Variable Effects of the In Ovo Administration of an Escherichia coli Vaccine in the Amnion or Air Cell on Commercial Layer Embryo and Hatchling Development †
Abstract
1. Introduction
2. Materials and Methods
2.1. Incubational Conditions and Monitoring
2.2. Vaccine Preparation
2.2.1. Preliminary Plating
2.2.2. Pre-Injection Plating at 18 DOI
2.2.3. Post-Injection Plating at 18 DOI
2.3. Setter Phase Egg Incubation and Subsequent In Ovo Injection at 18 Days of Incubation
2.4. Air Cell and Amnion Membrane Swabs and Yolk Sac and Yolk-Free Embryo Weights at 19 Days of Incubation
2.5. Hatchery Residue Analysis and Hatchling Evaluation at 22 Days of Incubation
2.6. Somatic and Yolk Content Determinations of Hatchlings at 22 Days of Incubation
2.7. PCR Procedures
2.8. Statistical Analysis
3. Results
3.1. Percent Egg Weight Loss, Site of Injection and Embryo Staging Confirmations, and Embryonic Somatic Variables
3.2. PCR at 19 Days of Incubation
3.3. Residue Egg Breakout and Hatchability
3.4. Hatchling Somatic and Yolk Content Variables
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Barnes, J.B.; Nolan, L.K.; Vaillancourt, J. Chapter 18: Colibacillosis. In Diseases of Poultry, 12th ed.; Saif, Y.M., Ed.; Blackwell Publishing: Hoboken, NJ, USA, 2008; pp. 691–732. [Google Scholar]
- Dho-Moulin, M.; Fairbrother, J.M. Avian pathogenic Escherichia coli (APEC). Vet. Res. 1999, 30, 299–316. [Google Scholar] [PubMed]
- Ardrey, W.B.; Peterson, C.F.; Haggart, M. Experimental Colibacillosis and the Development of Carriers in Laying Hens. Avian Dis. 1968, 12, 505–511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swelum, A.A.; Elbestawy, A.R.; El-Saadony, M.T.; Hussein, E.O.; Alhotan, R.; Suliman, G.M.; Taha, A.E.; Ba-Awadh, H.; El-Tarabily, K.A.; El-Hack, M.E.A. Ways to minimize bacterial infections, with special reference to Escherichia coli, to cope with the first-week mortality in chicks: An updated overview. Poult. Sci. 2021, 100, 101039. [Google Scholar] [CrossRef] [Scilit]
- Śmiałek, M.; Kowalczyk, J.; Koncicki, A. Influence of vaccination of broiler chickens against Escherichia coli with live attenuated vaccine on general properties of E. coli population, IBV vaccination efficiency, and production parameters—A field experiment. Poult. Sci. 2020, 99, 5452–5460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Christensen, H.; Nielsen, C. Safety of the live Escherichia coli vaccine Poulvac® E. coli in layer parent stock in a field trial. Vet. Microbiol. 2020, 240, 108537. [Google Scholar] [CrossRef] [Scilit]
- Zoetis. Poulvac E. coli, Dosing and Administration. Zoetisus.com. Available online: https://www.zoetisus.com/products/poultry/poulvac-e_coli/directions.aspx (accessed on 28 July 2021).
- Zoetis. Poulvac E. coli, Strengthening Broiler Flocks. Zoetisus.com. 2021. Available online: https://www.zoetisus.com/products/poultry/poulvac-e_coli/broiler.aspx (accessed on 28 July 2021).
- Zoetis. Poulvac E. coli, Broad-Spectrum E. coli Protection. Zoetisus.com. 2021. Available online: https://www.zoetisus.com/products/poultry/poulvac-e_coli/layer.aspx (accessed on 28 July 2021).
- Peebles, E. In ovo applications in poultry: A review. Poult. Sci. 2018, 97, 2322–2338. [Google Scholar] [CrossRef] [Scilit]
- Ricks, C.A.; Avakian, A.; Bryan, T.; Gildersleeve, R.; Haddad, E.; Ilich, R.; King, S.; Murray, L.; Phelps, P.; Poston, R.; et al. In ovo vaccination technology. Adv. Vet. Med. 1999, 41, 495–515. [Google Scholar] [PubMed]
- Wakenell, P.S.; Bryan, T.; Schaeffer, J.; Avakian, A.; Williams, C.; Whitfill, C. Effect of In Ovo Vaccine Delivery Route on Herpesvirus of Turkeys/SB-1 Efficacy and Viremia. Avian Dis. 2002, 46, 274–280. [Google Scholar] [CrossRef] [Scilit]
- Jochemsen, P.; Jeurissen, S. The localization and uptake of in ovo injected soluble and particulate substances in the chicken. Poult. Sci. 2002, 81, 1811–1817. [Google Scholar] [CrossRef] [Scilit]
- Williams, C. In ovo vaccination for disease prevention. Int. Poult. Prod. 2007, 15, 7–8. [Google Scholar]
- Williams, C.J.; Hopkins, B.A. Field evaluation of the accuracy of vaccine deposition by two different commercially available in ovo injection systems. Poult. Sci. 2011, 90, 223–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uni, Z.; Ferket, R.P. Methods for early nutrition and their potential. World’s Poult. Sci. J. 2004, 60, 101–111. [Google Scholar] [CrossRef]
- Alqhtani, A.H. In Ovo Vaccination of Layer Chickens with 6/85 and ts-11 Vaccine Strains of Mycoplasma gallisepticum. Ph.D. Thesis, Mississippi State University, Starkville, MS, USA, 2020. [Google Scholar]
- Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Durojaye, O.; Zhang, H.; Turner, B.; Peebles, E.D. The effects of in ovo-injected vitamin D3 sources on the eggshell temperature and early post-hatch performance of Ross 708 broilers. Poult. Sci. 2020, 99, 1357–1362. [Google Scholar] [CrossRef] [Scilit]
- Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Durojaye, O.; Zhang, H.; Turner, B.; Peebles, E.D. Effects of different levels of in ovo-injected vitamin D sources on the hatchability and serum 25-hydroxycholecalciferol concentrations of Ross 708 broilers. Poult. Sci. 2020, 99, 3877–3884. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hy-Line International. Hy-Line W-36 Commercial Layers Management Guide. 2020. Available online: https://www.hyline.com/filesimages/Hy-Line-Products/Hyline%20W%2036%20Commercial%20Layer%20Management%20Guide.pdf (accessed on 12 February 2022).
- Elliott, K.; Branton, S.; Evans, J.; Peebles, E.D. Early post-hatch survival and humoral immune response of layer chickens when in ovo vaccinated with strain F Mycoplasma gallisepticum. Poult. Sci. 2018, 97, 3860–3869. [Google Scholar] [CrossRef] [Scilit]
- Sokale, A.O.; Zhai, W.; Pote, L.M.; Williams, C.J.; Peebles, E.D. Effects of coccidiosis vaccination administered by in ovo injection on the hatchability and hatching chick quality of broilers. Poult. Sci. 2017, 96, 541–547. [Google Scholar] [CrossRef] [Scilit]
- Joseph, N.S.; Lourens, A.; Moran, E.T. The Effects of Suboptimal Eggshell Temperature during Incubation on Broiler Chick Quality, Live Performance, and Further Processing Yield. Poult. Sci. 2006, 85, 932–938. [Google Scholar] [CrossRef] [Scilit]
- Van den Brand, H.; van de Kraats, S.J.F.; Sözcü, A.; Jöerissen, R.; Heetkamp, M.J.W.; van den Anker, I.; Ooms, M.; Kemp, B. Both the rooster line and incubation temperature affect embryonic metabolism and hatching quality in laying hen crossbreds. Poult. Sci. 2019, 98, 2632–2640. [Google Scholar] [CrossRef] [Scilit]
- Peebles, E.D.; Pansky, T.; Doyle, S.M.; Boyle, C.R.; Smith, T.W.; Latour, M.A.; Gerard, P.D. Effects of dietary fat and eggshell cuticle removal on egg water loss and embryo growth in broiler hatching eggs. Poult. Sci. 1998, 77, 1522–1530. [Google Scholar] [CrossRef] [Scilit]
- Fatemi, S.A.; Macklin, K.S.; Zhang, L.; Mousstaaid, A.; Poudel, S.; Poudel, I.; Peebles, E.D. Improvement in the Immunity- and Vitamin D3-Activity-Related Gene Expression of Coccidiosis-Challenged Ross 708 Broilers in Response to the In Ovo Injection of 25-Hydroxyvitamin D3. Animals 2022, 12, 2517. [Google Scholar] [CrossRef] [Scilit]
- Elliott, K.E.; Branton, S.; Evans, J.; Gerard, P.; Peebles, E. Layer chicken embryo survival to hatch when administered an in ovo vaccination of strain F Mycoplasma gallisepticum and locations of bacteria prevalence in the newly hatched chick. Poult. Sci. 2017, 96, 3879–3884. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poudel, S.; Li, T.; Chen, S.; Zhang, X.; Cheng, W.-H.; Sukumaran, A.T.; Kiess, A.S.; Zhang, L. Prevalence, Antimicrobial Resistance, and Molecular Characterization of Campylobacter Isolated from Broilers and Broiler Meat Raised without Antibiotics. Microbiol. Spectr. 2022, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- SAS Institute Inc. SAS Proprietary Software Release 9.4; SAS Institute Inc.: Cary, NC, USA, 2013. [Google Scholar]
- Poudel, S.; Tabler, G.T.; Lin, J.; Zhai, W.; Zhang, L. Riboflavin and Bacillus subtilis effects on growth performance and woody-breast of Ross 708 broilers with or without Eimeria spp. challenge. J. Anim. Sci. Technol. 2022, 64, 443–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karimi, M.M.; Rahimi, S.; Nagahisarchoghaei, M.; Luo, C. A Multidimensional Game Theory–Based Group Decision Model for Predictive Analytics. Comput. Math. Methods 2022, 2022, 5089021. [Google Scholar]
- Mousstaaid, A.; Fatemi, S.A.; Elliott, K.E.C.; Alqhtani, A.H.; Peebles, E.D. Effects of the In Ovo Injection of L-Ascorbic Acid on Broiler Hatching Performance. Animals 2022, 12, 1020. [Google Scholar] [CrossRef] [Scilit]
- McGruder, B.M.; Zhai, W.; Keralapurath, M.M.; Bennett, L.W.; Gerard, P.D.; Peebles, E.D. Effects of in ovo injection of electrolyte solutions on the pre- and posthatch physiological characteristics of broilers. Poult. Sci. 2011, 90, 1058–1066. [Google Scholar] [CrossRef] [Scilit]
- Peebles, E.; McGruder, B.; Zhai, W.; Keralapura, M.; Gerard, P. Effects of In Ovo Injection of Stimulant Solutions on Growth and Yolk Utilization in Broiler Embryos. Int. J. Poult. Sci. 2011, 10, 338–343. [Google Scholar] [CrossRef] [Scilit]
- McGruder, B.; Zhai, W.; Keralapura, M.; Gerard, P.; Peebles, E. Effects of in ovo Injection of Theophylline and Electrolyte Solutions on Hatchability and Growth of Broilers from Day 0 to Day 10 Post-Hatch. Int. J. Poult. Sci. 2011, 10, 927–932. [Google Scholar] [CrossRef] [Scilit]
- Elliott, K.; Branton, S.; Evans, J.; Magee, C.; Peebles, E. Onset of the humoral immune response of layer chicks vaccinated in ovo with strain F Mycoplasma gallisepticum vaccine and evidence of male-biased mortality. Poult. Sci. 2022, 101, 101761. [Google Scholar] [CrossRef] [Scilit]
- Avakian, A. Understanding in ovo vaccination. Int. Hatch. Pract. 2006, 20, 15–17. [Google Scholar]
- Triplett, M.; Zhai, W.; Peebles, E.; McDaniel, C.; Kiess, A. Investigating commercial in ovo technology as a strategy for introducing probiotic bacteria to broiler embryos. Poult. Sci. 2018, 97, 658–666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bar-Shira, E.; Friedman, A. Development and adaptations of innate immunity in the gastrointestinal tract of the newly hatched chick. Dev. Comp. Immunol. 2006, 30, 930–941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, S.H.; Chung, T.K.; Yu, B. Effects of supplemental 25-hydroxycholecalciferol on growth performance, small intestinal morphology, and immune response of broiler chickens. Poult. Sci. 2009, 88, 2333–2341. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fatemi, S.; Elliott, K.; Bello, A.; Peebles, E. Effects of the in ovo injection of vitamin D3 and 25-hydroxyvitamin D3 in Ross 708 broilers subsequently challenged with coccidiosis. I. performance, meat yield and intestinal lesion incidence1,2,3. Poult. Sci. 2021, 100, 101382. [Google Scholar] [CrossRef] [Scilit]
- Fatemi, S.; Elliott, K.; Bello, A.; Zhang, H.; Alqhtani, A.; Peebles, E. Effects of the in ovo injection of vitamin D3 and 25-hydroxyvitamin D3 in Ross 708 broilers subsequently fed commercial or calcium and phosphorus-restricted diets. II. Immunity and small intestine morphology1,2,3. Poult. Sci. 2021, 100, 101240. [Google Scholar] [CrossRef] [Scilit]
- Fatemi, S.A.; Elliott, K.E.C.; Macklin, K.S.; Bello, A.; Peebles, E.D. Effects of the In Ovo Injection of Vitamin D3 and 25-Hydroxyvitamin D3 in Ross 708 Broilers Subsequently Challenged with Coccidiosis: II Immunological and Inflammatory Responses and Small Intestine Histomorphology. Animals 2022, 12, 1027. [Google Scholar] [CrossRef] [Scilit]
- Mousstaaid, A.; Fatemi, S.A.; Elliott, K.E.C.; Levy, A.W.; Miller, W.W.; Gerard, P.D.; Alqhtani, A.H.; Peebles, E.D. Effects of the In Ovo and Dietary Supplementation of L-Ascorbic Acid on the Growth Performance, Inflammatory Response, and Eye L-Ascorbic Acid Concentrations in Ross 708 Broiler Chickens. Animals 2022, 12, 2573. [Google Scholar] [CrossRef] [Scilit]
| E. coli Dosage (CFU) | PECV Dilution |
|---|---|
| Marek’s disease commercial diluent | --------- |
| 6.5 × 101 | 1 × 10−7 |
| 6.5 × 102 | 1 × 10−6 |
| 6.5 × 103 | 1 × 10−5 |
| 6.5 × 104 | 1 × 10−4 |
| IL | LS | RS | ||||||||||
| 1 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | S |
| 2 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 3 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 4 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 5 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 6 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 7 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 8 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 9 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 10 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 11 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 12 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 13 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 14 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 15 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| 16 | E | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | E |
| Item Identification | 5′→3′ Base Sequence |
|---|---|
| Primer 1 | TTAATGACTGCGCCTCTTGC |
| Primer 2 | ACGTCCAATACCGGTCACTT |
| Probe | [6FAM]TTAAGAATTCCAGTCTCCGGGT[BHQ1] |
| E. coli Dosage (CFU) | AM | AC |
|---|---|---|
| ----------------------Positives (%)--------------------- | ||
| Marek’s disease commercial diluent | 0 | 0 |
| 6.5 × 101 | 50 | 0 |
| 6.5 × 102 | 50 | 0 |
| 6.5 × 103 | 100 | 50 |
| 6.5 × 104 | 100 | 50 |
| Diluent (0 CFU E. coli) | 6.5 × 101 CFU E. coli | 6.5 × 102 CFU E. coli | 6.5 × 103 CFU E. coli | 6.5 × 104 CFU E. coli | |
|---|---|---|---|---|---|
| PEIS (%) | |||||
| Amnion | 9.54 | 13.91 a | 11.88 a | 13.82 a | 15.13 a |
| Air Cell | 6.91 | 5.59 b | 6.91 b | 9.21 b | 6.91 b |
| p-value | 0.2578 | 0.001 | 0.034 | 0.049 | 0.001 |
| Pooled SEM = 1.6376 | |||||
| N = 16 | |||||
| PEPE (%) | |||||
| Amnion | 2.63 | 10.58 a | 9.61 a | 7.90 a | 12.83 a |
| Air Cell | 5.26 | 3.62 b | 5.26 b | 3.29 b | 1.32 b |
| p-value | 0.140 | <0.001 | 0.016 | 0.011 | <0.001 |
| Pooled SEM = 1.2801 | |||||
| N = 16 | |||||
| HI (%) | |||||
| Amnion | 87.48 | 75.19 b | 78.17 b | 77.94 b | 71.70 b |
| Air Cell | 87.17 | 89.73 a | 87.84 a | 87.16 a | 91.12 a |
| p-value | 0.918 | <0.001 | 0.002 | 0.003 | <0.001 |
| Pooled SEM = 2.1396 | |||||
| N = 16 | |||||
| PFCH (%) | |||||
| Amnion | 56.53 | 43.60 b | 52.09 | 46.35 b | 42.85 b |
| Air Cell | 51.71 | 52.53 a | 48.88 | 54.92 a | 54.24 a |
| p-value | 0.270 | 0.042 | 0.461 | 0.051 | 0.010 |
| Pooled SEM = 3.0723 | |||||
| N = 16 | |||||
| Chick BW (g) | |||||
| Amnion | 39.75 | 39.35 | 38.65 b | 38.69 b | 38.23 b |
| Air Cell | 39.99 | 39.48 | 39.48 a | 39.55 a | 39.34 a |
| p-value | 0.410 | 0.650 | 0.005 | 0.004 | 0.001 |
| Pooled SEM for PEIS, PEPE, HI, and PFCH = 0.2124. SEM for chick BW = 0.2191. | |||||
| N = 16 | |||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lindsey, L.L.; Elliott, K.E.C.; Fatemi, S.A.; Evans, J.D.; Mousstaaid, A.; Gerard, P.D.; Peebles, E.D. Variable Effects of the In Ovo Administration of an Escherichia coli Vaccine in the Amnion or Air Cell on Commercial Layer Embryo and Hatchling Development. Poultry 2022, 1, 278-290. https://doi.org/10.3390/poultry1040023
Lindsey LL, Elliott KEC, Fatemi SA, Evans JD, Mousstaaid A, Gerard PD, Peebles ED. Variable Effects of the In Ovo Administration of an Escherichia coli Vaccine in the Amnion or Air Cell on Commercial Layer Embryo and Hatchling Development. Poultry. 2022; 1(4):278-290. https://doi.org/10.3390/poultry1040023
Chicago/Turabian StyleLindsey, Lauren L., Katie Elaine Collins Elliott, Seyed Abolghasem Fatemi, Jeff D. Evans, Ayoub Mousstaaid, Patrick D. Gerard, and Edgar David Peebles. 2022. "Variable Effects of the In Ovo Administration of an Escherichia coli Vaccine in the Amnion or Air Cell on Commercial Layer Embryo and Hatchling Development" Poultry 1, no. 4: 278-290. https://doi.org/10.3390/poultry1040023
APA StyleLindsey, L. L., Elliott, K. E. C., Fatemi, S. A., Evans, J. D., Mousstaaid, A., Gerard, P. D., & Peebles, E. D. (2022). Variable Effects of the In Ovo Administration of an Escherichia coli Vaccine in the Amnion or Air Cell on Commercial Layer Embryo and Hatchling Development. Poultry, 1(4), 278-290. https://doi.org/10.3390/poultry1040023

