terui, Y.; Yamamoto, K.; Ishihama, A.; Igarashi, K. Enhancement of +1 frameshift by polyamines during translation of polypeptide release factor 2 in Escherichia coli. J. Biol. Chem. 2006, 281, 9527–9537. [Google Scholar] [CrossRef] [Scilit]
- Balasundaram, D.; Dinman, J.D.; Tabor, C.W.; Tabor, H. SPE1 and SPE2: Two essential genes in the biosynthesis of polyamines that modulate +1 ribosomal frameshifting in Saccharomyces cerevisiae. J. Bacteriol. 1994, 176, 7126–7128. [Google Scholar] [CrossRef] [Scilit]
- Gupta, P.; Kannan, K.; Mankin, A.S.; Vázquez-Laslop, N. Regulation of gene expression by macrolide-induced ribosomal frameshifting. Mol. Cell 2013, 52, 629–642. [Google Scholar] [CrossRef] [Scilit]
- Harger, J.W.; Meskauskas, A.; Dinman, J.D. An “integrated model” of programmed ribosomal frameshifting. Trends Biochem. Sci. 2002, 27, 448–454. [Google Scholar] [CrossRef] [Scilit]
- Napthine, S.; Ling, R.; Finch, L.K.; Jones, J.D.; Bell, S.; Brierley, I.; Firth, A.E. Protein-directed ribosomal frameshifting temporally regulates gene expression. Nat. Commun. 2017, 8, 15582. [Google Scholar] [CrossRef] [Scilit]
- Dinman, J.D. Ribosomal frameshifting in yeast viruses. Yeast 1995, 11, 1115–1127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palanimurugan, R.; Scheel, H.; Hofmann, K.; Dohmen, R.J. Polyamines regulate their synthesis by inducing expression and blocking degradation of ODC antizyme. EMBO J. 2004, 23, 4857–4867. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dever, T.E.; Gutierrez, E.; Shin, B.S. The hypusine-containing translation factor eIF5A. Crit. Rev. Biochem. Mol. Biol. 2014, 49, 413–425. [Google Scholar] [CrossRef] [Scilit]
- Park, M.H. The post-translational synthesis of a polyamine-derived amino acid, hypusine, in the eukaryotic translation initiation factor 5A (eIF5A). J. Biochem. 2006, 139, 161–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, M.H.; Wolff, E.C. Hypusine, a polyamine-derived amino acid critical for eukaryotic translation. J. Biol. Chem. 2018, 293, 18710–18718. [Google Scholar] [CrossRef] [Scilit]
- Gutierrez, E.; Shin, B.S.; Woolstenhulme, C.J.; Kim, J.R.; Saini, P.; Buskirk, A.R.; Dever, T.E. eIF5A promotes translation of polyproline motifs. Mol. Cell 2013, 51, 35–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schuller, A.P.; Wu, C.C.; Dever, T.E.; Buskirk, A.R.; Green, R. eIF5A functions globally in translation elongation and termination. Mol. Cell 2017, 66, 194–205.e195. [Google Scholar] [CrossRef] [Scilit]
- Pelechano, V.; Alepuz, P. eIF5A facilitates translation termination globally and promotes the elongation of many nonpolyproline-specific tripeptide sequences. Nucleic Acids Res. 2017, 45, 7326–7338. [Google Scholar] [CrossRef] [Scilit]
- Halwas, K.; Döring, L.M.; Oehlert, F.V.; Dohmen, R.J. Hypusinated eIF5A promotes ribosomal frameshifting during decoding of ODC antizyme mRNA in Saccharomyces cerevisiae. Int. J. Mol. Sci. 2022, 23, 12972. [Google Scholar] [CrossRef] [Scilit]
- Ivanov, I.P.; Loughran, G.; Atkins, J.F. uORFs with unusual translational start codons autoregulate expression of eukaryotic ornithine decarboxylase homologs. Proc. Natl. Acad. Sci. USA 2008, 105, 10079–10084. [Google Scholar] [CrossRef] [Scilit]
- Ivanov, I.P.; Shin, B.S.; Loughran, G.; Tzani, I.; Young-Baird, S.K.; Cao, C.; Atkins, J.F.; Dever, T.E. Polyamine control of translation elongation regulates start site selection on antizyme inhibitor mRNA via ribosome queuing. Mol. Cell 2018, 70, 254–264.e256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murakami, Y.; Ichiba, T.; Matsufuji, S.; Hayashi, S. Cloning of antizyme inhibitor, a highly homologous protein to ornithine decarboxylase. J. Biol. Chem. 1996, 271, 3340–3342. [Google Scholar] [CrossRef] [Scilit]
- Vindu, A.; Shin, B.S.; Choi, K.; Christenson, E.T.; Ivanov, I.P.; Cao, C.; Banerjee, A.; Dever, T.E. Translational autoregulation of the S. cerevisiae high-affinity polyamine transporter Hol1. Mol. Cell 2021, 81, 3904–3918.e6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinman, J.D.; Icho, T.; Wickner, R.B. A -1 ribosomal frameshift in a double-stranded RNA virus of yeast forms a gag-pol fusion protein. Proc. Natl. Acad. Sci. USA 1991, 88, 174–178. [Google Scholar] [CrossRef] [Scilit]
- Tu, C.; Tzeng, T.H.; Bruenn, J.A. Ribosomal movement impeded at a pseudoknot required for frameshifting. Proc. Natl. Acad. Sci. USA 1992, 89, 8636–8640. [Google Scholar] [CrossRef] [Scilit]
- Farabaugh, P.J. Programmed translational frameshifting. Microbiol. Rev. 1996, 60, 103–134. [Google Scholar] [CrossRef] [PubMed]
- Jacobs, J.L.; Belew, A.T.; Rakauskaite, R.; Dinman, J.D. Identification of functional, endogenous programmed -1 ribosomal frameshift signals in the genome of Saccharomyces cerevisiae. Nucleic Acids Res. 2007, 35, 165–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Vizeacoumar, F.J.; Bahr, S.; Li, J.; Warringer, J.; Vizeacoumar, F.S.; Min, R.; Vandersluis, B.; Bellay, J.; Devit, M.; et al. Systematic exploration of essential yeast gene function with temperature-sensitive mutants. Nat. Biotechnol. 2011, 29, 361–367. [Google Scholar] [CrossRef] [Scilit]
- Belew, A.T.; Meskauskas, A.; Musalgaonkar, S.; Advani, V.M.; Sulima, S.O.; Kasprzak, W.K.; Shapiro, B.A.; Dinman, J.D. Ribosomal frameshifting in the CCR5 mRNA is regulated by miRNAs and the NMD pathway. Nature 2014, 512, 265–269. [Google Scholar] [CrossRef] [Scilit]
- Khan, Y.A.; Loughran, G.; Steckelberg, A.L.; Brown, K.; Kiniry, S.J.; Stewart, H.; Baranov, P.V.; Kieft, J.S.; Firth, A.E.; Atkins, J.F. Evaluating ribosomal frameshifting in CCR5 mRNA decoding. Nature 2022, 604, E16–E23. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Y.; Li, J.; Wang, R.; Fan, Y.; Han, X.; Fu, Y.; Alepuz, P.; Wang, W.; Liang, A. eIF5A promotes +1 programmed ribosomal frameshifting in Euplotes octocarinatus. Int. J. Biol. Macromol. 2024, 254, 127743. [Google Scholar] [CrossRef] [Scilit]
- Rehfeld, F.; Eitson, J.L.; Ohlson, M.B.; Chang, T.C.; Schoggins, J.W.; Mendell, J.T. CRISPR screening reveals a dependency on ribosome recycling for efficient SARS-CoV-2 programmed ribosomal frameshifting and viral replication. Cell Rep. 2023, 42, 112076. [Google Scholar] [CrossRef] [Scilit]
- Matsufuji, S.; Matsufuji, T.; Miyazaki, Y.; Murakami, Y.; Atkins, J.F.; Gesteland, R.F.; Hayashi, S. Autoregulatory frameshifting in decoding mammalian ornithine decarboxylase antizyme. Cell 1995, 80, 51–60. [Google Scholar] [CrossRef] [Scilit]
- Ivanov, I.P.; Atkins, J.F. Ribosomal frameshifting in decoding antizyme mRNAs from yeast and protists to humans: Close to 300 cases reveal remarkable diversity despite underlying conservation. Nucleic Acids Res. 2007, 35, 1842–1858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heller, J.S.; Canellakis, E.S. Cellular control of ornithine decarboxylase activity by its antizyme. J. Cell Physiol. 1981, 107, 209–217. [Google Scholar] [CrossRef] [Scilit]
- Murakami, Y.; Matsufuji, S.; Kameji, T.; Hayashi, S.; Igarashi, K.; Tamura, T.; Tanaka, K.; Ichihara, A. Ornithine decarboxylase is degraded by the 26S proteasome without ubiquitination. Nature 1992, 360, 597–599. [Google Scholar] [CrossRef] [Scilit]
- Ruan, H.; Shantz, L.M.; Pegg, A.E.; Morris, D.R. The upstream open reading frame of the mRNA encoding S-adenosylmethionine decarboxylase is a polyamine-responsive translational control element. J. Biol. Chem. 1996, 271, 29576–29582. [Google Scholar] [CrossRef] [Scilit]
- Law, G.L.; Raney, A.; Heusner, C.; Morris, D.R. Polyamine regulation of ribosome pausing at the upstream open reading frame of S-adenosylmethionine decarboxylase. J. Biol. Chem. 2001, 276, 38036–38043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raney, A.; Law, G.L.; Mize, G.J.; Morris, D.R. Regulated translation termination at the upstream open reading frame in S-adenosylmethionine decarboxylase mRNA. J. Biol. Chem. 2002, 277, 5988–5994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pegg, A.E. Mammalian polyamine metabolism and function. IUBMB Life 2009, 61, 880–894. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurian, L.; Palanimurugan, R.; Godderz, D.; Dohmen, R.J. Polyamine sensing by nascent ornithine decarboxylase antizyme stimulates decoding of its mRNA. Nature 2011, 477, 490–494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yordanova, M.M.; Wu, C.; Andreev, D.E.; Sachs, M.S.; Atkins, J.F. A nascent peptide signal responsive to endogenous levels of polyamines acts to stimulate regulatory frameshifting on antizyme mRNA. J. Biol. Chem. 2015, 290, 17863–17878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saini, P.; Eyler, D.E.; Green, R.; Dever, T.E. Hypusine-containing protein eIF5A promotes translation elongation. Nature 2009, 459, 118–121. [Google Scholar] [CrossRef] [Scilit]
- Kera, K.; Nagayama, T.; Nanatani, K.; Saeki-Yamoto, C.; Tominaga, A.; Souma, S.; Miura, N.; Takeda, K.; Kayamori, S.; Ando, E.; et al. Reduction of spermidine content resulting from inactivation of two arginine decarboxylases increases biofilm formation in Synechocystis sp. strain PCC 6803. J. Bacteriol. 2018, 200, e00664-17. [Google Scholar] [CrossRef] [Scilit]
- Ozdestan, O.; Uren, A. A method for benzoyl chloride derivatization of biogenic amines for high performance liquid chromatography. Talanta 2009, 78, 1321–1326. [Google Scholar] [CrossRef] [Scilit]








| Primers | Sequence (5′ → 3′) |
|---|---|
| Primers for PCR of the Ty1 and CTS2 PRF signals | |
| Sc-Ty1-F | ACGCGTCGACGAATGTATCGACATCTAATAACTCT |
| Sc-Ty1-R | ACGCGTCGACGTTCTTATAAGGGTTCGTGAT |
| Sc-CTS2-F | ACGCGTCGACAAAAAATCAATATTTATCAGTTATGATA |
| Sc-CTS2-R | ACGCGTCGACGTATTGTTATGTGTCACATATTC |
| Primers for construction of recombinant pRS315-Sc-HYP2 plasmid for expression in the tif51A-1 and tif51A-3 strains | |
| Sc-HYP2-F | CGGGATCCATGTCTGACGAAGAACATACCT |
| Sc-HYP2-R | CCCAAGCTTATCGGTTCTAGCAGCTTC |
| Primers for qPCR | |
| FL-F | CTAGAGGATGGAACCGCTGGAGAG |
| FL-R | TCTGCCAACCGAACGGACATTTC |
| Sc-actin-F | TGGATTCTGAGGTTGCTGCTTTGG |
| Sc-actin-R | TGGTGTCTTGGTCTACCGACGATAG |
| Primers for mutation of the frameshifting element of the Ty1 gene | |
| M-Sc-Ty1-F | TAGGCCAGAAACTTACTGTATCTTCAGTAAATCATA |
| M-Sc-Ty1-R | TGATTAGTATGATTTACTGAAGATACAGTAAGTTTCTG |
| Primers for mutation of the hypusination site of Sc-HYP2 | |
| M-Sc-HYP2-F | GTCCACTTCTAAGACTGGTAGGCACGGTCACGCTAA |
| M-Sc-HYP2-R | TGGACTTTAGCGTGACCGTGCCTACCAGTCTTAGAA |
| Gene | Sequence (5′ → 3′) |
|---|---|
| L-A | GTCGACGATCAATGCGGGCGAACTTAAGAACTACTGGGGTAGTGTGCGTCGTACTCAGCAGGGTTTAGGAGTGGTAGGTCTTACGATGCCAGCTGTAATGCCTACCGGAGAACCTACAGCTGGCGCTGCCCACGAAGAGTTGATAGAACAGGCGGACAATGTTTTAGTAGAGTAAACGTAATCGAACCCTCACACGGACCCCGCCCTACAAGGTACATACTGCAGACGTCGAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, Y.; Wang, R.; Han, X.; Wang, W.; Liang, A. The Deficiency of Hypusinated eIF5A Decreases the Putrescine/Spermidine Ratio and Inhibits +1 Programmed Ribosomal Frameshifting during the Translation of Ty1 Retrotransposon in Saccharomyces cerevisiae. Int. J. Mol. Sci. 2024, 25, 1766. https://doi.org/10.3390/ijms25031766
Xiao Y, Wang R, Han X, Wang W, Liang A. The Deficiency of Hypusinated eIF5A Decreases the Putrescine/Spermidine Ratio and Inhibits +1 Programmed Ribosomal Frameshifting during the Translation of Ty1 Retrotransposon in Saccharomyces cerevisiae. International Journal of Molecular Sciences. 2024; 25(3):1766. https://doi.org/10.3390/ijms25031766
Chicago/Turabian StyleXiao, Yu, Ruanlin Wang, Xiaxia Han, Wei Wang, and Aihua Liang. 2024. "The Deficiency of Hypusinated eIF5A Decreases the Putrescine/Spermidine Ratio and Inhibits +1 Programmed Ribosomal Frameshifting during the Translation of Ty1 Retrotransposon in Saccharomyces cerevisiae" International Journal of Molecular Sciences 25, no. 3: 1766. https://doi.org/10.3390/ijms25031766
APA StyleXiao, Y., Wang, R., Han, X., Wang, W., & Liang, A. (2024). The Deficiency of Hypusinated eIF5A Decreases the Putrescine/Spermidine Ratio and Inhibits +1 Programmed Ribosomal Frameshifting during the Translation of Ty1 Retrotransposon in Saccharomyces cerevisiae. International Journal of Molecular Sciences, 25(3), 1766. https://doi.org/10.3390/ijms25031766

