Accumulation γ-Aminobutyric Acid and Biogenic Amines in a Traditional Raw Milk Ewe’s Cheese
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cheese Manufacture
2.2. Microbial Analysis
2.3. qPCR Analysis
2.4. Free amino Acids (FAAs)
2.5. Biogenic Amines Determination
2.6. GABA Determination
3. Results and Discussion
3.1. Microbial Analysis
3.2. Biogenic Amines
3.3. γ-Aminobutyric Acid
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Schirone, M.; Tofalo, R.; Mazzone, G.; Corsetti, A.; Suzzi, G. Biogenic amine content and microbiological profile of Pecorino di Farindola cheese. Food Microbiol. 2011, 28, 128–136. [Google Scholar] [CrossRef] [PubMed]
- Di Giacomo, F.; Casolani, N.; Signore, A. Cheese making using pig rennet and calf rennet: Microorganisms and volatile compounds in Farindola ewe cheese. Ital. J. Food Sci. 2014, 26, 2. [Google Scholar]
- Suzzi, G.; Sacchetti, G.; Patrignani, F.; Corsetti, A.; Tofalo, R.; Schirone, M.; Fasoli, G.; Gardini, F.; Perpetuini, G.; Lanciotti, R. Influence of pig rennet on fatty acid composition, volatile molecule profile, texture and sensory properties of Pecorino di Farindola cheese. J. Sci. Food Agric. 2015, 95, 2252–2263. [Google Scholar] [CrossRef] [PubMed]
- Addis, M.; Piredda, G.; Pirisi, A. The use of lamb rennet paste in traditional sheep milk cheese production. Small Rumin. Res. 2008, 79, 2–10. [Google Scholar] [CrossRef]
- Addis, M.; Pirisi, A.; Di Salvo, R.; Podda, F.; Piredda, G. The influence of the enzymatic composition of lamb rennet paste on some properties of experimentally produced PDO Fiore Sardo cheese. Int. Dairy J. 2005, 15, 1271–1278. [Google Scholar] [CrossRef]
- Di Giacomo, F.; Del Signore, A.; Giaccio, M. Pig rennet in making Farindola ewe cheese. Prog. Nutr. 2013, 15, 226–238. [Google Scholar]
- Awad, S.; Lüthi-Peng, Q.-Q.; Puhan, Z. Proteolytic activities of chymosin and porcine pepsin on buffalo, cow, and goat whole and β-casein fractions. J. Agric. Food Chem. 1998, 46, 4997–5007. [Google Scholar] [CrossRef]
- Boudjellab, N.; Grosclaude, J.; Zhao, X.; Collin, J.C. Development of an inhibition enzyme-linked immunosorbent assay for the detection of residual porcine pepsin in a soft cheese sample. J. Agric. Food Chem. 1998, 46, 4030–4033. [Google Scholar] [CrossRef]
- Tofalo, R.; Schirone, M.; Fasoli, G.; Perpetuini, G.; Patrignani, F.; Manetta, A.C.; Lanciotti, R.; Corsetti, A.; Martino, G.; Suzzi, G. Influence of pig rennet on proteolysis, organic acids content and microbiota of Pecorino di Farindola, a traditional Italian ewe’s raw milk cheese. Food Chem. 2015, 175, 121–127. [Google Scholar] [CrossRef]
- Dalgleish, D.G. The enzymatic coagulation of milk. In Cheese: Chem, Phys and Microbiol; Springer: Boston, MA, USA, 1993; pp. 69–100. [Google Scholar]
- Barbieri, F.; Montanari, C.; Gardini, F.; Tabanelli, G. Biogenic amine production by lactic acid bacteria: A Review. Foods 2019, 8, 17. [Google Scholar] [CrossRef]
- Ordoñez, A.I.; Ibanez, F.C.; Torre, P.; Barcina, Y. Characterization of the casein hydrolysis of Idiazábal cheese manufactured from ovine milk. J. Dairy Sci. 1998, 81, 2089–2095. [Google Scholar] [CrossRef]
- Ladero, V.; Martinez, N.; Martín, M.C.; Fernández, M.; Alvarez, M.A. qPCR for quantitative detection of tyramine-producing bacteria in dairy products. Food Res. Int. 2010, 43, 289–295. [Google Scholar] [CrossRef]
- Tofalo, R.; Perpetuini, G.; Schirone, M.; Suzzi, G. Biogenic Amines: toxicology and health effect. Encyclopedia Food Health 2016, 424–429. [Google Scholar] [CrossRef]
- EFSA Panel on Biological Hazards (BIOHAZ). Scientific opinion on risk based control of biogenic amine formation in fermented foods. EFSA J. 2011, 9, 2393. [Google Scholar] [CrossRef]
- Ruiz-Capillas, C. Biogenic amine content in Spanish retail market meat products treated with protective atmosphere and high pressure. Eur. Food Res. Technol. 2004, 218, 237–241. [Google Scholar] [CrossRef]
- Tittarelli, F.; Perpetuini, G.; Di Gianvito, P.; Tofalo, R. Biogenic amines producing and degrading bacteria: A snapshot from raw ewes’ cheese. LWT 2019, 101, 1–9. [Google Scholar] [CrossRef]
- Diana, M.; Quilez, J.; Rafecas, M. Gamma-aminobutyric acid as a bioactive compound in foods: A review. J. Funct. Foods 2014, 10, 407–420. [Google Scholar] [CrossRef]
- Tajabadi, N.; Baradaran, A.; Ebrahimpour, A.; Rahim, R.A.; Bakar, F.A.; Manap, M.Y.A.; Mohammed, A.S.; Saari, N. Overexpression and optimization of glutamate decarboxylase in Lactobacillus plantarum Taj-Apis362 for high gamma-aminobutyric acid production. Microb. Biotechnol. 2015, 8, 623–632. [Google Scholar] [CrossRef]
- Hayakawa, K.; Kimura, M.; Kasaha, K.; Matsumoto, K.; Sansawa, H.; Yamori, Y. Effect of a γ-aminobutyric acid-enriched dairy product on the blood pressure of spontaneously hypertensive and normotensive Wistar–Kyoto rats. Br. J. Nutr. 2004, 92, 411–417. [Google Scholar] [CrossRef]
- Kajimoto, O.; Hirata, H.; Nakagawa, S.; Kajimoto, Y.; Hayakawa, K.; Kimura, M. Hypotensive Effect of Fermented milk containing gamma-aminobutyric acid (GABA) in subjects with high normal blood pressure. Nippon. Shokuhin Kagaku Kogaku Kaishi 2004, 51, 79–86. [Google Scholar] [CrossRef]
- Inoue, K.; Shirai, T.; Ochiai, H.; Kasao, M.; Hayakawa, K.; Kimura, M.; Sansawa, H. Blood-pressure-lowering effect of a novel fermented milk containing γ-aminobutyric acid (GABA) in mild hypertensives. Eur. J. Clin. Nutr. 2003, 57, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Ohmori, M. Effect of anaerobically treated tea on blood pressure of spontaneous hypertensive rats. Nippon Nogeik. Kaishi 1987, 61, 1449–1451. [Google Scholar] [CrossRef]
- Leenhouts, K.; Burghoorn, J.; Brands, J.R.; Sanders, J.W.; Venema, G.; Kok, J. A chloride-inducible acid resistance mechanism in Lactococcus lactis and its regulation. Mol. Microbiol. 1998, 27, 299–310. [Google Scholar]
- Aoki, H.; Furuya, Y.; Endo, Y.; Fujimoto, K. Effect of γ-Aminobutyric acid-enriched Tempeh-like fermented soybean (GABA-Tempeh) on the blood pressure of spontaneously hypertensive rats. Biosci. Biotechnol. Biochem. 2003, 67, 1806–1808. [Google Scholar] [CrossRef] [PubMed]
- Park, K.-B.; Oh, S.-H. Production of yogurt with enhanced levels of gamma-aminobutyric acid and valuable nutrients using lactic acid bacteria and germinated soybean extract. Bioresour. Technol. 2007, 98, 1675–1679. [Google Scholar] [CrossRef] [PubMed]
- Sun, T.; Zhao, S.; Wang, H.; Cai, C.; Chen, Y.; Zhang, H. ACE-inhibitory activity and gamma-aminobutyric acid content of fermented skim milk by Lactobacillus helveticus isolated from Xinjiang koumiss in China. Eur. Food Res. Technol. 2009, 228, 607–612. [Google Scholar] [CrossRef]
- Nadkarni, M.A.; Hunter, N.; Jacques, N.A.; Martin, F.E. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 2002, 148, 257–266. [Google Scholar] [CrossRef] [Green Version]
- Torriani, S.; Gatto, V.; Sembeni, S.; Tofalo, R.; Suzzi, G.; Belletti, N.; Gardini, F.; Bover-Cid, S. Rapid detection and quantification of tyrosine decarboxylase gene (tdc) and its expression in gram-positive bacteria associated with fermented foods using PCR-based methods. J. Food Prot. 2008, 71, 93–101. [Google Scholar] [CrossRef]
- Fernández, M.; Del Río, B.; Linares, D.; Martín, M.; Alvarez, M. Real-Time polymerase chain reaction for quantitative detection of histamine-producing bacteria: Use in cheese production. J. Dairy Sci. 2006, 89, 3763–3769. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR Data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Folkertsma, B.; Fox, P.F. Use of the Cd-ninhydrin reagent to assess proteolysis in cheese during ripening. J. Dairy Res. 1992, 59, 217–224. [Google Scholar] [CrossRef]
- Eerola, S.; Hinkkanen, R.; Lindfors, E.; Hirvi, T. Liquid chromatographic determination of biogenic amines in dry sausages. J. AOAC Int. 1993, 76, 575–577. [Google Scholar] [PubMed]
- Morea, M.; Matarante, A.; Di Cagno, R.; Baruzzi, F.; Minervini, F. Contribution of autochthonous non-starter lactobacilli to proteolysis in Caciocavallo Pugliese cheese. Int. Dairy J. 2007, 17, 525–534. [Google Scholar] [CrossRef]
- Moret, S.; Conte, L.S. High-performance liquid chromatographic evaluation of biogenic amines in foods an analysis of different methods of sample preparation in relation to food characteristics. J. Chromatogr. A 1996, 729, 363–369. [Google Scholar] [CrossRef]
- Kőrös, A.; Varga, Z.; Molnár-Perl, I. Simultaneous analysis of amino acids and amines as their o-phthalaldehyde-ethanethiol-9-fluorenylmethyl chloroformate derivatives in cheese by high-performance liquid chromatography. J. Chromatogr. A 2008, 1203, 146–152. [Google Scholar] [CrossRef] [PubMed]
- Ianni, A.; Di Maio, G.; Pittia, P.; Grotta, L.; Perpetuini, G.; Tofalo, R.; Cichelli, A.; Martino, G. Chemical–nutritional quality and oxidative stability of milk and dairy products obtained from Friesian cows fed with a dietary supplementation of dried grape pomace. J. Sci. Food Agric. 2019, 99, 3635–3643. [Google Scholar] [CrossRef]
- Diana, M.; Rafecas, M.; Arco, C.; Quilez, J. Free amino acid profile of Spanish artisanal cheeses: Importance of gamma-aminobutyric acid (GABA) and ornithine content. J. Food Compos. Anal. 2014, 35, 94–100. [Google Scholar] [CrossRef]
- Montel, M.-C.; Buchin, S.; Mallet, A.; Delbès-Paus, C.; Vuitton, D.A.; Desmasures, N.; Berthier, F. Traditional cheeses: Rich and diverse microbiota with associated benefits. Int. J. Food Microbiol. 2014, 177, 136–154. [Google Scholar] [CrossRef]
- Coton, M.; Delbès-Paus, C.; Irlinger, F.; Desmasures, N.; Le Flèche, A.; Stahl, V.; Montel, M.-C.; Coton, E. Diversity and assessment of potential risk factors of Gram-negative isolates associated with French cheeses. Food Microbiol. 2012, 29, 88–98. [Google Scholar] [CrossRef]
- Dahl, S.; Tavaria, F.K.; Malcata, F.X.; Malcata, F. Relationships between flavour and microbiological profiles in Serra da Estrela cheese throughout ripening. Int. Dairy J. 2000, 10, 255–262. [Google Scholar] [CrossRef]
- Schirone, M.; Tofalo, R.; Fasoli, G.; Perpetuini, G.; Corsetti, A.; Manetta, A.C.; Ciarrocchi, A.; Suzzi, G. High content of biogenic amines in Pecorino cheeses. Food Microbiol. 2013, 34, 137–144. [Google Scholar] [CrossRef] [PubMed]
- Morales, P.; Feliu, I.; Fernández-García, E.; Nuñez, M. Volatile compounds produced in cheese by Enterobacteriaceae strains of dairy origin. J. Food Prot. 2004, 67, 567–573. [Google Scholar] [CrossRef] [PubMed]
- Giraffa, G. Functionality of enterococci in dairy products. Int. J. Food Microbiol. 2003, 88, 215–222. [Google Scholar] [CrossRef]
- Suzzi, G.; Caruso, M.; Gardini, F.; Lombardi, A.; Vannini, L.; Guerzoni, M.E.; Andrighetto, C.; Lanorte, M.T. A survey of the enterococci isolated from an artisanal Italian goat’s cheese (semicotto caprino). J. Appl. Microbiol. 2000, 89, 267–274. [Google Scholar] [CrossRef]
- Renes, E.; Ladero, V.; Tornadijo, M.; Fresno, J. Production of sheep milk cheese with high γ-aminobutyric acid and ornithine concentration and with reduced biogenic amines level using autochthonous lactic acid bacteria strains. Food Microbiol. 2019, 78, 1–10. [Google Scholar] [CrossRef]
- Rodgers, S. Novel applications of live bacteria in food services: probiotics and protective cultures. Trends Food Sci. Technol. 2008, 19, 188–197. [Google Scholar] [CrossRef]
- Settanni, L.; Moschetti, G. Non-starter lactic acid bacteria used to improve cheese quality and provide health benefits. Food Microbiol. 2010, 27, 691–697. [Google Scholar] [CrossRef]
- Diaz, M.; Ladero, V.; Redruello, B.; Sanchez-Llana, E.; Del Rio, B.; Fernandez, M.; Martin, M.C.; Alvarez, M.A. A PCR-DGGE method for the identification of histamine-producing bacteria in cheese. Food Control. 2016, 63, 216–223. [Google Scholar] [CrossRef] [Green Version]
- Ascone, P.; Maurer, J.; Haldemann, J.; Irmler, S.; Berthoud, H.; Portmann, R.; Fröhlich-Wyder, M.-T.; Wechsler, D. Prevalence and diversity of histamine-forming Lactobacillus parabuchneri strains in raw milk and cheese—A case study. Int. Dairy J. 2017, 70, 26–33. [Google Scholar] [CrossRef]
- Berthoud, H.; Wüthrich, D.; Bruggmann, R.; Wechsler, D.; Fröhlich-Wyder, M.-T.; Irmler, S. Development of new methods for the quantitative detection and typing of Lactobacillus parabuchneri in dairy products. Int. Dairy J. 2017, 70, 65–71. [Google Scholar] [CrossRef]
- Diaz, M.; Del Rio, B.; Sanchez-Llana, E.; Ladero, V.; Redruello, B.; Fernández, M.; Martín, M.C.; Alvarez, M.A. Histamine-producing Lactobacillus parabuchneri strains isolated from grated cheese can form biofilms on stainless steel. Food Microbiol. 2016, 59, 85–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diaz, M.; Ladero, V.; Del Rio, B.; Redruello, B.; Fernández, M.; Martín, M.C.; Alvarez, M.A. Biofilm-forming capacity in biogenic amine-producing bacteria isolated from dairy products. Front. Microbiol. 2016, 7, 357. [Google Scholar] [CrossRef] [PubMed]
- Diaz, M.; Del Rio, B.; Sanchez-Llana, E.; Ladero, V.; Redruello, B.; Fernandez, M.; Martín, M.C.; Alvarez, M.A. Lactobacillus parabuchneri produces histamine in refrigerated cheese at a temperature-dependent rate. Int. J. Food Sci. Technol. 2018, 53, 2342–2348. [Google Scholar] [CrossRef]
- Freitas, A.; Pintado, A.E.; Pintado, M.E.; Malcata, F.; Pintado, M.M.; Malcata, F. Role of dominant microflora of Picante cheese on proteolysis and lipolysis. Int. Dairy J. 1999, 9, 593–603. [Google Scholar] [CrossRef]
- Sulejmani, E.; Hayaloglu, A.A. Influence of curd heating on proteolysis and volatiles of Kashkaval cheese. Food Chem. 2016, 211, 160–170. [Google Scholar] [CrossRef]
- Schirone, M.; Tofalo, R.; Perpetuini, G.; Manetta, A.C.; Di Gianvito, P.; Tittarelli, F.; Battistelli, N.; Corsetti, A.; Suzzi, G.; Martino, G. Influence of iodine feeding on microbiological and physico-chemical characteristics and biogenic amines content in a raw ewes’ milk cheese. Foods 2018, 7, 108. [Google Scholar] [CrossRef]
- Curtin, A.; McSweeney, P. Catabolism of amino acids in cheese during ripening. Cheese Chem. Phys. Microbiol. 2004, 1, 435–454. [Google Scholar]
- Hong-Xin, J.; Mi-Ya, S.; Guang-Yu, G. Influence of Lactobacillus casei LC2W on the proteolysis and aroma compounds of Cheddar cheese during ripening period. CyTA J. Food 2015, 13, 1–8. [Google Scholar] [CrossRef]
- López-Caballero, M.; Sánchez-Fernández, J.; Moral, A. Growth and metabolic activity of Shewanella putrefaciens maintained under different CO2 and O2 concentrations. Int. J. Food Microbiol. 2001, 64, 277–287. [Google Scholar] [CrossRef] [Green Version]
- Arena, M.; De Nadra, M.M. Biogenic amine production by Lactobacillus. J. Appl. Microbiol. 2001, 90, 158–162. [Google Scholar] [CrossRef] [PubMed]
- Pircher, A.; Bauer, F.; Paulsen, P. Formation of cadaverine, histamine, putrescine and tyramine by bacteria isolated from meat, fermented sausages and cheeses. Eur. Food Res. Technol. 2007, 226, 225–231. [Google Scholar] [CrossRef]
- Gorlier, A.; Lonati, M.; Renna, M.; Lussiana, C.; Lombardi, G.; Battaglini, L.M. Changes in pasture and cow milk compositions during a summer transhumance in the western Ital. Alps. J. Appl. Botany Food Qual. 2013, 85, 216–223. [Google Scholar]
- Tofalo, R.; Cocchi, S.; Suzzi, G. Polyamines and gut microbiota. Front. Nutr. 2019, 6, 16. [Google Scholar] [CrossRef] [PubMed]
- Linares, D.M.; Del Rio, B.; Redruello, B.; Ladero, V.; Martin, M.C.; Fernandez, M.; Ruas-Madiedo, P.; Alvarez, M.A. Comparative analysis of the in vitro cytotoxicity of the dietary biogenic amines tyramine and histamine. Food Chem. 2016, 197, 658–663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coton, E.; Coton, M. Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis. Food Microbiol. 2009, 26, 52–57. [Google Scholar] [CrossRef]
- Wüthrich, D.; Berthoud, H.; Wechsler, D.; Eugster, E.; Irmler, S.; Bruggmann, R. The histidine decarboxylase gene cluster of Lactobacillus parabuchneri was gained by horizontal gene transfer and is mobile within the species. Front. Microbiol. 2017, 8, 218. [Google Scholar] [CrossRef] [PubMed]
- Molenaar, D.; Bosscher, J.S.; Driessen, A.J.; Konings, W.N.; Brink, B.T. Generation of a proton motive force by histidine decarboxylation and electrogenic histidine/histamine antiport in Lactobacillus buchneri. J. Bacteriol. 1993, 175, 2864–2870. [Google Scholar] [CrossRef]
- Fernández, M.; Zuñiga, M. Amino Acid Catabolic Pathways of Lactic Acid Bacteria. Crit. Rev. Microbiol. 2006, 32, 155–183. [Google Scholar] [CrossRef]
- Lucas, P.M.; Blancato, V.S.; Claisse, O.; Magni, C.; Lolkema, J.S.; Lonvaud-Funel, A.; Blancato, V. Agmatine deiminase pathway genes in Lactobacillus brevis are linked to the tyrosine decarboxylation operon in a putative acid resistance locus. Microbiology 2007, 153, 2221–2230. [Google Scholar] [CrossRef]
- Arena, M.P.; Russo, P.; Capozzi, V.; Beneduce, L.; Spano, G. Effect of abiotic stress conditions on expression of the Lactobacillus brevis IOEB 9809 tyrosine decarboxylase and agmatine deiminase genes. Ann. Microbiol. 2011, 61, 179–183. [Google Scholar] [CrossRef]
- Siragusa, S.; De Angelis, M.; Di Cagno, R.; Rizzello, C.G.; Coda, R.; Gobbetti, M. Synthesis of γ-aminobutyric acid by lactic acid bacteria isolated from a variety of Italian cheese. Appl. Environ. Microbiol. 2007, 73, 7283–7290. [Google Scholar] [CrossRef] [PubMed]
- Nomura, M.; Kimoto, H.; Someya, Y.; Furukawa, S.; Suzuki, I. Production of γ-aminobutyric acid by cheese starters during cheese ripening. J. Dairy Sci. 1998, 81, 1486–1491. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) | qPCR Conditions | References |
---|---|---|---|
16SF 16SR | TCCTACGGGAGGCAGCAGT GGACTACCAGGGTATCTAATCCTGTT | 95 °C for 10 min, 40 cycles at 95 °C for 15 s, 60 °C for 1 min, 72 °C for 45 s | [28] |
Tyr3 Tyr4 | CGTACACATTCAGTTGCATGGCAT ATGTCCTACTTCTTCTTCCATTTG | 94 °C for 5 min, 35 cycles at 94 °C for 20 s, 58 °C for 30 s, 72 °C for 45 s | [29] |
Hdc1 Hdc2 | TTGACCGTATCTCAGTGAGTCCAT ACGGTCATACGAAACAATACCATC | 95 °C for 10 min, 40 cycles at 95 °C for 15 s, 58 °C for 1 min, 72 °C for 45 s | [30] |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tofalo, R.; Perpetuini, G.; Battistelli, N.; Pepe, A.; Ianni, A.; Martino, G.; Suzzi, G. Accumulation γ-Aminobutyric Acid and Biogenic Amines in a Traditional Raw Milk Ewe’s Cheese. Foods 2019, 8, 401. https://doi.org/10.3390/foods8090401
Tofalo R, Perpetuini G, Battistelli N, Pepe A, Ianni A, Martino G, Suzzi G. Accumulation γ-Aminobutyric Acid and Biogenic Amines in a Traditional Raw Milk Ewe’s Cheese. Foods. 2019; 8(9):401. https://doi.org/10.3390/foods8090401
Chicago/Turabian StyleTofalo, Rosanna, Giorgia Perpetuini, Noemi Battistelli, Alessia Pepe, Andrea Ianni, Giuseppe Martino, and Giovanna Suzzi. 2019. "Accumulation γ-Aminobutyric Acid and Biogenic Amines in a Traditional Raw Milk Ewe’s Cheese" Foods 8, no. 9: 401. https://doi.org/10.3390/foods8090401