Direct PCR for Rapid and Safe Pathogen Detection: Laboratory Evaluation Supporting Field Use in Infectious Disease Outbreak

Abstract

Rapid, safe, and field-deployable molecular diagnostics are crucial for the effective management of infectious disease outbreaks, particularly those involving highly infectious pathogens, which can produce clinical symptoms similar to less infectious pathogens, thus raising potential biosafety concerns. In this study, we evaluated DNA/RNA Defend Pro (DRDP) buffer, a novel viral-inactivating transport medium designed to stabilize nucleic acids and allow direct PCR without nucleic acid extraction. To ensure critical qPCR parameters were not compromised by using DRDP, we conducted serial dilution tests using herpes simplex viruses 1 and 2 (HSV-1, HSV-2) and varicella-zoster virus (VZV), comparing DRDP to standard universal transport medium (UTM). Detection sensitivity, determined by cycle quantification (Cq) values, favored DRDP, as UTM samples required a 2–3-fold dilution to mitigate PCR inhibition. DRDP maintained reliable PCR compatibility at reaction volumes containing up to 25% buffer. At higher DRDP concentrations (30–35%), PCR inhibition occurred due to EDTA content but was fully reversible by adding supplemental magnesium. Furthermore, DRDP samples did not require an initial 95 °C thermal lysis step, thus simplifying the procedure without reducing PCR sensitivity or efficiency.

1. Introduction

The rapid detection of infectious agents is essential for controlling emerging infectious diseases [1]. Traditional PCR-based diagnostics [2] typically require nucleic acid extraction prior to PCR, which introduces biosafety hazards, added complexity and costs, and delays in turnaround time [2]. Efforts have aimed to simplify diagnostic workflows by implementing direct PCR methods that omit extraction steps, thereby reducing the time [3,4] and resources required. However, the success of direct PCR depends on the medium used for sample transport, pathogen inactivation, and nucleic acid stabilization. Many standard transport media are not compatible with direct PCR due to the presence of PCR inhibitors, or the need for complex sample handling [5,6]. Although DRDP is formulated to preserve both RNA and DNA, this study focused solely on DNA viruses (HSV-1, HSV-2, VZV) as a model system to evaluate the buffer’s compatibility with direct PCR and assess its effect at high sample input volumes.

DNA/RNA Defend Pro (DRDP) buffer has been developed as a universal, virus-inactivating transport medium formulated with chelating agents and mild detergents. It contains components including EDTA and citric acid (maintaining the buffer at approximately pH 2) along with a proprietary non-ionic detergent. This formulation ensures pathogen inactivation, compatibility with rapid antigen testing, and nucleic acid stability, without the PCR inhibitors commonly found in guanidinium-based lysis buffers. Unlike guanidinium-based solutions—which strongly inhibit PCR and therefore require extraction [7]—DRDP buffer allows direct PCR on the sample without nucleic acid purification [8,9]. The buffer effectively lyses virions and preserves DNA/RNA while also permitting downstream amplification. Moreover, by inactivating pathogens on contact, DRDP enhances biosafety for personnel handling clinical specimens [9].

An example of an emerging diagnostic challenge underscoring these needs is the recent global outbreak of mpox (formerly referred to as monkeypox) [10]. The vesiculopustular skin lesions caused by mpox can closely resemble those of herpesviruses such as VZV (chickenpox) or HSV, creating diagnostic uncertainty [11]. Currently, swabs from suspected mpox lesions are typically placed in universal transport medium (UTM) or similar media that preserve virus viability during transport. While this allows traditional PCR testing in centralized laboratories, it poses biosafety risks—sample handling requires at least a Class II biosafety cabinet, and certain procedures (e.g., aliquoting) are recommended only in BSL-3 facilities [11]. An inactivating transport buffer like DRDP could mitigate these concerns by neutralizing the pathogen at the point of collection (rendering the sample noninfectious) and still preserving nucleic acids for direct PCR testing. This would enable safer and more efficient diagnostics for mpox in decentralized or resource- limited settings, where biosafety and rapid results are critical. Such an approach aligns with the broader need for point-of-care outbreak diagnostics, providing enhanced biosafety and timely results for improved outbreak response [12,13].

This study aimed to evaluate key aspects of DRDP’s performance for direct PCR diagnostics using DNA viruses (HSV-1, HSV-2, and VZV) as a model. In particular, we examined the following: (a) the detection sensitivity of DRDP vs. a standard medium (UTM) by comparing PCR Cq values across serial virus dilutions to determine whether DRDP compromises, maintains, or improves the limit of detection relative to the conventional medium; (b) PCR compatibility at high buffer concentrations by varying the fraction of DRDP buffer in the reaction and assessing any amplification inhibition (and whether it can be mitigated by magnesium supplementation); and (c) the impact of thermal pre-treatment, evaluating if the usual 95 °C pre-heating lysis step is necessary when using DRDP, or if it can be omitted without affecting results. Additionally, we assessed the performance of DRDP in a commercial multiplex PCR assay to confirm its compatibility with established diagnostic platforms. By examining these factors, we provide a comprehensive proof-of-concept evaluation of DRDP’s utility for direct PCR in the field or point-of-care settings.

2. Materials and Methods: Evaluating DRDP for Extraction-Free PCR in a Field Context

The Sample Preparation and Virus Dilution for Laboratory Developed Test

Sample Preparation and Virus Dilution: HSV-1, HSV-2, and VZV stocks from anonymized leftover clinical samples were prepared at equivalent titers and used to inoculate transport media. Aliquots of each virus were serially diluted in 10-fold increments (10⁰, 10⁻¹, 10⁻², etc.) into two different media: DRDP buffer (DNA/RNA Defend Pro™, InActiv Blue, Beernem, Belgium), constituting 15–35% of the total PCR volume, and a standard universal transport medium (UTM) as a control (fixed 15% of total PCR volume in all cases). The samples and each dilution were prepared in parallel for both DRDP and UTM. All samples were handled in a biosafety cabinet. Notably, DRDP-containing samples were rendered noninfectious immediately upon contact with the buffer, whereas UTM samples contained viable virus and were handled with appropriate precautions. No nucleic acid extraction was performed on any samples. DRDP samples were added directly into the PCR setup. The UTM samples were processed with a 15-min thermal lysis at 95 °C followed by a 3× dilution due to the inhibitory effect of UTM on PCR [14].

PCR Assay and Conditions: The PCR assays targeted conserved regions of each virus’s genome using RT-qPCR with a hydrolysis probe.

Table A1. Oligonucleotide primers and probes used for real-time PCR detection of HSV-1, HSV-2, and VZV.

Virus	Forward Primer (5′→3′)	Reverse Primer (5′→3′)	Probe (5′→3′)
HSV-1	CGGCCGTGTGACACTATCG	CTCGTAAAATGGCCCCTCC	CCATACCGACCACACCGACGAACC
HSV-2	CGCCAAATACGCCTTAGCA	GAAGGTTCTTCCCGCGAAAT	CTCGCTTAAGATGGCCGATCCCAATC
VZV	CACGTATTTTCAGTCCTCTTCAAGTG	TTAGACGTGGAGTTGACATCGTTT	TACCGCCCGTGGAGCGCG

(Appendix A) lists the primer and probe sequences specific for HSV-1, HSV-2, and VZV. The HSV-1 and HSV-2 assays target each virus’s glycoprotein gene and the VZV assay targets the DNA polymerase gene. Primers and hydrolysis probes were synthesized by Integrated DNA Technologies (IDT, Coralville, IA, USA). Each viral target’s probe was labeled with a distinct fluorophore to enable multiplex detection within a single reaction: FAM for HSV-1, HEX for HSV-2, and Cy5 for VZV.

The primers and probes used in this study were adapted from previously validated protocols: HSV-1 and HSV-2 assays from Watzinger et al. (2004) and Weidmann et al. (2003), and the VZV assay from Depledge et al. (2011) [15,16,17]. These primer/probe sets have been integrated into our routine clinical diagnostic workflow as validated Laboratory Developed Tests (LDTs) and have been consistently utilized at our laboratory for the past two decades. Their clinical performance and quality assurance have been continuously monitored and maintained in compliance with standards set by the College of American Pathologists (CAP) and the Bureau de normalization du Québec (BNQ). Real-time PCR was performed using a Roche LightCycler^® 480 II instrument (Roche Diagnostics, Montreal, QC, Canada) with a 20 µL reaction volume per sample. The thermal cycling program consisted of an initial 95 °C denaturation for 2 min, followed by 40 cycles of 95 °C for 15 s and 55 °C for 30 s, with fluorescence acquisition in the appropriate channels during the 55 °C step. To test the effect of increasing buffer input, additional PCRs were prepared with the sample (in DRDP) constituting 15%, 20%, 25%, 30%, or 35% of the total reaction volume. Reactions exceeding 25% DRDP content were also run with 10 mM MgCl₂ to counteract EDTA chelation. Magnesium supplementation was performed in DRDP buffer post lysis (within approximately 1–2 min of adding DRDP buffer to the sample) and around 5 min before adding it into PCR master mix).

Commercial Assay Evaluation: To assess compatibility with an existing diagnostic platform, we also evaluated DRDP-preserved samples on a commercial multiplex PCR assay. Aliquots of clinical swab samples known to be positive for HSV-1, HSV-2, or VZV were used in parallel for UTM and DRDP medium with the same virus concentration. Tests were conducted using the DiaSorin Simplexa™ HSV-1/2 (https://int.diasorin.com/en/molecular-diagnostics/kits-reagents/simplexa-hsv-12-direct, accessed on 7 July 2025) and, VZV Direct kit (https://int.diasorin.com/en/molecular-diagnostics/kits-reagents/simplexa-vzv-direct, accessed on 7 July 2025) according to the manufacturer’s instructions. The input sample (50 µL) and PCR master mix (50 µL) have the same volumes. For DRDP samples, Mg supplementation was conducted before the PCR started. The Ct (cycle threshold) results from the Simplexa assay for each experiment were compared between DRDP and UTM samples, but as a function of concentration of Mg supplementation in DRDP medium, to determine any performance differences.

3. Results

3.1. Detection Sensitivity: DRDP vs. UTM

All three viruses were robustly detected in both media across all dilution levels, with DRDP performing equivalently to UTM regarding sensitivity. At the highest viral load (undiluted 1×), DRDP’s Cq values were essentially the same as UTM’s (differences ~0.5 cycles or less). As the samples became more diluted (10× and 100×), DRDP showed a slight advantage in detection. For example, HSV-1 at 1× yielded Cq 18.0 ± 0.1 in DRDP vs. 18.5 ± 0.2 in UTM, and VZV at 10× gave Cq 23.0 ± 0.4 in DRDP vs. 24.0 ± 0.2 in UTM (

Table 1. PCR cycle quantification (Cq) values for HSV-1, HSV-2, and VZV in samples collected in UTM vs. DRDP buffer at various dilution factors. Values are mean Cq ± SD (n = 3) for each condition. Each PCR mix received the same equivalent sample volume.

Dilution	Medium	HSV-1 Cq	HSV-2 Cq	VZV Cq
1×	UTM	18.5 ± 0.2	19.2 ± 0.3	21.0 ± 0.3
1×	DRDP	18.0 ± 0.1	18.7 ± 0.2	20.5 ± 0.2
10×	UTM	22.0 ± 0.3	23.0 ± 0.4	24.0 ± 0.2
10×	DRDP	21.8 ± 0.2	22.5 ± 0.3	23.0 ± 0.4
100×	UTM	25.5 ± 0.5	27.1 ± 0.6	27.9 ± 0.4
100×	DRDP	24.3 ± 0.4	25.9 ± 0.5	26.7 ± 0.6

). At the 100× dilution (lower viral copies), DRDP samples had Cq values about 1.0–1.2 cycles lower (earlier, more sensitive) than the corresponding UTM samples for all three viruses. For instance, HSV-2 at 100× showed a mean Cq of 25.9 ± 0.5 in DRDP vs. 27.1 ± 0.6 in UTM (Table 1).

Table 2. The effect of DRDP buffer fraction and Mg²⁺ supplementation on PCR amplification. “PCR inhibition” qualitatively describes the outcome, and “Cq shift” quantifies the delay in Cq compared to a control reaction with a low DRDP fraction (≤25%). The n.d. term is used for a reaction that was not performed.

DRDP in PCR	Inhibition (No Extra Mg2+)	Cq Shift	Inhibition (Added Extra Mg2+)
15%	absent	<1	n.d.
20%	absent	<1	n.d.
25%	absent	<1	n.d.
30%	present	<=2	none
35%	present	failed	none

n.d. means not detected.

summarizes the mean Cq results (±SD) for each virus at three dilution levels in each medium. Even at a 100-fold dilution without extraction or concentration, viruses in DRDP were still reliably detected with Cq values in the mid-20s, comparable to those in the conventional medium. This indicates that DRDP did not compromise sensitivity and may even slightly improve the detection of low-abundance targets, possibly through the more effective lysis of virions or better preservation of nucleic acid integrity.

3.2. Effect of DRDP Buffer Volume on PCR Inhibition

We next examined whether increasing the proportion of DRDP buffer in the PCR would introduce any inhibition of amplification. Since DRDP contains EDTA (which chelates divalent cations including Mg²⁺) and is acidic, using high concentrations could sequester magnesium or otherwise alter the reaction environment. A series of reactions were run where the fraction of the PCR volume composed of DRDP (with sample) ranged from 10% up to 35%, using undiluted HSV-1 as the test system. Table 2 summarizes the observed inhibition and Cq shifts. Reactions with up to 25% of the total volume as DRDP buffer showed no detectable inhibition. Amplification curves in these reactions were virtually identical to those of control reactions with smaller DRDP inputs, and Cq values shifted by no more than 0.5 cycles (Table 2). At 30% DRDP, a mild delay in amplification was observed (Cq shifts of ~1–2 cycles), and at 35% DRDP, significant inhibition occurred (markedly delayed or failed amplification). As described in the manufacturer’s manual, inhibition at high DRDP concentration might be due to EDTA in the buffer chelating magnesium necessary for PCR. To test this, additional Mg²⁺ was added to reactions with 35% DRDP. With magnesium supplementation, the 35% DRDP reactions showed no notable inhibition. Cq values returned close to baseline and amplification curves regained a normal sigmoidal shape. This “rescue” demonstrates that inhibition at high DRDP volumes was indeed due to magnesium sequestration and not due to irreversible enzyme inhibition or nucleic acid damage from the buffer.

Additionally, the efficacy of the PCR is preserved for various qPCR tests with 15–25% DRDP input of PCR volume, as demonstrated in Appendix A 

Table A2. PCR amplification efficiency at various DRDP buffer fractions. Each slope was determined from the standard curve of Cq values across a 10⁰, 10⁻¹,10⁻² and 10⁻³ dilution series of VZV-positive clinical samples.

DRDP Buffer in Reaction (%)	Standard Curve Slope	Calculated Efficiency (%)
15%	−3.3	100.5
20%	−3.1	108.8
25%	−3.2	101.4

.

In

Table A3. Effect of DRDP and magnesium addition (first column) on PCR inhibition at high DRDP concentrations (data from HSV-1 35% DRDP reactions). Each reaction was run in triplicate. (Note: 0 mM, 2.5 mM, 5 mM, and 10 mM Mg²⁺ were tested; 10 mM fully restored amplification, as discussed in the text.).

Mg Added (mM)	PCR Outcome vs. UTM	Cq Shift of DRDP (+Mg)
0	No amplification (inhibited)	no Cq (total inhibition)
2.5	Delayed amplification (partial inhibition)	~5 cycles
5	Delayed amplification (moderate inhibition)	~2.5 cycles
10	Normal amplification (inhibition fully reversed)	0 cycles (same as UTM)

(Appendix A), we provide a quantitative Mg²⁺ titration analysis: 2.5 mM Mg²⁺ added to DRDP-containing reactions was insufficient (strong inhibition persisted), 5 mM Mg²⁺ partially mitigated inhibition (approximately a 5-cycle Cq delay remained), while 10 mM Mg²⁺ fully reversed EDTA-induced inhibition, restoring Cq values to those with ≤25% DRDP. These findings confirm that magnesium supplementation at 10 mM completely counteracts the chelation effect of EDTA in high-DRDP reactions.

3.3. Omission of Initial Heat Lysis Step

Another finding of our study was that initial high-temperature lysis of sample material before the start of PCR protocols may not be necessary for samples in DRDP. Conventionally, a 15 min incubation at 95 °C is used to ensure complete sample lysis by so-called “thermal lysis”. However, DRDP’s formulation lyses viral particles (due to its acidic, detergent-containing nature). We hypothesized that this might render the extended heat step of 15 min redundant. To test this, we performed PCR on DRDP-preserved samples with and without the initial 95 °C 15-min hold.

The results showed no significant difference in amplification performance whether or not the 95 °C pre-treatment was applied. When the thermal pre-step was omitted (the samples remained at room temperature during that period and then entered the standard cycling program), the Cq values obtained were virtually identical to those with the 15-min hold heat step—the differences were <0.3 cycles on average, well within run-to-run variability. Amplification curves for both conditions were superimposable, indicating that the targets were equally available. There was no significant Cq delay or loss of fluorescence intensity observed among these two groups. In practical terms, this means DRDP-treated samples were “PCR-ready” without a prolonged initial thermal lysis step. The potent chemical lysis and nucleic acid release achieved by DRDP at room temperature appeared sufficient to make the viral DNA accessible. As soon as thermal cycling began, the brief denaturation during the first cycle (95 °C for 120 s) was enough to denature the template and activate the polymerase.

3.4. Performance in a Commercial PCR Assay

Paired samples were tested using the DiaSorin Simplexa HSV 1/2 Direct and Simplexa VZV Direct PCR assays to evaluate the compatibility of DRDP sample collection medium. Initial tests indicated that PCR inhibition can occur with DRDP samples if sample input volume is higher than 25% of the total PCR mix (Table 2) and magnesium (Mg²⁺) was not supplemented. Due to differences in the initial sample volume and the composition of commercial master mixes versus our Laboratory Developed Test, a higher concentration of Mg²⁺ supplementation was required. Samples initially collected in UTM and testing positive also yielded equivalent positive results with DRDP medium, provided Mg²⁺ was supplemented at tested concentrations between 10 mM and 20 mM. At these concentrations, cycle threshold (Ct) values (used by the manufacturer) were equivalent to those obtained with UTM (within a difference of one Ct unit).

Detailed Mg²⁺ titration experiments assessing DRDP buffer with Mg²⁺ concentrations of 0 mM, 5 mM, 10 mM, 15 mM, and 20 mM are presented in Appendix A,

Table A4. Effect of DRDP and magnesium addition (first column) on PCR inhibition at high DRDP concentrations presenting 50% sample input in the total PCR (data from DiaSorin Simplexa VZV Direct assay). (Note: 0 mM, 5 mM, 10 mM, 15 mM and 20 mM Mg²⁺ were tested.) The cycle threshold (C(t)) values were provided by manufacturer, instead of Cq values. After Mg supplementation (10 mM of higher Mg), Ct values were equivalent to those obtained with UTM (within a difference of one C(t) unit).

Mg Added (mM)	PCR Outcome vs. UTM	Ct Shift of DRDP (+Mg)
0	No amplification (inhibited)	no Ct (total inhibition)
5	Delayed amplifications (partial inhibition)	~+5
10	Equivalent amplification (inhibition reversed)	~1
15	Equivalent amplification (inhibition fully reversed)	~0.7
20	Equivalent amplification (inhibition fully reversed)	~0.7

. These experiments clearly demonstrate that equivalent Ct values (within one Ct unit of the UTM control Ct value) were restored, beginning at approximately 10 mM Mg²⁺, with the optimal, lowest Ct values consistently achieved at 15 mM and 20 mM Mg²⁺ concentrations.

These results confirm the compatibility of DRDP sample collection medium, achieving equivalent performance while enhancing biosafety, reducing turn-around-time and reducing operational complexity and the corresponding cost (Figure 1).

4. Discussion

These findings are consistent with prior evaluations of DRDP and similar inactivating media, including studies with RNA viruses [8,9]. While those investigations explored RNA virus detection, our current study focuses exclusively on DNA viruses, using HSV-1, HSV-2, and VZV as representative models.

An important operational consideration is the reversibility of DRDP-induced PCR inhibition at high buffer concentrations. As DRDP contains EDTA, it can chelate essential divalent cations such as Mg²⁺, thereby impairing polymerase activity when used in excess. Our study confirms that this inhibition is entirely mitigated by magnesium chloride (MgCl₂) supplementation. To support decentralized or cartridge-based testing platforms, MgCl₂ can be pre-loaded into the reaction compartment or directly into the sample inlet, such as in DiaSorin’s 50 µL format disk. A final concentration of 15 mM MgCl₂ is readily achieved by adding 0.75 µL of a 1 M MgCl₂ stock solution—an amount sufficiently small to tolerate minor evaporation without impacting assay performance. The same strategy can be applied to 96-well plates for high-throughput workflows, enabling consistent results across Laboratory Developed Tests (LDTs) and in vitro diagnostic (IVD) platforms. This adaptability is especially valuable for outbreak responses—such as the recent (2025) measles resurgence in North America (https://www.cdc.gov/measles/data-research/index.html, accessed on 7 July 2025)—where safe and rapid diagnostics are urgently required in the field.

The implications of our results are significant for outbreak response and point-of-care testing. DRDP buffer allows clinicians or field workers to collect swab samples and run PCR on-site without the need for a biosafety hood or complex extraction kits. The sample can be added directly to a PCR mix and run on a portable thermocycler. The time savings (both from skipping extraction and the thermal lysis step) can improve patient management and infection control measures. The confirmed stability of nucleic acids in DRDP ensures that samples remain suitable for testing, even in challenging field conditions [8,9]. Similar extraction-free molecular testing approaches have been successfully implemented [18,19,20,21] for SARS-CoV-2 during the COVID-19 pandemic, demonstrating the feasibility of deploying rapid PCR diagnostics in non-traditional settings [19,20,21,22].

An additional operational advantage of DRDP is its ability to facilitate the preparation of biologically relevant whole-process positive and negative controls that retain ≥8 days stability at +25 °C during routine weekly operations [8,9]. Traditionally, laboratories must store such controls at −20 °C or lower to prevent nucleic acid degradation, often requiring extensive aliquoting into single-use volumes to avoid repeated freeze–thaw cycles that accelerate molecular decay and reduce assay reliability. This approach consumes considerable freezer space and increases preparation workload. In contrast, DRDP chemically stabilizes nucleic acids by combining acidification and EDTA chelation, enabling the ambient-temperature storage of control materials for extended durations without measurable degradation—even under repeated temperature fluctuations associated with field or routine diagnostic use [8,9,20,21,22]. This eliminates the need for frozen stocks or guanidinium-based buffers (which are incompatible with direct PCR due to strong enzyme inhibition [8,9]). DRDP-preserved whole-process positive controls (e.g., swabs spiked with inactivated pathogen or characterized patient material) can be stored as ready-to-use aliquots at room temperature or 4 °C, offering unmatched convenience and reliability. These DRDP-based controls undergo the same steps as patient samples—including swabbing, elution, and amplification—thus ensuring a realistic, end-to-end quality control. The ability to prepare large batches of stable aliquots simplifies workflow logistics and mitigates the risk of degradation from repeated freezing, thawing, or handling errors. Importantly, DRDP also supports the preparation of biologically complex negative controls (e.g., pooled swab specimens from known-negative individuals or similar matrices) that mimic real sample composition but lack the target pathogen. These “whole-process” negative controls can be carried through the full workflow to confirm specificity, assess cross-contamination, and detect any non-specific amplification. As molecular testing expands to decentralized settings, including mobile units and remote clinics, the ability to deploy ambient, stable, and whole-process controls becomes increasingly valuable in validating new diagnostic assays.

5. Conclusions

It is important to note that direct PCR sensitivity has inherent limitations imposed by the sample reaction volume, potentially limiting detection in cases with an extremely low viral load. Consequently, when swab is collected in a large (1–3 mL) buffer volume, sensitivity might be an issue for some assays. On the contrary, although not tested here, a swab exposed to, or impregnated with, a small volume of buffer (50–100 µL) could potentially increase the analytical sensitivity dramatically in a direct PCR approach. Direct PCR enabled by the DRDP buffer offers a rapid and safe diagnostic approach for infectious diseases, eliminating the need for time-consuming extraction steps while maintaining sensitivity. Our evaluation with HSV-1, HSV-2, and VZV demonstrates that DRDP-preserved samples can be directly amplified with performance comparable to conventional methods, even improving the detection of low-level targets. The buffer’s inactivation capability addresses biosafety concerns, and its compatibility with PCR simplifies workflows in outbreak and point-of-care settings. By reducing processing steps and equipment requirements, DRDP-facilitated direct PCR can accelerate diagnosis and help contain outbreaks more effectively. Ongoing and future studies extending this approach to other pathogens and integrating it with field-deployable PCR platforms will further validate DRDP’s role in advancing molecular diagnostics while also protecting test operators from exposure to potential pathogens.

Although rapid antigen testing (RAT) was not evaluated in the current study [13], implementing RAT as a preliminary screening method could provide the rapid, cost-effective identification of positive cases, while the subsequent molecular nucleic acid amplification testing (NAT) of RAT-negative samples would ensure enhanced diagnostic accuracy and overall reliability. This two-tier strategy could optimize resource allocation and improve testing efficiency in outbreak scenarios.

Note: The name ‘DNA/RNA Defend Pro’ reflects the manufacturer’s naming convention; this study evaluated DNA virus compatibility only.

6. Patents

The composition of DRDP medium is the intellectual property of InActiv Blue.