Deciphering the Molecular Mechanisms Sustaining the Estrogenic Activity of the Two Major Dietary Compounds Zearalenone and Apigenin in ER-Positive Breast Cancer Cell Lines
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Reagents
2.2. Luciferase Assay
2.3. Chromatin Immunoprecipitation
2.4. RNA Extraction and Real-Time PCR
2.5. Proliferation Assay
2.6. Cell Cycle Analysis
2.7. Apoptosis Analysis
2.8. Statistical Analysis
2.9. Transcriptomic Analysis
2.10. Microarray Data Analysis and Gene Filtration
2.11. Functional Data Mining
2.12. Regulatory Network Analysis
3. Results
3.1. ER Is Transactivated by Zearalenone and Apigenin
3.2. Zearalenone and Apigenin Are Able to Induce the Recruitment of ERα DNA-Binding at Chromatin Sites
3.3. Induction of E2-Dependent Genes Is Different between Zearalenone and Apigenin
3.4. Zearalenone and Apigenin Have Different ER-Dependent Proliferative Effects on MCF-7 Cells
3.5. Genome Wide Microarray Analysis
3.6. Regulatory Network Analysis Revealed
3.7. Zearalenone and Apigenin alter the Expression of Genes Involved in Cell Cycle and Growth Arrest
3.8. Zearalenone and Apigenin Alter the Expression of Genes Linked to Cancer, Nucleoli and Apoptosis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Rudel, R.A.; Attfield, K.R.; Schifano, J.N.; Brody, J.G. Chemicals causing mammary gland tumors in animals signal new directions for epidemiology, chemicals testing, and risk assessment for breast cancer prevention. Cancer 2007, 109, 2635–2666. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Crain, D.A.; Janssen, S.J.; Edwards, T.M.; Heindel, J.; Ho, S.; Hunt, P.; Iguchi, T.; Juul, A.; McLachlan, J.A.; Schwartz, J.; et al. Female reproductive disorders: The roles of endocrine-disrupting compounds and developmental timing. Fertil. Steril. 2008, 90, 911–940. [Google Scholar] [CrossRef] [PubMed]
- Wu, A.H.; Yu, M.C.; Tseng, C.-C.; Pike, M.C. Epidemiology of soy exposures and breast cancer risk. Br. J. Cancer 2008, 98, 9–14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caan, B.J.; Natarajan, L.; Parker, B.; Gold, E.B.; Thomson, C.; Newman, V.; Rock, C.L.; Pu, M.; Al-Delaimy, W.; Pierce, J.P. Soy food consumption and breast cancer prognosis. Cancer Epidemiol. Biomark. Prev. 2011, 20, 854–858. [Google Scholar] [CrossRef] [PubMed]
- Lecomte, S.; Lelong, M.; Bourgine, G.; Efstathiou, T.; Saligaut, C.; Pakdel, F. Assessment of the potential activity of major dietary compounds as selective estrogen receptor modulators in two distinct cell models for proliferation and differentiation. Toxicol. Appl. Pharmacol. 2017, 325, 61–70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marin, S.; Ramos, A.J.; Cano-Sancho, G.; Sanchis, V. Mycotoxins: Occurrence, toxicology, and exposure assessment. Food Chem. Toxicol. 2013, 60, 218–237. [Google Scholar] [CrossRef] [PubMed]
- Mauro, T.; Hao, L.; Pop, L.C.; Buckley, B.; Schneider, S.H.; Bandera, E.V.; Shapses, S.A. Circulating zearalenone and its metabolites differ in women due to body mass index and food intake. Food Chem. Toxicol. 2018, 116, 227–232. [Google Scholar] [CrossRef]
- Madunić, J.; Madunić, I.V.; Gajski, G.; Popić, J.; Garaj-Vrhovac, V. Apigenin: A dietary flavonoid with diverse anticancer properties. Cancer Lett. 2018, 413, 11–22. [Google Scholar] [CrossRef]
- Hostetler, G.L.; Ralston, R.A.; Schwartz, S.J. Flavones: Food Sources, Bioavailability, Metabolism, and Bioactivity. Adv. Nutr. Int. Rev. J. 2017, 8, 423–435. [Google Scholar] [CrossRef] [Green Version]
- Gates, M.A.; Tworoger, S.S.; Hecht, J.L.; De Vivo, I.; Rosner, B.; Hankinson, S.E. A prospective study of dietary flavonoid intake and incidence of epithelial ovarian cancer. Int. J. Cancer 2007, 121, 2225–2232. [Google Scholar] [CrossRef] [Green Version]
- Gradolatto, A.; Basly, J.; Berges, R.; Teyssier, C.; Chagnon, M.; Siess, M.; Canivenc-Lavier, M. Pharmacokinetics and metabolism of apigenin in female and male rats after a single oral administration. Drug Metab. Dispos. 2004, 33, 49–54. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Li, J.; Yan, C. Simultaneous determination of three flavonoids and one coumarin by LC-MS/MS: Application to a comparative pharmacokinetic study in normal and arthritic rats after oral administration of Daphne genkwa extract. Biomed. Chromatogr. 2018, e4233. [Google Scholar] [CrossRef] [PubMed]
- Hanske, L.; Loh, G.; Sczesny, S.; Blaut, M.; Braune, A. The bioavailability of apigenin-7-glucoside is influenced by human intestinal microbiota in rats. J. Nutr. 2009, 139, 1095–1102. [Google Scholar] [CrossRef] [PubMed]
- Ström, A.; Hartman, J.; Foster, J.S.; Kietz, S.; Wimalasena, J.; Gustafsson, J.-A. Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation of the breast cancer cell line T47D. Proc. Natl. Acad. Sci. USA 2004, 101, 1566–1571. [Google Scholar] [CrossRef] [PubMed]
- Couse, J.F.; Korach, K.S. Estrogen receptor null mice: What have we learned and where will they lead us? Endocr. Rev. 1999, 20, 358–417. [Google Scholar] [CrossRef] [PubMed]
- Levin, E.R.; Pietras, R.J. Estrogen receptors outside the nucleus in breast cancer. Breast Cancer Res. Treat. 2008, 108, 351–361. [Google Scholar] [CrossRef] [PubMed]
- Burns, K.A.; Korach, K.S. Estrogen receptors and human disease: An update. Arch. Toxicol. 2012, 86, 1491–1504. [Google Scholar] [CrossRef] [PubMed]
- WHO. Breast Cancer Factsheet, Globocan 2018. Available online: http://gco.iarc.fr/today/data/factsheets/cancers/20-Breast-fact-sheet.pdf (accessed on 18 January 2019).
- Marcotte, R.; Sayad, A.; Brown, K.R.; Sanchez-Garcia, F.; Reimand, J.; Haider, M.; Virtanen, C.; Bradner, J.E.; Bader, G.D.; Mills, G.B.; et al. Functional Genomic Landscape of Human Breast Cancer Drivers, Vulnerabilities, and Resistance. Cell 2016, 164, 293–309. [Google Scholar] [CrossRef]
- Lecomte, S.; Chalmel, F.; Ferriere, F.; Percevault, F.; Plu, N.; Saligaut, C.; Surel, C.; Lelong, M.; Efstathiou, T.; Pakdel, F. Glyceollins trigger anti-proliferative effects through estradiol-dependent and independent pathways in breast cancer cells. Cell Commun. Signal. 2017, 15. [Google Scholar] [CrossRef]
- Chalmel, F.; Primig, M. The Annotation, Mapping, Expression and Network (AMEN) suite of tools for molecular systems biology. BMC Bioinform. 2008, 9, 86. [Google Scholar] [CrossRef]
- Smyth, G.K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 2004, 3. [Google Scholar] [CrossRef] [PubMed]
- Lê, S.; Josse, J.; Husson, F. FactoMineR: An R Package for Multivariate Analysis. J. Stat. Softw. 2008, 25, 1–18. [Google Scholar] [CrossRef]
- Yusuf, D.; Butland, S.L.; Swanson, M.I.; Bolotin, E.; Ticoll, A.; Cheung, W.A.; Zhang, X.Y.C.; Dickman, C.T.D.; Fulton, D.L.; Lim, J.S.; et al. The transcription factor encyclopedia. Genome Biol. 2012, 13, R24. [Google Scholar] [CrossRef] [PubMed]
- Bojcsuk, D.; Nagy, G.; Balint, B.L. Inducible super-enhancers are organized based on canonical signal-specific transcription factor binding elements. Nucleic Acids Res. 2017, 45, 3693–3706. [Google Scholar] [CrossRef] [PubMed]
- Darde, T.A.; Gaudriault, P.; Beranger, R.; Lancien, C.; Caillarec-Joly, A.; Sallou, O.; Bonvallot, N.; Chevrier, C.; Mazaud-Guittot, S.; Jégou, B.; et al. TOXsIgN: A cross-species repository for toxicogenomic signatures. Bioinformatics 2018, 34, 2116–2122. [Google Scholar] [CrossRef] [PubMed]
- Porter, S.; Scott, S.D.; Sassoon, E.M.; Williams, M.R.; Jones, J.L.; Girling, A.C.; Ball, R.Y.; Edwards, D.R. Dysregulated expression of adamalysin-thrombospondin genes in human breast carcinoma. Clin. Cancer Res. 2004, 10, 2429–24240. [Google Scholar] [CrossRef]
- Dahlman-Wright, K.; Qiao, Y.; Jonsson, P.; Gustafsson, J.-Å.; Williams, C.; Zhao, C. Interplay between AP-1 and estrogen receptor α in regulating gene expression and proliferation networks in breast cancer cells. Carcinogenesis 2012, 33, 1684–1691. [Google Scholar] [CrossRef]
- Shin, D.-H.; Park, J.-H.; Lee, J.-Y.; Won, H.-Y.; Jang, K.-S.; Min, K.-W.; Jang, S.-H.; Woo, J.-K.; Oh, S.H.; Kong, G. Overexpression of Id1 in transgenic mice promotes mammary basal stem cell activity and breast tumorigenesis. Oncotarget 2015, 6, 17276–17290. [Google Scholar] [CrossRef]
- Tong, D.; Heinze, G.; Pils, D.; Wolf, A.; Singer, C.F.; Concin, N.; Hofstetter, G.; Schiebel, I.; Rudas, M.; Zeillinger, R. Gene expression of PMP22 is an independent prognostic factor for disease-free and overall survival in breast cancer patients. BMC Cancer 2010, 10, 682. [Google Scholar] [CrossRef]
- Hua, W.-F.; Zhong, Q.; Xia, T.-L.; Chen, Q.; Zhang, M.-Y.; Zhou, A.-J.; Tu, Z.-W.; Qu, C.; Li, M.-Z.; Xia, Y.-F.; et al. RBM24 suppresses cancer progression by upregulating miR-25 to target MALAT1 in nasopharyngeal carcinoma. Cell Death Dis. 2016, 7, e2352. [Google Scholar] [CrossRef]
- Zhang, M.; Zhang, Y.; Xu, E.; Mohibi, S.; de Anda, D.M.; Jiang, Y.; Zhang, J.; Chen, X. Rbm24, a target of p53, is necessary for proper expression of p53 and heart development. Cell Death Differ. 2018. [Google Scholar] [CrossRef] [PubMed]
- Luengo-Fernandez, R.; Leal, J.; Gray, A.; Sullivan, R. Economic burden of cancer across the European Union: A population-based cost analysis. Lancet Oncol. 2013, 14, 1165–1174. [Google Scholar] [CrossRef]
- Baudry, J.; Assmann, K.E.; Touvier, M.; Allès, B.; Seconda, L.; Latino-Martel, P.; Ezzedine, K.; Galan, P.; Hercberg, S.; Lairon, D.; et al. Association of Frequency of Organic Food Consumption With Cancer Risk. JAMA Intern. Med. 2018. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Luh, C.J.; Burns, K.A.; Arao, Y.; Jiang, Z.; Teng, C.T.; Tice, R.R.; Korach, K.S. Endocrine-Disrupting Chemicals (EDCs): In Vitro Mechanism of Estrogenic Activation and Differential Effects on ER Target Genes. Environ. Health Perspect. 2013, 121, 459–466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Burns, K.A.; Arao, Y.; Luh, C.J.; Korach, K.S. Differential estrogenic actions of endocrine-disrupting chemicals bisphenol A, bisphenol AF, and zearalenone through estrogen receptor α and β in vitro. Environ. Health Perspect. 2012, 120, 1029–1035. [Google Scholar] [CrossRef] [PubMed]
- Seo, H.-S.; DeNardo, D.G.; Jacquot, Y.; Laïos, I.; Vidal, D.S.; Zambrana, C.R.; Leclercq, G.; Brown, P.H. Stimulatory effect of genistein and apigenin on the growth of breast cancer cells correlates with their ability to activate ER alpha. Breast Cancer Res. Treat. 2006, 99, 121–134. [Google Scholar] [CrossRef]
- Cozzini, P.; Dellafiora, L. In silico approach to evaluate molecular interaction between mycotoxins and the estrogen receptors ligand binding domain: A case study on zearalenone and its metabolites. Toxicol. Lett. 2012, 214, 81–85. [Google Scholar] [CrossRef]
- Métivier, R.; Penot, G.; Flouriot, G.; Pakdel, F. Synergism between ERalpha transactivation function 1 (AF-1) and AF-2 mediated by steroid receptor coactivator protein-1: Requirement for the AF-1 alpha-helical core and for a direct interaction between the N- and C-terminal domains. Mol. Endocrinol. 2001, 15, 1953–1970. [Google Scholar] [CrossRef]
- Arao, Y.; Coons, L.A.; Zuercher, W.J.; Korach, K.S. Transactivation Function-2 of Estrogen Receptor α Contains Transactivation Function-1-regulating Element. J. Biol. Chem. 2015, 290, 17611–17627. [Google Scholar] [CrossRef] [Green Version]
- Pike, A.C.; Brzozowski, A.M.; Walton, J.; Hubbard, R.E.; Bonn, T.; Gustafsson, J.A.; Carlquist, M. Structural aspects of agonism and antagonism in the oestrogen receptor. Biochem. Soc. Trans. 2000, 28, 396–400. [Google Scholar] [CrossRef]
- Dellafiora, L.; Galaverna, G.; Dall’Asta, C.; Cozzini, P. Hazard identification of cis/trans -zearalenone through the looking-glass. Food Chem. Toxicol. 2015, 86, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Welboren, W.-J.; Sweep, F.C.G.J.; Span, P.N.; Stunnenberg, H.G. Genomic actions of estrogen receptor alpha: What are the targets and how are they regulated? Endocr. Relat. Cancer 2009, 16, 1073–1089. [Google Scholar] [CrossRef]
- Wang, I.-C.; Chen, Y.-J.; Hughes, D.; Petrovic, V.; Major, M.L.; Park, H.J.; Tan, Y.; Ackerson, T.; Costa, R.H. Forkhead box M1 regulates the transcriptional network of genes essential for mitotic progression and genes encoding the SCF (Skp2-Cks1) ubiquitin ligase. Mol. Cell. Biol. 2005, 25, 10875–10894. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.C.; Granieri, L.; Shrestha, M.; Wang, D.-Y.; Vorobieva, I.; Rubie, E.A.; Jones, R.; Ju, Y.; Pellecchia, G.; Jiang, Z.; et al. Identification of CDC25 as a Common Therapeutic Target for Triple-Negative Breast Cancer. Cell Rep. 2018, 23, 112–126. [Google Scholar] [CrossRef] [PubMed]
- Gilkes, D.M.; Semenza, G.L. Role of hypoxia-inducible factors in breast cancer metastasis. Future Oncol. 2013, 9, 1623–1636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, J.; AlTahan, A.; Jones, D.T.; Buffa, F.M.; Bridges, E.; Interiano, R.B.; Qu, C.; Vogt, N.; Li, J.-L.; Baban, D.; et al. Estrogen receptor-α directly regulates the hypoxia-inducible factor 1 pathway associated with antiestrogen response in breast cancer. Proc. Natl. Acad. Sci. USA 2015, 112, 15172–15177. [Google Scholar] [CrossRef] [PubMed]
- Fuady, J.H.; Gutsche, K.; Santambrogio, S.; Varga, Z.; Hoogewijs, D.; Wenger, R.H. Estrogen-dependent downregulation of hypoxia-inducible factor (HIF)-2α in invasive breast cancer cells. Oncotarget 2016, 7, 31153–31165. [Google Scholar] [CrossRef] [Green Version]
- DeYoung, M.P.; Horak, P.; Sofer, A.; Sgroi, D.; Ellisen, L.W. Hypoxia regulates TSC1/2 mTOR signaling and tumor suppression through REDD1-mediated 14 3 3 shuttling. Genes Dev. 2008, 22, 239–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shukla, S.; Gupta, S. Apigenin-induced Cell Cycle Arrest is Mediated by Modulation of MAPK, PI3K-Akt, and Loss of Cyclin D1 Associated Retinoblastoma Dephosphorylation in Human Prostate Cancer Cells. Cell Cycle 2007, 6, 1102–1114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Z.; Tang, M.; Liu, Y.; Zhang, Z.; Lu, R.; Lu, J. Apigenin inhibits cell proliferation, migration, and invasion by targeting Akt in the A549 human lung cancer cell line. Anticancer Drugs 2017, 28, 446–456. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Pi, C.; Wang, G. Inhibition of PI3K/Akt/mTOR pathway by apigenin induces apoptosis and autophagy in hepatocellular carcinoma cells. Biomed. Pharmacother. 2018, 103, 699–707. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.; Zhang, Z.; Song, J.; Cheng, X.; Jiang, J.; Jia, X. Enhanced bioavailability of apigenin via preparation of a carbon nanopowder solid dispersion. Int. J. Nanomed. 2014, 9, 2327–2333. [Google Scholar] [CrossRef] [PubMed]
- Kowalska, K.; Habrowska-Górczyńska, D.E.; Piastowska-Ciesielska, A.W. Zearalenone as an endocrine disruptor in humans. Environ. Toxicol. Pharmacol. 2016, 48, 141–149. [Google Scholar] [CrossRef] [PubMed]
Gene Name and Symbol | Forward Primer | Reverse Primer |
---|---|---|
Chemokine (C-X-C motif) ligand 12 (CXCL12) | CACCATTGAGAGGTCGGAAG | AATGAGACCCGTCTTTGCAG |
Progesterone receptor (PgR) | CCCGCCGTCGTAACTTTGG | GTGCCTATCCTGCCTCTCAATC |
Amphiregulin (AREG) | GTATTTTCACTTTCCGTCTTGTTTTG | CCTGGCTATATTGTCGATTCA |
Growth regulation in breast cancer 1 (GREB1) | GAGGATGTGGAGTGGAGACC | CAGTACCTCAAAGACCTCGGC |
Forkhead box M1 (FOXM1) | AGCGAGACCCATCAAAGTGG | GGTCTTGGGGTGGGAGATTG |
Cell division cycle 25A (CDC25A) | CAAGGGTGCAGTGAACTTGC | ACAACAATGACACGCTTGCC |
Cell division cycle 25B (CDC25B) | CTACTGCTGTGAACCCTGGG | CAACAAAACGCTCCCACCTG |
Cyclin B1 (CCNB1) | TCTGGATAATGGTGAATGGACA | CGATGTGGCATACTTGTTCTTG |
Centromere protein A (CENPA) | ACATGCAGGCCGAGTTACTC | AGAGTCCCCGGTATCATCCC |
Polo-like kinase 1 (PLK1) | CTCAACACGCCTCATCCTC | GTGCTCGCTCATGTAATTGC |
Cyclin-dependent kinase inhibitor 1A (CDKN1A/p21) | CTGTCTTGTACCCTTGTGCC | GGTAGAAATCTGTCATGCTGG |
Endothelial PAS domain protein 1 (EPAS1/HIF2α) | GCGCTAGACTCCGAGAACAT | TGGCCACTTACTACCTGACCCTT |
Vascular endothelial growth factor A (VEGFA) | AGGAGGAGGGCAGAATCATCA | CTCGATTGGATGGCAGTAGCT |
Lactate dehydrogenase A (LDHA) | GGCCTGTGCCATCAGTATCT | GCCGTGATAATGACCAGCTT |
DNA damage-inducible transcript 4 (DDIT4/REDD1) | AGGAAGCTCATTGAGTTGTG | GGTACATGCTACACACACAT |
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) | GGGCATCCTGGGCTACACTG | GGGCATCCTGGGCTACACTG |
TATA box binding protein (TBP) | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lecomte, S.; Demay, F.; Pham, T.H.; Moulis, S.; Efstathiou, T.; Chalmel, F.; Pakdel, F. Deciphering the Molecular Mechanisms Sustaining the Estrogenic Activity of the Two Major Dietary Compounds Zearalenone and Apigenin in ER-Positive Breast Cancer Cell Lines. Nutrients 2019, 11, 237. https://doi.org/10.3390/nu11020237
Lecomte S, Demay F, Pham TH, Moulis S, Efstathiou T, Chalmel F, Pakdel F. Deciphering the Molecular Mechanisms Sustaining the Estrogenic Activity of the Two Major Dietary Compounds Zearalenone and Apigenin in ER-Positive Breast Cancer Cell Lines. Nutrients. 2019; 11(2):237. https://doi.org/10.3390/nu11020237
Chicago/Turabian StyleLecomte, Sylvain, Florence Demay, Thu Ha Pham, Solenn Moulis, Théo Efstathiou, Frédéric Chalmel, and Farzad Pakdel. 2019. "Deciphering the Molecular Mechanisms Sustaining the Estrogenic Activity of the Two Major Dietary Compounds Zearalenone and Apigenin in ER-Positive Breast Cancer Cell Lines" Nutrients 11, no. 2: 237. https://doi.org/10.3390/nu11020237
APA StyleLecomte, S., Demay, F., Pham, T. H., Moulis, S., Efstathiou, T., Chalmel, F., & Pakdel, F. (2019). Deciphering the Molecular Mechanisms Sustaining the Estrogenic Activity of the Two Major Dietary Compounds Zearalenone and Apigenin in ER-Positive Breast Cancer Cell Lines. Nutrients, 11(2), 237. https://doi.org/10.3390/nu11020237