Oxostephanine, Thalmiculine, and Thaliphyline—Three Isoquinoleine Alkaloids That Inhibit L-Type Voltage-Gated Ca2+ Channels
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Alkaloids Tested for Their Ability to Block LTCC
2.3. Cell Culture
Trivial Name | Chemical Class | Structure | Plant Origin (Part of Plant) |
---|---|---|---|
(+)-cepharanthine [22] | BBIQ | Stephania suberosa, Menispermaceae (tuberous roots) | |
thaliphylline [23] | BBIQ | Thalictrum minus var. microphyllum, Ranunculaceae (roots and rhizomes) | |
(−)-curine [24] | BBIQ | Cyclea barbata, Menispermaceae (roots) | |
thalmirabine [24] | BBIQ | Thalictrum minus var. microphyllum, Ranunculaceae (roots and rhizomes) | |
(−)-thalmiculine [25] | BBIQ | Thalictrum cultratum, Ranunculaceae (whole plant) | |
(+)-bebeerine [26] | BBIQ | Curarea candicans, Menispermaceae (roots) | |
(−)-curicycleatjenine [27] | Amidic BBIQ | Cyclea atjehensis, Menispermaceae (whole plant) | |
(+/−)-8-oxotetrahydropalmatine * | Protoberberine | Pycnarrhena sp., Menispermaceae (unknown) | |
tTetrahydropalmatine * | Protoberberine | Berberis sp., Berberidaceae (unknown) | |
protopine [28] | Protopine | Corydalis majori, Fumariaceae (whole plant) | |
oxostephanine [29] | Oxoaporphine | Stephania venosa, Menispermaceae (leaves) | |
liriodenine [29] | Oxoaporphine | Stephania venosa, Menispermaceae (leaves) | |
(+)-claviculine [28] | Cularine | Corydalis claviculata, Papaveraceae (whole plant) | |
(+)-celtine [30] | Cularine | Ceratocapnos palaestinus, Fumariaceae (whole plant) | |
(−)-norargemonine [27] | Pavine | Cyclea atjehensis, Menispermaceae (whole plant) | |
(S)-stylopine [31] | Berberine | Corydalis majori, Fumariaceae (whole plant) |
2.4. Quantitative Real-Time PCR
2.5. Monitoring Intracellular Ca2+ Using Fura-2
2.6. Statistical Analysis
3. Results
3.1. KCl and BAY K8644 Induced Ca2+ Responses Mediated by L-Type CaV Channels (LTCC) in GH3b6 Cells
3.2. Screening of Isoquinoline Alkaloids for Inhibitors of LTCC
3.3. Effects of Oxostephanine, Thaliphylline, and Thalmiculine on the Concentration–Effect Relationship of BAY K8644
3.4. Inhibitory Effects of Oxostephanine, Thaliphylline, and Thalmiculine Increase versus KCl Concentration
3.5. Structural Analogs of Oxostephanine, Thaliphylline, and Thalmiculine
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AUC | area under curve |
BBIQ | bisbenzylisoquinoline |
CaV channels | voltage-gated Ca2+ channels |
IA | Isoquinoline Alkaloid |
Cav channel | voltage-gated Ca2+ channel |
[Ca2+]i | intracellular Ca2+ concentration |
gapdh | glyceraldehyde-3-phosphate dehydrogenase |
gusb | beta-glucuronidase; |
LTCC | L-type voltage-gated Ca2+ channel |
References
- Zamponi, G.W.; Striessnig, J.; Koschak, A.; Dolphin, A.C. The Physiology, Pathology, and Pharmacology of Voltage-Gated Calcium Channels and Their Future Therapeutic Potential. Pharmacol. Rev. 2015, 67, 821–870. [Google Scholar] [CrossRef] [PubMed]
- Catterall, W.A.; Lenaeus, M.J.; Gamal El-Din, T.M. Structure and Pharmacology of Voltage-Gated Sodium and Calcium Channels. Annu. Rev. Pharmacol. Toxicol. 2020, 60, 133–154. [Google Scholar] [CrossRef] [PubMed]
- Catterall, W.A.; Perez-Reyes, E.; Snutch, T.P.; Striessnig, J. International Union of Pharmacology. XLVIII. Nomenclature and Structure-Function Relationships of Voltage-Gated Calcium Channels. Pharmacol. Rev. 2005, 57, 411–425. [Google Scholar] [CrossRef] [PubMed]
- Lacinová, L.; Lichvárová, L. Pharmacology of Voltage-Gated Calcium Channels in Clinic. In Pathologies of Calcium Channels; Weiss, N., Koschak, A., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; pp. 297–314. ISBN 978-3-642-40281-4. [Google Scholar]
- Barrett, P.Q.; Guagliardo, N.A.; Klein, P.M.; Hu, C.; Breault, D.T.; Beenhakker, M.P. Role of Voltage-Gated Calcium Channels in the Regulation of Aldosterone Production from Zona Glomerulosa Cells of the Adrenal Cortex: Voltage-Gated Channels in the Regulation of Aldosterone. J. Physiol. 2016, 594, 5851–5860. [Google Scholar] [CrossRef]
- Xue, Z.; Li, Y.; Zhou, M.; Liu, Z.; Fan, G.; Wang, X.; Zhu, Y.; Yang, J. Traditional Herbal Medicine Discovery for the Treatment and Prevention of Pulmonary Arterial Hypertension. Front. Pharmacol. 2021, 12, 720873. [Google Scholar] [CrossRef]
- Qian, J.-Q. Cardiovascular Pharmacological Effects of Bisbenzylisoquinoline Alkaloid Derivatives. Acta Pharmacol. Sin. 2002, 23, 1086–1092. [Google Scholar]
- Shang, X.; Yang, C.; Morris-Natschke, S.L.; Li, J.; Yin, X.; Liu, Y.; Guo, X.; Peng, J.; Goto, M.; Zhang, J.; et al. Biologically Active Isoquinoline Alkaloids Covering 2014–2018. Med. Res. Rev. 2020, 40, 2212–2289. [Google Scholar] [CrossRef]
- Huang, Y.-L.; Cui, S.-Y.; Cui, X.-Y.; Cao, Q.; Ding, H.; Song, J.-Z.; Hu, X.; Ye, H.; Yu, B.; Sheng, Z.-F.; et al. Tetrandrine, an Alkaloid from S. Tetrandra Exhibits Anti-Hypertensive and Sleep-Enhancing Effects in SHR via Different Mechanisms. Phytomedicine 2016, 23, 1821–1829. [Google Scholar] [CrossRef]
- Wang, X.; Yang, Y.; Yang, D.; Tong, G.; Lv, S.; Lin, X.; Chen, C.; Dong, W. Tetrandrine Prevents Monocrotaline-Induced Pulmonary Arterial Hypertension in Rats through Regulation of the Protein Expression of Inducible Nitric Oxide Synthase and Cyclic Guanosine Monophosphate-Dependent Protein Kinase Type 1. J. Vasc. Surg. 2016, 64, 1468–1477. [Google Scholar] [CrossRef]
- Bhagya, N.; Chandrashekar, K.R. Tetrandrine—A Molecule of Wide Bioactivity. Phytochemistry 2016, 125, 5–13. [Google Scholar] [CrossRef]
- Felix, J.P.; King, V.F.; Shevell, J.L.; Garcia, M.L.; Kaczorowski, G.J.; Bick, I.R.C.; Slaughter, R.S. Bis(Benzylisoquinoline) Analogs of Tetrandrine Block L-Type Calcium Channels: Evidence for Interaction at the Diltiazem-Binding Site. Biochemistry 1992, 31, 11793–11800. [Google Scholar] [CrossRef]
- Low, A.M.; Berdik, M.; Sormaz, L.; Gataiance, S.; Buchanan, M.R.; Kwan, C.Y.; Daniel, E.E. Plant Alkaloids, Tetrandrine and Hernandezine, Inhibit Calcium-Depletion Stimulated Calcium Entry in Human and Bovine Endothelial Cells. Life Sci. 1996, 58, 2327–2335. [Google Scholar] [CrossRef]
- Medeiros, M.A.A.; Pinho, J.F.; De-Lira, D.P.; Barbosa-Filho, J.M.; Araújo, D.A.M.; Cortes, S.F.; Lemos, V.S.; Cruz, J.S. Curine, a Bisbenzylisoquinoline Alkaloid, Blocks L-Type Ca2+ Channels and Decreases Intracellular Ca2+ Transients in A7r5 Cells. Eur. J. Pharmacol. 2011, 669, 100–107. [Google Scholar] [CrossRef]
- Dias, C.S.; Barbosa-Filho, J.M.; Lemos, V.S.; Côrtes, S.F. Mechanisms Involved in the Vasodilator Effect of Curine in Rat Resistance Arteries. Planta Med. 2002, 68, 1049–1051. [Google Scholar] [CrossRef]
- Chang, G.-J.; Wu, M.-H.; Wu, Y.-C.; Su, M.-J. Electrophysiological Mechanisms for Antiarrhythmic Efficacy and Positive Inotropy of Liriodenine, a Natural Aporphine Alkaloid from Fissistigma Glaucescens. Br. J. Pharmacol. 1996, 118, 1571–1583. [Google Scholar] [CrossRef]
- Xu, S.Z.; Zhang, Y.; Ren, J.Y.; Zhou, Z.N. Effects of Berberine of L- and T-Type Calcium Channels in Guinea Pig Ventricular Myocytes. Zhongguo Yao Li Xue Bao 1997, 18, 515–518. [Google Scholar]
- Wen, N.; Xue, L.; Yang, Y.; Shi, S.; Liu, Q.-H.; Cai, C.; Shen, J. Coptisine, a Protoberberine Alkaloid, Relaxes Mouse Airway Smooth Muscle via Blockade of VDLCCs and NSCCs. Biosci. Rep. 2020, 40, BSR20190534. [Google Scholar] [CrossRef]
- Glassmeier, G.; Hauber, M.; Wulfsen, I.; Weinsberg, F.; Bauer, C.K.; Schwarz, J.R. Ca2+ Channels in Clonal Rat Anterior Pituitary Cells (GH3/B6). Pflug. Arch. 2001, 442, 577–587. [Google Scholar]
- Réthoré, L.; Park, J.; Montnach, J.; Nicolas, S.; Khoury, J.; Le Seac’h, E.; Mabrouk, K.; De Pomyers, H.; Tricoire-Leignel, H.; Mattei, C.; et al. Pharmacological Dissection of the Crosstalk between NaV and CaV Channels in GH3b6 Cells. Int. J. Mol. Sci. 2022, 23, 827. [Google Scholar] [CrossRef]
- Zhu, Z.; Cui, W.; Zhu, D.; Gao, N.; Zhu, Y. Common Tools for Pituitary Adenomas Research: Cell Lines and Primary Cells. Pituitary 2020, 23, 182–188. [Google Scholar] [CrossRef]
- Patra, A.; Freyer, A.J.; Guinaudeau, H.; Shamma, M.; Tantisewie, B.; Pharadai, K. The Bisbenzylisoquinoline Alkaloids of Stephania Suberosa. J. Nat. Prod. 1986, 49, 424–427. [Google Scholar] [CrossRef]
- Guinaudeau, H.; Freyer, A.J.; Shamma, M.; Hüsnü Can Başer, K. Enzymic Control of Stereochemistry among the Bisbenzylisoquinoline Alkaloids. Tetrahedron 1984, 40, 1975–1982. [Google Scholar] [CrossRef]
- Angerhofer, C.K.; Guinaudeau, H.; Wongpanich, V.; Pezzuto, J.M.; Cordell, G.A. Antiplasmodial and Cytotoxic Activity of Natural Bisbenzylisoquinoline Alkaloids. J. Nat. Prod. 1999, 62, 59–66. [Google Scholar] [CrossRef]
- Hussain, S.F.; Freyer, A.J.; Guinaudeau, H.; Shamma, M. Five New Bisbenzylisoquinoline Alkaloids from Thalictrum Cultratum. J. Nat. Prod. 1986, 49, 488–493. [Google Scholar] [CrossRef]
- Lavault, M.; Fournet, A.; Guinaudeau, H.; Bruneton, J. Bisbenzylisoquinoline N-Oxides from Curarea Candicans. J. Chem. Res. 1985, 8, 248–249. [Google Scholar]
- Tantisewie, B.; Pharadai, T.; Pandhuganont, M.; Guinaudeau, H.; Freyer, A.J.; Shamma, M. (+)-N-Formylnornantenine, a New Aporphine Alkaloid from Cyclea Atjehensis. J. Nat. Prod. 1989, 52, 652–654. [Google Scholar] [CrossRef]
- Allais, D.P.; Guinaudeau, H. Composition Alcaloëdique de Corydalis Claviculata. J. Nat. Prod. 1990, 53, 1280–1286. [Google Scholar] [CrossRef]
- Pharadai, K.; Pharadai, T.; Tantisewie, B.; Guinaudeau, H.; Freyer, A.J.; Shamma, M. (−)-O-Acetylsukhodianine and Oxostephanosine: Two New Aporphinoids from Stephania Venosa. J. Nat. Prod. 1985, 48, 658–659. [Google Scholar] [CrossRef]
- Herath, W.H.M.W.; Zarga, M.H.A.; Sabri, S.S.; Guinaudeau, H.; Shamma, M. Some C-Secocularines from Ceratocapnos Palaestinus. J. Nat. Prod. 1990, 53, 1006–1008. [Google Scholar] [CrossRef]
- Allais, D.P.; Goezler, T.; Guinaudeau, H. Alkaloids of Corydalis Majoris Poelln. (Corydalis Integra Barbey and Major) (Fumariaceae) [Isoquinolic Alkaloids]. Plantes Med. Phytother. 1988, 22, 219–224. [Google Scholar]
- Backman, T.W.H.; Cao, Y.; Girke, T. ChemMine Tools: An Online Service for Analyzing and Clustering Small Molecules. Nucleic Acids Res. 2011, 39, W486–W491. [Google Scholar] [CrossRef] [PubMed]
- Vela, J.; Pérez-Millán, M.I.; Becu-Villalobos, D.; Díaz-Torga, G. Different Kinases Regulate Activation of Voltage-Dependent Calcium Channels by Depolarization in GH3 Cells. Am. J. Physiol. Cell Physiol. 2007, 293, C951–C959. [Google Scholar] [CrossRef] [PubMed]
- Vetter, I. Development and Optimization of FLIPR High Throughput Calcium Assays for Ion Channels and GPCRs. In Calcium Signaling; Islam, M.D.S., Ed.; Advances in Experimental Medicine and Biology; Springer: Dordrecht, The Netherlands, 2012; Volume 740, pp. 45–82. ISBN 978-94-007-2887-5. [Google Scholar]
- Bassett, J.J.; Monteith, G.R. Genetically Encoded Calcium Indicators as Probes to Assess the Role of Calcium Channels in Disease and for High-Throughput Drug Discovery. In Advances in Pharmacology; Elsevier: Amsterdam, The Netherlands, 2017; Volume 79, pp. 141–171. ISBN 978-0-12-810413-2. [Google Scholar]
- Impheng, H.; Lemmers, C.; Bouasse, M.; Legros, C.; Pakaprot, N.; Guérineau, N.C.; Lory, P.; Monteil, A. The Sodium Leak Channel NALCN Regulates Cell Excitability of Pituitary Endocrine Cells. FASEB J. 2021, 35, e21400. [Google Scholar] [CrossRef] [PubMed]
- Simasko, S.M. A Background Sodium Conductance Is Necessary for Spontaneous Depolarizations in Rat Pituitary Cell Line GH3. Am. J. Physiol. Cell Physiol. 1994, 266, C709–C719. [Google Scholar] [CrossRef] [PubMed]
- Sankaranarayanan, S.; Simasko, S.M. A Role for a Background Sodium Current in Spontaneous Action Potentials and Secretion from Rat Lactotrophs. Am. J. Physiol. Cell Physiol. 1996, 271, C1927–C1934. [Google Scholar] [CrossRef]
- Desgrouas, C.; Taudon, N.; Bun, S.-S.; Baghdikian, B.; Bory, S.; Parzy, D.; Ollivier, E. Ethnobotany, Phytochemistry and Pharmacology of Stephania Rotunda Lour. J. Ethnopharmacol. 2014, 154, 537–563. [Google Scholar] [CrossRef]
- Wirasathien, L.; Boonarkart, C.; Pengsuparp, T.; Suttisri, R. Biological Activities of Alkaloids from Pseuduvaria Setosa. Pharm. Biol. 2006, 44, 274–278. [Google Scholar] [CrossRef]
- Ferdous, A.J.; Islam, M.O.; Hasan, C.M.; Islam, S.N. In Vitro Antimicrobial Activity of Lanuginosine and Oxostephanine. Fitoterapia-Milano 1992, 63, 549. [Google Scholar]
- Makarasen, A.; Sirithana, W.; Mogkhuntod, S.; Khunnawutmanotham, N.; Chimnoi, N.; Techasakul, S. Cytotoxic and Antimicrobial Activities of Aporphine Alkaloids Isolated from Stephania venosa (Blume) Spreng. Planta Med. 2011, 77, 1519–1524. [Google Scholar] [CrossRef]
- Montanha, J.A.; Amoros, M.; Boustie, J.; Girre, L. Anti-Herpes Virus Activity of Aporphine Alkaloids. Planta Med. 1995, 61, 419–424. [Google Scholar] [CrossRef]
- Still, P.C.; Yi, B.; González-Cestari, T.F.; Pan, L.; Pavlovicz, R.E.; Chai, H.-B.; Ninh, T.N.; Li, C.; Soejarto, D.D.; McKay, D.B.; et al. Alkaloids from Microcos Paniculata with Cytotoxic and Nicotinic Receptor Antagonistic Activities. J. Nat. Prod. 2013, 76, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Coquerel, Q.R.R.; Démares, F.; Geldenhuys, W.J.; Le Ray, A.-M.; Bréard, D.; Richomme, P.; Legros, C.; Norris, E.; Bloomquist, J.R. Toxicity and Mode of Action of the Aporphine Plant Alkaloid Liriodenine on the Insect GABA Receptor. Toxicon 2021, 201, 141–147. [Google Scholar] [CrossRef] [PubMed]
- Goren, A.C.; Zhou, B.N.; Kingston, D.G. Cytotoxic and DNA Damaging Activity of Some Aporphine Alkaloids from Stephania Dinklagei. Planta Med. 2003, 69, 867–868. [Google Scholar] [CrossRef]
- Thuy, T.T.; Quan, T.D.; Anh, N.T.; Sung, T.V. Cytotoxic and Antimicrobial Aporphine Alkaloids from Fissistigma Poilanei (Annonaceae) Collected in Vietnam. Nat. Prod. Res. 2012, 26, 1296–1302. [Google Scholar] [CrossRef]
- Mohamed, S.M.; Hassan, E.M.; Ibrahim, N.A. Cytotoxic and Antiviral Activities of Aporphine Alkaloids of Magnolia grandiflora L. Nat. Prod. Res. 2010, 24, 1395–1402. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Shi, X.; Chen, J.; Mao, X.; Zhu, L.; Yu, L.; Shi, J. Alkaloids from Toddalia Asiatica and Their Cytotoxic, Antimicrobial and Antifungal Activities. Food Chem. 2014, 148, 437–444. [Google Scholar] [CrossRef]
- King, V.F.; Garcia, M.L.; Himmel, D.; Reuben, J.P.; Lam, Y.K.; Pan, J.X.; Han, G.Q.; Kaczorowski, G.J. Interaction of Tetrandrine with Slowly Inactivating Calcium Channels. Characterization of Calcium Channel Modulation by an Alkaloid of Chinese Medicinal Herb Origin. J. Biol. Chem. 1988, 263, 2238–2244. [Google Scholar] [CrossRef]
- Wiegand, H.; Meis, S.; Gotzsch, U. Inhibition by Tetrandrine of Calcium Currents at Mouse Motor Nerve Endings. Brain Res. 1990, 524, 112–118. [Google Scholar] [CrossRef]
- Pennefather, P.; Quastel, D.M. Modification of Dose-Response Curves by Effector Blockade and Uncompetitive Antagonism. Mol. Pharmacol. 1982, 22, 369–380. [Google Scholar]
- Lambert, D. Drugs and Receptors. Contin. Educ. Anaesth. Crit. Care Pain 2004, 4, 181–184. [Google Scholar] [CrossRef]
- Zahradníková, A.; Minarovic, I.; Zahradník, I. Competitive and Cooperative Effects of Bay K8644 on the L-Type Calcium Channel Current Inhibition by Calcium Channel Antagonists. J. Pharmacol. Exp. Ther. 2007, 322, 638–645. [Google Scholar] [CrossRef] [PubMed]
Gene Name | GenBank Accession Number | Protein Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|---|
cacna1s | NM_05873 | CaV1.1 | gcgtcgtggagtggaaac | gggagctggagtttaagaatga |
cacna1c | NM_012517 | CaV1.2 | tggctcacagaagtgcaaga | agcatttctgccgtgaaaag |
cacna1d | NM_017298 | CaV1.3 | ccatgctcactgtgttccag | ctcccatcctatcgcatcat |
gusb | NM_017015.2 | Gus | ctctggtggccttacctgat | cagactcaggtgttgtcatcg |
gapdh | NM_017008.3 | Gapdh | tgggaagctggtcatcaac | gcatcaccccatttgatgtt |
BAY K8644 | KCl | |||
---|---|---|---|---|
IA Name | IC50 (µM) | Hill Slope | IC50 (µM) | Hill Slope |
oxostephanine | 3.97 ± 0.54 | 1.87 ± 0.41 | 8.36 ± 0.86 | 1.80 ± 0.30 |
thaliphylline | 9.21 ± 0.71 | 1.53 ± 0.69 | 10.97 ± 0.96 | 1.39 ± 0.51 |
thalmiculine | 7.00 ± 1.10 | 2.00 ± 0.40 | 4.96 ± 0.98 | 1.55 ± 0.50 |
IA Name | EC50 (µM) | Emax (AUC) |
---|---|---|
Control | 0.40 ± 0.39 | 148.6 ± 0.05 |
+10 µM oxostephanine | 4.00 ± 0.09 * | 56.45 * ± 0.10 |
+10 µM thaliphylline | 0.73 ± 0.96 ns | 92.7 * ± 0.45 |
+10 µM thalmiculine | 0.36 ± 0.10 ns | 39.33 * ± 0.94 |
Alkaloid Name | Oxosteph. | Liriodenine | Lauterine | Atherosperm. | Langinosine | Dicentrinone | Oxocreb. |
---|---|---|---|---|---|---|---|
oxosteph. | 1 | 0.73 | 0.83 | 0.83 | 0.75 | 0.66 | 0.75 |
liriodenine | 0.73 | 1 | 0.70 | 0.72 | 0.71 | 0.53 | 0.49 |
lauterine | 0.83 | 0.70 | 1 | 0.75 | 0.80 | 0.75 | 0.71 |
atherosperm. | 0.83 | 0.75 | 0.75 | 1 | 0.70 | 0.62 | 0.68 |
langinosine | 0.75 | 0.71 | 0.80 | 0.70 | 1 | 0.75 | 0.71 |
dicentrinone | 0.66 | 0.53 | 0.75 | 0.62 | 0.75 | 1 | 0.85 |
oxocreb. | 0.75 | 0.49 | 0.71 | 0.68 | 0.71 | 0.85 | 1 |
Alkaloid Name | Thaliphylline | Thalmiculine | Tetrandrine | Cepharanthine |
---|---|---|---|---|
thaliphylline | 1 | 0.75 | 0.80 | 0.76 |
thalmiculine | 0.75 | 1 | 0.76 | 0.71 |
tetrandrine | 0.80 | 0.76 | 1 | 0.84 |
cepharanthine | 0.76 | 0.71 | 0.84 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Frangieh, J.; Legendre, C.; Bréard, D.; Richomme, P.; Henrion, D.; Fajloun, Z.; Mattei, C.; Le Ray, A.-M.; Legros, C. Oxostephanine, Thalmiculine, and Thaliphyline—Three Isoquinoleine Alkaloids That Inhibit L-Type Voltage-Gated Ca2+ Channels. Future Pharmacol. 2022, 2, 238-255. https://doi.org/10.3390/futurepharmacol2030016
Frangieh J, Legendre C, Bréard D, Richomme P, Henrion D, Fajloun Z, Mattei C, Le Ray A-M, Legros C. Oxostephanine, Thalmiculine, and Thaliphyline—Three Isoquinoleine Alkaloids That Inhibit L-Type Voltage-Gated Ca2+ Channels. Future Pharmacology. 2022; 2(3):238-255. https://doi.org/10.3390/futurepharmacol2030016
Chicago/Turabian StyleFrangieh, Jacinthe, Claire Legendre, Dimitri Bréard, Pascal Richomme, Daniel Henrion, Ziad Fajloun, César Mattei, Anne-Marie Le Ray, and Christian Legros. 2022. "Oxostephanine, Thalmiculine, and Thaliphyline—Three Isoquinoleine Alkaloids That Inhibit L-Type Voltage-Gated Ca2+ Channels" Future Pharmacology 2, no. 3: 238-255. https://doi.org/10.3390/futurepharmacol2030016
APA StyleFrangieh, J., Legendre, C., Bréard, D., Richomme, P., Henrion, D., Fajloun, Z., Mattei, C., Le Ray, A. -M., & Legros, C. (2022). Oxostephanine, Thalmiculine, and Thaliphyline—Three Isoquinoleine Alkaloids That Inhibit L-Type Voltage-Gated Ca2+ Channels. Future Pharmacology, 2(3), 238-255. https://doi.org/10.3390/futurepharmacol2030016