Fucoxanthinol from the Diatom Nitzschia Laevis Ameliorates Neuroinflammatory Responses in Lipopolysaccharide-Stimulated BV-2 Microglia
Abstract
1. Introduction
2. Results
2.1. Cytotoxic Effect of Fucoxanthinol on BV-2 Cells
2.2. Fucoxanthinol Inhibited LPS-Induced iNOS, NO, PGE-2, and COX-2 Expression in BV-2 Cells
2.3. Fucoxanthinol Ameliorated LPS-induced Pro-Inflammatory Cytokines Production in BV-2 Cells
2.4. Fucoxanthinol Repressed the Nuclear Translocation of NF-κB
2.5. Fucoxanthinol Inhibited LPS-Stimulated MAPKs and PI3K/Akt Pathways Activities
2.6. Effects of Fucoxanthinol on the Accumulation of ROS, HO-1 and NQO-1 and the Activation of Nrf2
3. Discussion
4. Materials and Methods
4.1. Chemicals and Antibodies
4.2. Isolation of Fucoxanthinol from Diatom Nitzschia Laevis
4.3. Cell Culture and Treatment
4.4. Cell Viability Assays
4.5. Nitric Oxide Assays
4.6. Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (RTPCR)
4.7. Enzyme-Linked Immunosorbent (ELISA) Assay
4.8. Western Blot Analysis
4.9. Detection of Intracellular ROS Production
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Block, M.; Zecca, L.; Hong, J. Microglia-mediated neurotoxicity: Uncovering the molecular mechanisms. Nat. Rev. Neurosci. 2007, 8, 57–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Voet, S.; Mc Guire, C.; Hagemeyer, N.; Martens, A.; Schroeder, A.; Wieghofer, P.; Daems, C.; Staszewski, O.; Walle, L.V.; Jordao, M.J.C. A20 critically controls microglia activation and inhibits inflammasome-dependent neuroinflammation. Nat. Commun. 2018, 9, 2036. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Junghyung, P.; Hoonsung, C.; Ju-Sik, M.; Sun-Ji, P.; Jung-Hak, K.; Hyo-Jin, P.; Bokyung, K.; Jung-Il, C.; Mijung, Y.; Dong-Seok, L. Mitochondrial dynamics modulate the expression of pro-inflammatory mediators in microglial cells. J. Neurochem. 2013, 127, 221–232. [Google Scholar]
- Ghoshal, A.; Das, S.; Ghosh, S.; Mishra, M.K.; Sharma, V.; Koli, P.; Sen, E.; Basu, A. Proinflammatory mediators released by activated microglia induces neuronal death in Japanese encephalitis. Glia 2010, 55, 483–496. [Google Scholar] [CrossRef] [Scilit]
- Salter, M.W.; Stevens, B. Microglia emerge as central players in brain disease. Nat. Med. 2017, 23, 1018–1027. [Google Scholar] [CrossRef] [Scilit]
- Brent, C.; Landreth, G.E. Inflammation, microglia, and Alzheimer’s disease. Neurobiol. Dis. 2010, 37, 503–509. [Google Scholar]
- Park, H.Y.; Han, M.H.; Park, C.; Jin, C.Y.; Kim, G.Y.; Choi, I.W.; Kim, N.D.; Nam, T.J.; Kwon, T.K.; Choi, Y.H. Anti-inflammatory effects of fucoidan through inhibition of NF-κB, MAPK and Akt activation in lipopolysaccharide-induced BV2 microglia cells. Food Chem. Toxicol. 2011, 49, 1745–1752. [Google Scholar]
- Lo, J.Y.; Kamarudin, M.N.A.; Hamdi, O.A.A.; Awang, K.; Kadir, H.A. Curcumenol isolated from Curcuma zedoaria suppresses Akt-mediated NF-κB activation and p38 MAPK signaling pathway in LPS-stimulated BV-2 microglial cells. Food Funct. 2015, 6, 3550–3559. [Google Scholar] [CrossRef] [Scilit]
- Cianciulli, A.; Calvello, R.; Porro, C.; Trotta, T.; Salvatore, R.; Panaro, M.A. PI3k/Akt signalling pathway plays a crucial role in the anti-inflammatory effects of curcumin in LPS-activated microglia. Int. Immunopharmacol. 2016, 36, 282–290. [Google Scholar] [CrossRef] [Scilit]
- Oh, Y.T.; Lee, J.Y.; Lee, J.; Kim, H.; Yoon, K.S.; Choe, W.; Kang, I. Oleic acid reduces lipopolysaccharide-induced expression of iNOS and COX-2 in BV2 murine microglial cells: Possible involvement of reactive oxygen species, p38 MAPK, and IKK/NF-κB signaling pathways. Neurosci. Lett. 2009, 464, 93–97. [Google Scholar] [CrossRef] [Scilit]
- Lu, M.; Gong, X. Upstream reactive oxidative species (ROS) signals in exogenous oxidative stress-induced mitochondrial dysfunction. Cell Biol. Int. 2009, 33, 658–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.H.; Gupta, S.C.; Park, B.; Yadav, V.R.; Aggarwal, B.B. Turmeric (Curcuma longa) inhibits inflammatory nuclear factor (NF)-κB and NF-κB-regulated gene products and induces death receptors leading to suppressed proliferation, induced chemosensitization, and suppressed osteoclastogenesis. Mol. Nutr. Food Res. 2012, 56, 454–465. [Google Scholar] [CrossRef] [Scilit]
- Huang, B.; He, D.; Chen, G.; Ran, X.; Guo, W.; Kan, X.; Wang, W.; Liu, D.; Fu, S.; Liu, J. α-Cyperone inhibits LPS-induced inflammation in BV-2 cells through activation of Akt/Nrf2/HO-1 and suppression of the NF-κB pathway. Food Funct. 2018, 9, 2735–2743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, H.-L.; Lin, S.-W.; Lee, C.-C.; Lin, K.-Y.; Liao, C.-H.; Yang, T.-Y.; Wang, H.-M.; Huang, H.-C.; Wu, C.-R.; Hseu, Y.-C. Induction of Nrf2-mediated genes by Antrodia salmonea inhibits ROS generation and inflammatory effects in lipopolysaccharide-stimulated RAW264.7 macrophages. Food Funct. 2015, 6, 229–240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, P.; Wong, C.-C.; Li, Y.; He, Y.; Mao, X.; Wu, T.; Ren, Y.; Chen, F. A novel strategy for isolation and purification of fucoxanthinol and fucoxanthin from the diatom Nitzschia laevis. Food Chem. 2019, 277, 566–572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, X.; Sun, H.; Zhao, W.; Cheng, K.-W.; Chen, F.; Liu, B. A Hetero-Photoautotrophic Two-Stage Cultivation Process for Production of Fucoxanthin by the Marine Diatom Nitzschia laevis. Mar. Drugs 2018, 16, 219. [Google Scholar] [CrossRef] [Scilit]
- Heo, S.J.; Yoon, W.J.; Kim, K.N.; Ahn, G.N.; Kang, S.M.; Kang, D.H.; Affan, A.; Oh, C.; Jung, W.K.; Jeon, Y.J. Evaluation of anti-inflammatory effect of fucoxanthin isolated from brown algae in lipopolysaccharide-stimulated RAW 264.7 macrophages. Food Chem. Toxicol. 2010, 48, 2045–2051. [Google Scholar] [CrossRef] [Scilit]
- Pangestuti, R.; Vo, T.S.; Ngo, D.H.; Kim, S.K. Fucoxanthin ameliorates inflammation and oxidative reponses in microglia. J. Agric. Food Chem. 2013, 61, 3876–3883. [Google Scholar] [CrossRef] [Scilit]
- Molina, N.; Morandi, A.C.; Bolin, A.P.; Otton, R. Comparative effect of fucoxanthin and vitamin C on oxidative and functional parameters of human lymphocytes. Int. Immunopharmacol. 2014, 22, 41–50. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Luna, A.; Ávila-Román, J.; Oliveira, H.; Motilva, V.; Talero, E. Fucoxanthin and Rosmarinic Acid Combination Has Anti-Inflammatory Effects through Regulation of NLRP3 Inflammasome in UVB-Exposed HaCaT Keratinocytes. Mar. Drugs 2019, 17, 451. [Google Scholar] [CrossRef] [Scilit]
- Peng, J.; Yuan, J.-P.; Wu, C.-F.; Wang, J.-H. Fucoxanthin, a marine carotenoid present in brown seaweeds and diatoms: Metabolism and bioactivities relevant to human health. Mar. Drugs 2011, 9, 1806–1828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kei, Y.; Chie, I.; Harukata, K.; Takeshi, Y.; Naoki, M. Fucoxanthin and its deacetylated product, fucoxanthinol, induce apoptosis of primary effusion lymphomas. Cancer Lett. 2011, 300, 225. [Google Scholar]
- Asai, A.; Sugawara, T.; Ono, H.; Nagao, A. Biotransformation of fucoxanthinol into amarouciaxanthin A in mice and HepG2 cells: Formation and cytotoxicity of fucoxanthin metabolites. Drug Metab. Dispos. 2004, 32, 205–211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maeda, H.; Hosokawa, M.; Sashima, T.; Takahashi, N.; Kawada, T.; Miyashita, K. Fucoxanthin and its metabolite, fucoxanthinol, suppress adipocyte differentiation in 3T3-L1 cells. Int. J. Mol. 2006, 18, 147–152. [Google Scholar] [CrossRef] [Scilit]
- Ishikawa, C.; Tafuku, S.; Kadekaru, T.; Sawada, S.; Tomita, M.; Okudaira, T.; Nakazato, T.; Toda, T.; Uchihara, J.N.; Taira, N. Antiadult T-cell leukemia effects of brown algae fucoxanthin and its deacetylated product, fucoxanthinol. Int. J. Cancer 2008, 123, 2702–2712. [Google Scholar] [CrossRef] [Scilit]
- Zeng, J.; Zhang, Y.; Ruan, J.; Yang, Z.; Wang, C.; Hong, Z.; Zuo, Z. Protective effects of fucoxanthin and fucoxanthinol against tributyltin-induced oxidative stress in HepG2 cells. Environ. Sci. Pollut. Res. Int. 2018, 25, 5582–5589. [Google Scholar] [CrossRef] [Scilit]
- Rwigemera, A.; Mamelona, J.; Martin, L.J. Inhibitory effects of fucoxanthinol on the viability of human breast cancer cell lines MCF-7 and MDA-MB-231 are correlated with modulation of the NF-kappaB pathway. Cell Biol. Toxicol. 2014, 30, 157–167. [Google Scholar] [CrossRef] [Scilit]
- Mohibbullah, M.; Haque, M.N.; Khan, M.N.A.; Park, I.-S.; Moon, I.S.; Hong, Y.-K. Neuroprotective effects of fucoxanthin and its derivative fucoxanthinol from the phaeophyte Undaria pinnatifida attenuate oxidative stress in hippocampal neurons. J. Appl. Phycol. 2018, 30, 3243–3252. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Wang, H.; Fan, Y.; Gao, Y.; Li, X.; Hu, Z.; Ding, K.; Wang, Y.; Wang, X. Fucoxanthin provides neuroprotection in models of traumatic brain injury via the Nrf2-ARE and Nrf2-autophagy pathways. Sci. Rep. 2017, 7, 46763. [Google Scholar] [CrossRef] [Scilit]
- Lin, J.; Huang, L.; Yu, J.; Xiang, S.; Wang, J.; Zhang, J.; Yan, X.; Cui, W.; He, S.; Wang, Q. Fucoxanthin, a Marine Carotenoid, Reverses Scopolamine-Induced Cognitive Impairments in Mice and Inhibits Acetylcholinesterase in Vitro. Mar. Drugs 2016, 14, 67. [Google Scholar] [CrossRef] [Scilit]
- Alzahrani, M.A.J.; Perera, C.O.; Sabaragamuwa, R.; Hemar, Y. Assessment of Bioactive Potential of Aqueous Protein Extracts from Diatoms Nitzschia laevis, Spirulina platensis, and Chlorella vulgaris. J. Aquat. Food Prod. Technol. 2019, 28, 177–193. [Google Scholar] [CrossRef] [Scilit]
- Sun, Z.; Peng, X.; Liu, J.; Fan, K.-W.; Wang, M.; Chen, F. Inhibitory effects of microalgal extracts on the formation of advanced glycation endproducts (AGEs). Food Chem. 2010, 120, 261–267. [Google Scholar] [CrossRef] [Scilit]
- D’Orazio, N.; Gemello, E.; Gammone, M.; de Girolamo, M.; Ficoneri, C.; Riccioni, G. Fucoxantin: A Treasure from the Sea. Mar. Drugs 2012, 10, 604–616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, P.; Cheng, K.W.; He, Y.; Liu, B.; Mao, X.; Chen, F. Screening and Identification of Inhibitors of Advanced Glycation Endproduct Formation from Microalgal Extracts. Food Funct. 2018, 9, 1683–1691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bin, L.; Jau-Shyong, H. Role of microglia in inflammation-mediated neurodegenerative diseases: Mechanisms and strategies for therapeutic intervention. J. Pharmacol. Exp. Ther. 2003, 304, 1. [Google Scholar]
- Maqbool, A.; Lattke, M.; Wirth, T.; Baumann, B. Sustained, neuron-specific IKK/NF-κB activation generates a selective neuroinflammatory response promoting local neurodegeneration with aging. Mol. Neurodegener. 2013, 8, 40. [Google Scholar] [CrossRef] [Scilit]
- Baeuerle, P.A.; Baltimore, D. NF-kappa B: Ten years after. Cell 1996, 87, 13–20. [Google Scholar] [CrossRef] [Scilit]
- Folbergrová, J.; Ješina, P.; Kubová, H.; Otáhal, J. Effect of resveratrol on oxidative stress and mitochondrial dysfunction in immature brain during epileptogenesis. Mol. Neurobiol. 2018, 55, 7512–7522. [Google Scholar] [CrossRef] [Scilit]
- Yuan, L.; Wu, Y.; Ren, X.; Liu, Q.; Wang, J.; Liu, X. Isoorientin attenuates lipopolysaccharide-induced pro-inflammatory responses through down-regulation of ROS-related MAPK/NF-κB signaling pathway in BV-2 microglia. Mol. Cell. Biochem. 2014, 386, 153–165. [Google Scholar] [CrossRef] [Scilit]
- Costa, A.P.; Lopes, M.W.; Rieger, D.K.; Barbosa, S.G.R.; Gonçalves, F.M.; Xikota, J.C.; Walz, R.; Leal, R.B. Differential activation of mitogen-activated protein kinases, ERK 1/2, p38 MAPK and JNK p54/p46 during postnatal development of rat hippocampus. Neurochem. Res. 2016, 41, 1160–1169. [Google Scholar] [CrossRef] [Scilit]
- Bonny, C.; Borsello, T.; Zine, A. Targeting the JNK pathway as a therapeutic protective strategy for nervous system diseases. Rev. Neurosci. 2005, 16, 57–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chia-Chung, H.; Chi-Chang, H.; Lie-Fen, S. Echinacea alkamides prevent lipopolysaccharide/D-galactosamine-induced acute hepatic injury through JNK pathway-mediated HO-1 expression. J. Agric. Food Chem. 2011, 59, 11966–11974. [Google Scholar]
- El-Remessy, A.B.; Tang, Y.; Zhu, G.; Matragoon, S.; Khalifa, Y.; Liu, E.K.; Liu, J.Y.; Hanson, E.; Mian, S.; Fatteh, N. Neuroprotective effects of cannabidiol in endotoxin-induced uveitis: Critical role of p38 MAPK activation. Mol. Vis. 2008, 49, 1331–1338. [Google Scholar]
- Aikawa, R.; Komuro, I.; Yamazaki, T.; Zou, Y.; Kudoh, S.; Tanaka, M.; Shiojima, I.; Hiroi, Y.; Yazaki, Y. Oxidative stress activates extracellular signal-regulated kinases through Src and Ras in cultured cardiac myocytes of neonatal rats. J. Clin. Investig. 1997, 100, 1813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Irving, E.A.; Mark, B. Role of mitogen- and stress-activated kinases in ischemic injury. J. Cereb. Blood Flow Metab. 2002, 22, 631–647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Hu, X.; Tian, G.G.; Cheng, P.; Li, Z.; Zhu, M.; Zhou, H.; Wu, J. C89 Induces Autophagy of Female Germline Stem Cells via Inhibition of the PI3K-Akt Pathway In Vitro. Cells 2019, 8, 606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, M.F.; Feng, Z.P.; Ou, Y.C.; Peng, J.J.; Li, K.; Gong, H.D.; Qiu, B.H.; Liu, Y.W.; Wang, Y.J.; Qi, S.T. Endoplasmic reticulum stress induces apoptosis of arginine vasopressin neurons in central diabetes insipidus via PI3K/Akt pathway. CNS Neurosci. Ther. 2019, 25, 562–574. [Google Scholar] [CrossRef] [Scilit]
- Luo, K.-W.; Lung, W.-Y.; Chun-Xie, X.-L.L.; Huang, W.-R. EGCG inhibited bladder cancer T24 and 5637 cell proliferation and migration via PI3K/AKT pathway. Oncotarget 2018, 9, 12261. [Google Scholar] [CrossRef] [Scilit]
- Xie, Q.; Wu, G.-Z.; Yang, N.; Shen, Y.-H.; Tang, J.; Zhang, W.-D. Delavatine A, an unusual isoquinoline alkaloid exerts anti-inflammation on LPS-induced proinflammatory cytokines production by suppressing NF-κB activation in BV-2 microglia. Biochem. Biophys. Res. Commun. 2018, 502, 202–208. [Google Scholar] [CrossRef] [Scilit]
- Jung, K.A.; Kwak, M.K. The Nrf2 system as a potential target for the development of indirect antioxidants. Molecules 2010, 15, 7266–7291. [Google Scholar]
- Kim, J.; Cha, Y.N.; Surh, Y.J. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders. Mutat. Res. 2010, 690, 12–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lauf, J.; Gebauer, G. On-Line Analysis of Stable Isotopes of Nitrogen in NH(3), NO, and NO(2) at Natural Abundance Levels. Anal. Chem. 1998, 70, 2750–2756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, H.G.; Xie, K.L.; Han, H.Z.; Wang, W.N.; Liu, D.Q.; Wang, G.L.; Yu, Y.H. Heme oxygenase-1 mediates the anti-inflammatory effect of molecular hydrogen in LPS-stimulated RAW 264.7 macrophages. Int. J. Surg. 2013, 11, 1060–1066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thimmulappa, R.K.; Fuchs, R.J.; Deepti, M.; Catherine, S.; Kassim, T.; Bream, J.H.; Trush, M.A.; Liby, K.T.; Sporn, M.B.; Kensler, T.W. Preclinical evaluation of targeting the Nrf2 pathway by triterpenoids (CDDO-Im and CDDO-Me) for protection from LPS-induced inflammatory response and reactive oxygen species in human peripheral blood mononuclear cells and neutrophils. Antioxid. Redox Signal. 2007, 9, 1963. [Google Scholar] [CrossRef] [Scilit]
- Park, S.Y.; Kim, Y.H.; Park, G. Cucurbitacins attenuate microglial activation and protect from neuroinflammatory injury through Nrf2/ARE activation and STAT/NF-κB inhibition. Neurosci. Lett. 2015, 609, 129–136. [Google Scholar] [CrossRef] [Scilit]
- Wei, J.; Wang, H.; Ji, Y.; Hu, Q.; Yan, W.; Chen, G.; Yin, H. Increased intestinal inflammatory response and gut barrier dysfunction in Nrf2-deficient mice after traumatic brain injury. Cytokine 2008, 44, 135–140. [Google Scholar]
- Bak, M.J.; Jun, M.; Jeong, W.S. Procyanidins from wild grape (Vitis amurensis) seeds regulate ARE-mediated enzyme expression via Nrf2 coupled with p38 and PI3K/Akt pathway in HepG2 cells. Int. J. Mol. Sci. 2012, 13, 801–818. [Google Scholar] [CrossRef] [Scilit]
- Buelna-Chontal, M.; Zazueta, C. Redox activation of Nrf2 & NF-κB: A double end sword? Cell. Signal. 2013, 25, 2548–2557. [Google Scholar]
- Ahmad, T.B.; Rudd, D.; Smith, J.; Kotiw, M.; Mouatt, P.; Seymour, L.M.; Liu, L.; Benkendorff, K. Anti-Inflammatory Activity and Structure-Activity Relationships of Brominated Indoles from a Marine Mollusc. Mar. Drugs 2017, 15, 133. [Google Scholar] [CrossRef] [Scilit]








| Genes | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| iNOS | GAAGAAAACCCCTTGTGCTG | GTCGATGTCACATGCAGCTT |
| COX-2 | GATGTTTGCATTCTTTGCCC | TGAAGCCATGACCTTTCGCATTAGCATGG |
| TNF-α | GAAAAGCAAGCAGCCAACCA | CGGATCATGCTTTCTGTGCTC |
| IL-1β | AATGACCTGTTCTTTGAAGTTGA | TGATGTGCTGCTGCGAGATTTGAAG |
| IL-6 | ACAAGTCGGAGGCTTAATTACACAT | TTGCCATTGCACAACTCTTTTC |
| β-actin | TCCTCCTGAGCGCAAGTACTCT | GCTCAGTAACAGTCCGCCTAGAA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Liu, L.; Sun, P.; Zhang, Y.; Wu, T.; Sun, H.; Cheng, K.-W.; Chen, F. Fucoxanthinol from the Diatom Nitzschia Laevis Ameliorates Neuroinflammatory Responses in Lipopolysaccharide-Stimulated BV-2 Microglia. Mar. Drugs 2020, 18, 116. https://doi.org/10.3390/md18020116
Li Y, Liu L, Sun P, Zhang Y, Wu T, Sun H, Cheng K-W, Chen F. Fucoxanthinol from the Diatom Nitzschia Laevis Ameliorates Neuroinflammatory Responses in Lipopolysaccharide-Stimulated BV-2 Microglia. Marine Drugs. 2020; 18(2):116. https://doi.org/10.3390/md18020116
Chicago/Turabian StyleLi, Yuelian, Lu Liu, Peipei Sun, Yifeng Zhang, Tao Wu, Han Sun, Ka-Wing Cheng, and Feng Chen. 2020. "Fucoxanthinol from the Diatom Nitzschia Laevis Ameliorates Neuroinflammatory Responses in Lipopolysaccharide-Stimulated BV-2 Microglia" Marine Drugs 18, no. 2: 116. https://doi.org/10.3390/md18020116
APA StyleLi, Y., Liu, L., Sun, P., Zhang, Y., Wu, T., Sun, H., Cheng, K.-W., & Chen, F. (2020). Fucoxanthinol from the Diatom Nitzschia Laevis Ameliorates Neuroinflammatory Responses in Lipopolysaccharide-Stimulated BV-2 Microglia. Marine Drugs, 18(2), 116. https://doi.org/10.3390/md18020116
