Health Risks of Pristine and Leached Polystyrene Micro- and Nanoplastics: An In Vitro Study on Human Dental Pulp Stem Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Plastics
2.2. Plastic Characterization
2.3. Institutional Review Board Statement
2.4. Cell Isolation and Maintenance
2.5. Cell Viability Assay
2.6. Aging of PS Particles in Culture Medium and Atomic Force Microscopy (AFM) Inspection
2.7. Cellular Uptake and Cytoskeleton Organization
2.8. Study of Endocytic Pathway
2.9. RNA Extraction and Gene Expression
2.10. Statistical Analysis
3. Results
3.1. Study Design
3.2. PS Pristine Particle Characterization
3.3. Effect of PS Pristine Particles on Cell Viability
3.4. Effect of Aged PS Particles on Cell Viability
3.5. Effect of Aging on PS Particle Surface Evaluated by Atomic Force Microscopy
3.6. Impact of PS Particles on Cellular Uptake and Cytoskeleton Organization
3.7. Study of Cell Uptake Pathway After Exposure to PS Particles
3.8. Assessment of Gene Expression After Cell Exposure to PS Particles
3.9. Effect of PS Particle Aging on Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nisha; Joshi, H.C. A Systematic Review: Biodegradation, Mechanism, Remediation Strategies, and Environmental Impacts of Microplastics. Asia-Pac. J. Chem. Eng. 2024, 19, e3122. [Google Scholar] [CrossRef] [Scilit]
- Kik, K.; Bukowska, B.; Sicińska, P. Polystyrene Nanoparticles: Sources, Occurrence in the Environment, Distribution in Tissues, Accumulation and Toxicity to Various Organisms. Environ. Pollut. 2020, 262, 114297. [Google Scholar] [CrossRef] [Scilit]
- Kwon, B.G.; Koizumi, K.; Chung, S.-Y.; Kodera, Y.; Kim, J.-O.; Saido, K. Global Styrene Oligomers Monitoring as New Chemical Contamination from Polystyrene Plastic Marine Pollution. J. Hazard. Mater. 2015, 300, 359–367. [Google Scholar] [CrossRef] [Scilit]
- Banerjee, A.; Billey, L.O.; Shelver, W.L. Uptake and Toxicity of Polystyrene Micro/Nanoplastics in Gastric Cells: Effects of Particle Size and Surface Functionalization. PLoS ONE 2021, 16, e0260803. [Google Scholar] [CrossRef] [Scilit]
- Mattioda, V.; Benedetti, V.; Tessarolo, C.; Oberto, F.; Favole, A.; Gallo, M.; Martelli, W.; Crescio, M.I.; Berio, E.; Masoero, L.; et al. Pro-Inflammatory and Cytotoxic Effects of Polystyrene Microplastics on Human and Murine Intestinal Cell Lines. Biomolecules 2023, 13, 140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vo, H.C.; Pham, M.H. Ecotoxicological Effects of Microplastics on Aquatic Organisms: A Review. Environ. Sci. Pollut. Res. 2021, 28, 44716–44725. [Google Scholar] [CrossRef] [Scilit]
- Jalaudin Basha, N.N.; Adzuan Hafiz, N.B.; Osman, M.S.; Abu Bakar, N.F. Unveiling the Noxious Effect of Polystyrene Microplastics in Aquatic Ecosystems and Their Toxicological Behavior on Fishes and Microalgae. Front. Toxicol. 2023, 5, 1135081. [Google Scholar] [CrossRef] [Scilit]
- Kelpsiene, E.; Ekvall, M.T.; Lundqvist, M.; Torstensson, O.; Hua, J.; Cedervall, T. Review of Ecotoxicological Studies of Widely Used Polystyrene Nanoparticles. Environ. Sci. Process. Impacts 2022, 24, 8–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, J.; Choi, D.; Han, S.; Jung, S.Y.; Choi, J.; Hong, J. Potential Toxicity of Polystyrene Microplastic Particles. Sci. Rep. 2020, 10, 7391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paul, M.B.; Fahrenson, C.; Givelet, L.; Herrmann, T.; Loeschner, K.; Böhmert, L.; Thünemann, A.F.; Braeuning, A.; Sieg, H. Beyond Microplastics–Investigation on Health Impacts of Submicron and Nanoplastic Particles after Oral Uptake In Vitro. Microplastics Nanoplastics 2022, 2, 16. [Google Scholar] [CrossRef] [Scilit]
- Saud, S.; Yang, A.; Jiang, Z.; Ning, D.; Fahad, S. New Insights in to the Environmental Behavior and Ecological Toxicity of Microplastics. J. Hazard. Mater. Adv. 2023, 10, 100298. [Google Scholar] [CrossRef] [Scilit]
- Issac, M.N.; Kandasubramanian, B. Effect of Microplastics in Water and Aquatic Systems. Environ. Sci. Pollut. Res. 2021, 28, 19544–19562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddiqui, S.A.; Singh, S.; Bahmid, N.A.; Shyu, D.J.H.; Domínguez, R.; Lorenzo, J.M.; Pereira, J.A.M.; Câmara, J.S. Polystyrene Microplastic Particles in the Food Chain: Characteristics and Toxicity—A Review. Sci. Total Environ. 2023, 892, 164531. [Google Scholar] [CrossRef] [Scilit]
- Zaini, N.; Kasmuri, N.; Mojiri, A.; Kindaichi, T.; Nayono, S.E. Plastic Pollution and Degradation Pathways: A Review on the Treatment Technologies. Heliyon 2024, 10, e28849. [Google Scholar] [CrossRef] [Scilit]
- Landrigan, P.J.; Raps, H.; Cropper, M.; Bald, C.; Brunner, M.; Canonizado, E.M.; Charles, D.; Chiles, T.C.; Donohue, M.J.; Enck, J.; et al. The Minderoo-Monaco Commission on Plastics and Human Health. Ann. Glob. Health 2023, 89, 23. [Google Scholar] [CrossRef] [Scilit]
- van Emmerik, T.H.M.; Kirschke, S.; Schreyers, L.J.; Nath, S.; Schmidt, C.; Wendt-Potthoff, K. Estimating Plastic Pollution in Rivers through Harmonized Monitoring Strategies. Mar. Pollut. Bull. 2023, 196, 115503. [Google Scholar] [CrossRef] [Scilit]
- Geremia, E.; Muscari Tomajoli, M.T.; Murano, C.; Petito, A.; Fasciolo, G. The Impact of Micro- and Nanoplastics on Aquatic Organisms: Mechanisms of Oxidative Stress and Implications for Human Health—A Review. Environments 2023, 10, 161. [Google Scholar] [CrossRef] [Scilit]
- He, T.; Qu, Y.; Yang, X.; Liu, L.; Xiong, F.; Wang, D.; Liu, M.; Sun, R. Research Progress on the Cellular Toxicity Caused by Microplastics and Nanoplastics. J. Appl. Toxicol. 2023, 43, 1576–1593. [Google Scholar] [CrossRef] [Scilit]
- Jeon, M.S.; Kim, J.W.; Han, Y.B.; Jeong, M.H.; Kim, H.R.; Sik Kim, H.; Park, Y.J.; Chung, K.H. Polystyrene Microplastic Particles Induce Autophagic Cell Death in BEAS-2B Human Bronchial Epithelial Cells. Environ. Toxicol. 2022, 38, 359–367. [Google Scholar] [CrossRef] [Scilit]
- Ma, C.; Ramachandraiah, K.; Jiang, G. Micro and Nano Plastics: Contaminants in Beverages and Prevention Strategies. Front. Sustain. Food Syst. 2024, 8, 1491290. [Google Scholar] [CrossRef] [Scilit]
- Yu, C.; Abbott, P. An Overview of the Dental Pulp: Its Functions and Responses to Injury. Aust. Dent. J. 2007, 52, S4–S6. [Google Scholar] [CrossRef] [Scilit]
- Barone, L.; Gallazzi, M.; Rossi, F.; Papait, R.; Raspanti, M.; Zecca, P.A.; Buonarrivo, L.; Bassani, B.; Bernardini, G.; Bruno, A.; et al. Human Dental Pulp Mesenchymal Stem Cell-Derived Soluble Factors Combined with a Nanostructured Scaffold Support the Generation of a Vascular Network In Vivo. Nanomaterials 2023, 13, 2479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barone, L.; Cucchiara, M.; Palano, M.T.; Bassani, B.; Gallazzi, M.; Rossi, F.; Raspanti, M.; Zecca, P.A.; De Antoni, G.; Pagiatakis, C.; et al. Dental Pulp Mesenchymal Stem Cell (DPSCs)-Derived Soluble Factors, Produced under Hypoxic Conditions, Support Angiogenesis via Endothelial Cell Activation and Generation of M2-like Macrophages. J. Biomed. Sci. 2024, 31, 99. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Ouchi, T.; Cao, Y.; Zhao, Z.; Men, Y. Dental-Derived Mesenchymal Stem Cells: State of the Art. Front. Cell Dev. Biol. 2021, 9, 654559. [Google Scholar] [CrossRef] [Scilit]
- Cherubino, M.; Valdatta, L.; Balzaretti, R.; Pellegatta, I.; Rossi, F.; Protasoni, M.; Tedeschi, A.; Accolla, R.S.; Bernardini, G.; Gornati, R. Human Adipose-Derived Stem Cells Promote Vascularization of Collagen-Based Scaffolds Transplanted into Nude Mice. Regen. Med. 2016, 11, 261–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conrad, C.; Huss, R. Adult Stem Cell Lines in Regenerative Medicine and Reconstructive Surgery. J. Surg. Res. 2005, 124, 201–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Borgese, M.; Rossi, F.; Bonfanti, P.; Colombo, A.; Mantecca, P.; Valdatta, L.; Bernardini, G.; Gornati, R. Recovery Ability of Human Adipose Stem Cells Exposed to Cobalt Nanoparticles: Outcome of Dissolution. Nanomedicine 2020, 15, 453–465. [Google Scholar] [CrossRef] [Scilit]
- Papis, E.; Rossi, F.; Raspanti, M.; Dalle-Donne, I.; Colombo, G.; Milzani, A.; Bernardini, G.; Gornati, R. Engineered Cobalt Oxide Nanoparticles Readily Enter Cells. Toxicol. Lett. 2009, 189, 253–259. [Google Scholar] [CrossRef] [Scilit]
- Gornati, R.; Pedretti, E.; Rossi, F.; Cappellini, F.; Zanella, M.; Olivato, I.; Sabbioni, E.; Bernardini, G. Zerovalent Fe, Co and Ni Nanoparticle Toxicity Evaluated on SKOV-3 and U87 Cell Lines. J. Appl. Toxicol. 2016, 36, 385–393. [Google Scholar] [CrossRef] [Scilit]
- Gheorghe, Ş.; Pătraşcu, A.-M.; Stoica, C.; Balas, M.; Feodorov, L. Ecotoxicological Effects of Polystyrene Particle Mix (20, 200, and 430 Μm) on Cyprinus Carpio. Toxics 2025, 13, 246. [Google Scholar] [CrossRef] [Scilit]
- Palombella, S.; Pirrone, C.; Cherubino, M.; Valdatta, L.; Bernardini, G.; Gornati, R. Identification of Reference Genes for qPCR Analysis during hASC Long Culture Maintenance. PLoS ONE 2017, 12, e0170918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmidt, A.; Da Silva Brito, W.A.; Singer, D.; Mühl, M.; Berner, J.; Saadati, F.; Wolff, C.; Miebach, L.; Wende, K.; Bekeschus, S. Short- and Long-Term Polystyrene Nano- and Microplastic Exposure Promotes Oxidative Stress and Divergently Affects Skin Cell Architecture and Wnt/Beta-Catenin Signaling. Part. Fibre Toxicol. 2023, 20, 3. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Jian, S.; Zhang, S.; Wu, D.; Wang, J.; Gao, M.; Sheng, J.; Hong, Y. Enrichment of Polystyrene Microplastics Induces Histological Damage, Oxidative Stress, Keap1-Nrf2 Signaling Pathway-Related Gene Expression in Loach Juveniles (Paramisgurnus dabryanus). Ecotoxicol. Environ. Saf. 2022, 237, 113540. [Google Scholar] [CrossRef] [Scilit]
- Yedier, S.; Yalçınkaya, S.K.; Bostancı, D. Exposure to Polypropylene Microplastics via Diet and Water Induces Oxidative Stress in Cyprinus Carpio. Aquat. Toxicol. 2023, 259, 106540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mäger, I.; Langel, K.; Lehto, T.; Eiríksdóttir, E.; Langel, Ü. The Role of Endocytosis on the Uptake Kinetics of Luciferin-Conjugated Cell-Penetrating Peptides. Biochim. Biophys. Acta (BBA)-Biomembr. 2012, 1818, 502–511. [Google Scholar] [CrossRef] [Scilit]
- Rossi, F.; Bernardini, G.; Bonfanti, P.; Colombo, A.; Prati, M.; Gornati, R. Effects of TCDD on Spermatogenesis Related Factor-2 (SRF-2): Gene Expression in Xenopus. Toxicol. Lett. 2009, 191, 189–194. [Google Scholar] [CrossRef] [Scilit]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal Human Dental Pulp Stem Cells (DPSCs) in Vitro and in Vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef] [Scilit]
- Research and Markets. Polystyrene (PS) World, Regions and Countries Market Analysis 2019–2024 and Outlook to 2034; Market Reasearch Report; Research and Markets: Birmingham, UK, 2025; p. 205. [Google Scholar]
- Guanglin, L.; Shuqin, W. Polystyrene Nanoplastics Exposure Causes Inflammation and Death of Esophageal Cell. Ecotoxicol. Environ. Saf. 2024, 269, 115819. [Google Scholar] [CrossRef] [Scilit]
- Saenen, N.D.; Witters, M.S.; Hantoro, I.; Tejeda, I.; Ethirajan, A.; Van Belleghem, F.; Smeets, K. Polystyrene Microplastics of Varying Sizes and Shapes Induce Distinct Redox and Mitochondrial Stress Responses in a Caco-2 Monolayer. Antioxidants 2023, 12, 739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Ren, X.-M.; He, H.; Li, F.; Liu, K.; Zhao, F.; Hu, H.; Zhang, P.; Huang, B.; Pan, X. Cytotoxicity and Pro-Inflammatory Effect of Polystyrene Nano-Plastic and Micro-Plastic on RAW264.7 Cells. Toxicology 2023, 484, 153391. [Google Scholar] [CrossRef] [Scilit]
- Schmidt, A.; Mühl, M.; Brito, W.A.D.S.; Singer, D.; Bekeschus, S. Antioxidant Defense in Primary Murine Lung Cells Following Short- and Long-Term Exposure to Plastic Particles. Antioxidants 2023, 12, 227. [Google Scholar] [CrossRef] [Scilit]
- Brouwer, H.; Porbahaie, M.; Boeren, S.; Busch, M.; Bouwmeester, H. The in Vitro Gastrointestinal Digestion-Associated Protein Corona of Polystyrene Nano- and Microplastics Increases Their Uptake by Human THP-1-Derived Macrophages. Part. Fibre Toxicol. 2024, 21, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janke, U.; Geist, N.; Weilbeer, E.; Levin, W.; Delcea, M. Impact of Protein Corona Formation and Polystyrene Nanoparticle Functionalisation on the Interaction with Dynamic Biomimetic Membranes Comprising of Integrin. ChemBioChem 2024, 25, e202400188. [Google Scholar] [CrossRef] [Scilit]
- Kihara, S.; Ashenden, A.; Kaur, M.; Glasson, J.; Ghosh, S.; van der Heijden, N.; Brooks, A.E.S.; Mata, J.P.; Holt, S.; Domigan, L.J.; et al. Cellular Interactions with Polystyrene Nanoplastics—The Role of Particle Size and Protein Corona. Biointerphases 2021, 16, 041001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Liu, W.; Zeb, A.; Lian, J.; Sun, Y.; Sun, H. Polystyrene Microplastic Interaction with Oryza Sativa: Toxicity and Metabolic Mechanism. Environ. Sci. Nano 2021, 8, 3699–3710. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Wang, F.; Xu, S.; Cui, J.; Li, K.; Shiwen, X.; Guo, M. Polystyrene Microplastics Induce Myocardial Inflammation and Cell Death via the TLR4/NF-κB Pathway in Carp. Fish Shellfish. Immunol. 2023, 135, 108690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pugnaloni, A.; Lucarini, G.; Giantomassi, F.; Lombardo, L.; Capella, S.; Belluso, E.; Zizzi, A.; Panico, A.M.; Biagini, G. In Vitro Study of Biofunctional Indicators after Exposure to Asbestos-like Fluoro-Edenite Fibres. Cell. Mol. Biol. 2007, 53, 965–980. [Google Scholar]
- DeLoid, G.M.; Yang, Z.; Bazina, L.; Kharaghani, D.; Sadrieh, F.; Demokritou, P. Mechanisms of Ingested Polystyrene Micro-Nanoplastics (MNPs) Uptake and Translocation in an in Vitro Tri-Culture Small Intestinal Epithelium. J. Hazard. Mater. 2024, 473, 134706. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Colosi, P.; Hugelier, S.; Zabezhinsky, D.; Lakadamyali, M.; Svitkina, T. Actin Polymerization Promotes Invagination of Flat Clathrin-Coated Lattices in Mammalian Cells by Pushing at Lattice Edges. Nat. Commun. 2022, 13, 6127. [Google Scholar] [CrossRef] [Scilit]
- Deng, Z.; Fan, T.; Xiao, C.; Tian, H.; Zheng, Y.; Li, C.; He, J. TGF-β Signaling in Health, Disease and Therapeutics. Signal Transduct. Target. Ther. 2024, 9, 61. [Google Scholar] [CrossRef] [Scilit]
- Mahmud, F.; Sarker, D.B.; Jocelyn, J.A.; Sang, Q.-X.A. Molecular and Cellular Effects of Microplastics and Nanoplastics: Focus on Inflammation and Senescence. Cells 2024, 13, 1788. [Google Scholar] [CrossRef] [Scilit]
- Van Gorp, H.; Van Opdenbosch, N.; Lamkanfi, M. Inflammasome-Dependent Cytokines at the Crossroads of Health and Autoinflammatory Disease. Cold Spring Harb. Perspect. Biol. 2019, 11, a028563. [Google Scholar] [CrossRef] [Scilit]
- Michelini, S.; Mawas, S.; Kurešepi, E.; Barbero, F.; Šimunović, K.; Miremont, D.; Devineau, S.; Schicht, M.; Ganin, V.; Haugen, Ø.P.; et al. Pulmonary Hazards of Nanoplastic Particles: A Study Using Polystyrene in in Vitro Models of the Alveolar and Bronchial Epithelium. J. Nanobiotechnol. 2025, 23, 388. [Google Scholar] [CrossRef] [Scilit]
- Lin, P.; Tong, X.; Xue, F.; Qianru, C.; Xinyu, T.; Zhe, L.; Zhikun, B.; Shu, L. Polystyrene Nanoplastics Exacerbate Lipopolysaccharide-Induced Myocardial Fibrosis and Autophagy in Mice via ROS/TGF-Β1/Smad. Toxicology 2022, 480, 153338. [Google Scholar] [CrossRef] [Scilit]
- Arini, A.; Muller, S.; Coma, V.; Grau, E.; Sandre, O.; Baudrimont, M. Origin, Exposure Routes and Xenobiotics Impart Nanoplastics with Toxic Effects on Freshwater Bivalves. Environ. Sci. Nano 2023, 10, 1352–1371. [Google Scholar] [CrossRef] [Scilit]
- Ranjan, H.; Senthil Kumar, S.; Priscilla, S.; Swaminathan, S.; Umezawa, M.; Sheik Mohideen, S. Polyethylene Microplastics Affect Behavioural, Oxidative Stress, and Molecular Responses in the Drosophila Model. Environ. Sci. Process. Impacts 2024, 26, 2203–2214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, C.-S.; Chang, C.-K.; Lin, L.-S.; Jou, S.-B.; Kuo, D.-H.; Liao, S.-S.; Cheng, J.-T. Modification of Superoxide Dismutase (SOD) mRNA and Activity by a Transient Hypoxic Stress in Cultured Glial Cells. Neurosci. Lett. 1998, 251, 145–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Im, G.-B.; Kim, Y.G.; Jo, I.-S.; Yoo, T.Y.; Kim, S.-W.; Park, H.S.; Hyeon, T.; Yi, G.-R.; Bhang, S.H. Effect of Polystyrene Nanoplastics and Their Degraded Forms on Stem Cell Fate. J. Hazard. Mater. 2022, 430, 128411. [Google Scholar] [CrossRef] [Scilit]
- Barguilla, M.-S.V.; Guyot, B. Stem Cells as Unique Models to Study Long-Term Effects Triggered by Micro- and Nanoplastic Exposure: A Focus on Cell Transformation and Differentiation. Span. J. Environ. Mutagen. Genom. 2023, 27, 141. [Google Scholar]
- Lerman, M.J.; Smith, B.T.; Gerald, A.G.; Santoro, M.; Fookes, J.A.; Mikos, A.G.; Fisher, J.P. Aminated 3D Printed Polystyrene Maintains Stem Cell Proliferation and Osteogenic Differentiation. Tissue Eng. Part C Methods 2020, 26, 118–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tao, M.; Wang, C.; Zheng, Z.; Gao, W.; Chen, Q.; Xu, M.; Zhu, W.; Xu, L.; Han, X.; Guo, X.; et al. Nanoplastics Exposure-Induced Mitochondrial Dysfunction Contributes to Disrupted Stem Cell Differentiation in Human Cerebral Organoids. Ecotoxicol. Environ. Saf. 2024, 285, 117063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gulizia, A.M.; Patel, K.; Philippa, B.; Motti, C.A.; van Herwerden, L.; Vamvounis, G. Understanding Plasticiser Leaching from Polystyrene Microplastics. Sci. Total Environ. 2023, 857, 159099. [Google Scholar] [CrossRef] [Scilit]
- Morandi, M.I.; Kluzek, M.; Wolff, J.; Schroder, A.; Thalmann, F.; Marques, C.M. Accumulation of Styrene Oligomers Alters Lipid Membrane Phase Order and Miscibility. Proc. Natl. Acad. Sci. USA 2021, 118, e2016037118. [Google Scholar] [CrossRef] [Scilit]
- Arrigo, F.; Impellitteri, F.; Piccione, G.; Faggio, C. Phthalates and Their Effects on Human Health: Focus on Erythrocytes and the Reproductive System. Comp. Biochem. Physiol. Part. C Toxicol. Pharmacol. 2023, 270, 109645. [Google Scholar] [CrossRef] [Scilit]
- Bereketoglu, C.; Pradhan, A. Plasticizers: Negative Impacts on the Thyroid Hormone System. Environ. Sci. Pollut. Res. 2022, 29, 38912–38927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paramasivam, A.; Murugan, R.; Jeraud, M.; Dakkumadugula, A.; Periyasamy, R.; Arjunan, S. Additives in Processed Foods as a Potential Source of Endocrine-Disrupting Chemicals: A Review. J. Xenobiotics 2024, 14, 1697–1710. [Google Scholar] [CrossRef] [Scilit] [PubMed]










| Gene Name | Primer Sequence 5′-3′ | Melting Temperature (°C) | Accession Number |
|---|---|---|---|
| βactin | 1Fw: GAAGATCAAGATCATTGCTCCTC | 63.1 | NM_001101.5 |
| 2Rev: GACTCGTCATACTCCTGCTT | 63.1 | ||
| GAPDH | 1Fw: ATCATCAGCAATGCCTCCT | 60.9 | M17851.1 |
| 2Rev: GAGTCCTTCCACGATACCAA | 60.5 | ||
| Interleukin-1β (IL-1β) | 1Fw: CTACGAATCTCCGACCAC | 60.7 | AY137079.1 |
| 2Rev: AACCAGCATCTTCCTCAG | 60.5 | ||
| Interleukin-6 (IL-6) | 1Fw: ACTCACCTCTTCAGAACG | 60.0 | M54894.1 |
| 2Rev: CCTCTTTGCTGCTTTCAC | 60.4 | ||
| Interleukin-8 (IL-8) | 1Fw: GCCAAGGAGTGCTAAAGA | 60.8 | M28130.1 |
| 2Rev: TGGTCCACTCTCAATCAC | 60.0 | ||
| Transforming Growth Factor β1 (TGF-β1) | 1Fw: CTACTACGCCAAGGAGGTC | 63.1 | NM_000660.7 |
| 2Rev: CTCTGCTTGAACTTGTCATAGATT | 62.9 | ||
| Tumor necrosis factor α (TNF-α) | 1Fw: AATGGCGTGGAGCTGAGA | 65.3 | M16441.1 |
| 2Rev: TGAAGAGGACCTGGGAGTAGAT | 65.8 | ||
| Superoxide dismutase (SOD) | 1Fw: CAGATGACTTGGGCAAAG | 59.8 | EF151142.1 |
| 2Rev: CCAATTACACCACAAGCC | 60.1 | ||
| Catalase (CAT) | 1Fw: TACCCTCTCATCCCAGTT | 60.4 | AY028632.1 |
| 2Rev: GGTCGAAGGCTATCTGTT | 60.2 | ||
| CD44 | 1Fw: GCAGTCAACAGTCGAAGAAG | 62.9 | AY101192.1 |
| 2Rev: GTCCTCCACAGCTCCATT | 62.9 | ||
| CD90 | 1Fw: CTCTACTTATCCGCCTTCACT | 62.9 | NM_006288.5 |
| 2Rev: CGTTCTGGGAGGAGATGG | 63.0 | ||
| Dentin Sialophosphoprotein (DSPP) | 1Fw: GCAGTGACAGTGATAGTAGTG | 63.2 | NM_014208.3 |
| 2Rev: TTGCTGCTGTCTGACTTG | 63.2 | ||
| Alkaline Phosphatase (ALPL) | 1Fw: TGAGTGACACAGACAAGAAG | 62.6 | AH005272.2 |
| 2Rev: CTGGTAGTTGTTGTGAGCATA | 63.1 | ||
| Cyclin-dependent kinase inhibitor 2A (p16) | 1Fw: CTTCCTGGACACGCTGGTG | 67.1 | NM_000077.5 |
| 2Rev: ATGGTTACTGCCTCTGGTGC | 66.5 | ||
| Cyclin Dependent Kinase Inhibitor 1A (p21) | 1Fw: ACCTCACCTGCTCTGCTG | 65.6 | NM_000389.5 |
| 2Rev: AGGCACAAGGGTACAAGAC | 63.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Barone, L.; Rossi, F.; Borgese, M.; Maisano, M.; Cappello, T.; Raspanti, M.; Pagiatakis, C.; Papait, R.; Bernardini, G.; Gornati, R. Health Risks of Pristine and Leached Polystyrene Micro- and Nanoplastics: An In Vitro Study on Human Dental Pulp Stem Cells. Microplastics 2026, 5, 25. https://doi.org/10.3390/microplastics5010025
Barone L, Rossi F, Borgese M, Maisano M, Cappello T, Raspanti M, Pagiatakis C, Papait R, Bernardini G, Gornati R. Health Risks of Pristine and Leached Polystyrene Micro- and Nanoplastics: An In Vitro Study on Human Dental Pulp Stem Cells. Microplastics. 2026; 5(1):25. https://doi.org/10.3390/microplastics5010025
Chicago/Turabian StyleBarone, Ludovica, Federica Rossi, Marina Borgese, Maria Maisano, Tiziana Cappello, Mario Raspanti, Christina Pagiatakis, Roberto Papait, Giovanni Bernardini, and Rosalba Gornati. 2026. "Health Risks of Pristine and Leached Polystyrene Micro- and Nanoplastics: An In Vitro Study on Human Dental Pulp Stem Cells" Microplastics 5, no. 1: 25. https://doi.org/10.3390/microplastics5010025
APA StyleBarone, L., Rossi, F., Borgese, M., Maisano, M., Cappello, T., Raspanti, M., Pagiatakis, C., Papait, R., Bernardini, G., & Gornati, R. (2026). Health Risks of Pristine and Leached Polystyrene Micro- and Nanoplastics: An In Vitro Study on Human Dental Pulp Stem Cells. Microplastics, 5(1), 25. https://doi.org/10.3390/microplastics5010025

