Next Article in Journal
Survey of the Trunk Wood Mycobiome of an Ancient Tilia × europaea L.
Previous Article in Journal
Characterization of the Microbiome and Virulence and Resistance Genes in the Howler Monkey (Alouatta seniculus) in Colombian Andean Forests
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees

by
Iskra Vitanova Ivanova
1,
Yavor Rabadjiev
1,
Maria Ananieva
1,
Ilia Iliev
2 and
Svetoslav Dimitrov Todorov
1,3,*
1
Department of General and Applied Microbiology, Faculty of Biology, Sofia University St. Kliment Ohridski, 8 Dragan Tzankov Blvd., 1164 Sofia, Bulgaria
2
Department of Biochemistry and Microbiology, Faculty of Biology, Plovdiv University “Paisii Hilendarski”, 4027 Plovdiv, Bulgaria
3
ProBacLab, Laboratório de Microbiologia de Alimentos, Departamento de Alimentos e Nutrição Experimental, Food Research Center, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo 05508-000, SP, Brazil
*
Author to whom correspondence should be addressed.
Appl. Microbiol. 2025, 5(4), 130; https://doi.org/10.3390/applmicrobiol5040130
Submission received: 5 October 2025 / Revised: 5 November 2025 / Accepted: 10 November 2025 / Published: 12 November 2025

Abstract

Fructophilic lactic acid bacteria (FLAB), Apilactobacillus kunkeei strains AG8 and AG9 were selected in the current study for in-depth analysis. Cultivation on fructose yeast peptone (FYP) medium with varying fructose concentrations (1%, 10%, and 30%) revealed that higher fructose levels promoted acetate production over lactate, confirming a heterofermentative metabolic profile. Ethanol production was negligible, consistent with the absence of alcohol dehydrogenase (ADH) activity. Enzyme assays showed fructokinase activity doubled at 30% fructose, while acetate kinase activity increased and L-lactate dehydrogenase activity decreased. This shift in enzyme ratios from 1:1 at 1% fructose to 10:1 or 15:1 at higher concentrations explains the metabolic preference for acetate. Apb. kunkeei is an obligate FLAB, growing poorly on glucose unless supplemented with external electron acceptors like pyruvate or oxygen. It lacks ADH, but retains acetaldehyde dehydrogenase (ALDH), enabling acetate production and additional ATP generation, enhancing biomass yield. The absence of the adhE gene contributes to NAD+/NADH imbalance and favors acetate production. Gene expression studies targeting fructose transport enzymes showed elevated expression of ABC transporters and carbohydrate metabolism genes in response to fructose. ADH expression remained low across sugar concentrations. Fructokinase gene expression was shown to be strain specific. Neither strain expressed the ABC transporter ATP-binding protein gene on glucose, nor the bacteriocin ABC transporter gene, correlating with the absence of antibacterial activity. These findings underscore the metabolic specialization of Apb. kunkeei, its reliance on fructose, and the role of ABC transporters in optimizing fermentation. The strain-specific gene expression and metabolic flexibility highlight its potential as a probiotic and feed additive in apiculture and biotechnology.

1. Introduction

Lactic acid bacteria (LAB) are one of the most important groups of microorganisms known to mankind. They are found in diverse ecological niches and are part of the composition of the microflora on plants, silages, and preserved plant-based foods, milk and milk products, meat and meat products, the gastrointestinal tract of humans and animals, and are important for the normal functioning of the gastrointestinal microflora [1,2,3].
LAB represent a large heterogeneous group of microorganisms characterized by their functional property to produce lactic acid by fermentation of organic substrates. LAB have been used for centuries to produce a variety of fermented products. The first studies on lactic acid fermentation were carried out by Louis Pasteur between 1857 and 1863, and 10 years later, J. Lister obtained the first pure culture of LAB, which he called Bacterium lactis [4]. Today, a century and a half later, we have numerous scientific facts and evidence revealing the enormous importance and importance of LAB for food fermentation, food biopreservation, the chemical industry, and medicine. LAB are one of the most important groups of microorganisms with applications in the food industry, where they are used as starter cultures to obtain many fermentation products.
In recent years, fructose-rich niches have emerged as a potential new source of LAB. Such habitats are flowers, fruits, etc., associated with natural pollinators such as the honeybee Apis mellifera, its pastures, its gastrointestinal tract, and its products (bee pollen, bee bread, royal jelly), which are classified as healthy food. Fructophilic lactic acid bacteria (FLAB) are a recently discovered group, consisting of a few fructobacilli and lactobacilli species. Because of their unique characteristics, including poor growth on glucose and a preference for oxygen, they are regarded as “unconventional” LAB [5]. Their unusual growth characteristics are due to an incomplete gene encoding a bifunctional alcohol/acetaldehyde dehydrogenase (adhE). This results in the imbalance of NAD/NADH and the requirement of additional electron acceptors to metabolize glucose.

2. Materials and Methods

2.1. Microorganisms and Growth Conditions

Apilactobacillus kunkeei AG8 and AG9 strains were previously isolated from a GIT of Bulgarian Apis melifera and identification by physiological, biochemical and biomolecular methods and shown to be two predominant isolated strains [6] and maintained in de Man, Rogosa and Sharpe broth (MRS, BD, Franklin Lakes, NJ, USA) supplemented with glycerol 20% (v/v) and stored at −20 °C. In the experiments, before use, an aliquot of 100 μL of the stored culture was transferred to 10 mL of modified MRS broth (glucose replaced by fructose) with initial pH on 6.0 and incubated in fructose yeast extract polypeptone (FYP) broth with 10 g/L fructose, 10 g/L yeast extract, 5 g/L polypeptone, 2 g/L sodium acetate, 0.5 g/L Tween 80, 0.2 g/L MgSO4 7 H2O, 0.01 g/L MnSO4 4 H2O, 0.01 g/L FeSO4 7H2O, 0.01 g/L NaCl, where fructose at 1%, was replaced with 10% and 30% (named FYP 1.0%, FYP 10% and FYP 30%, respectively), and incubated on a rotary shaker (100 rpm) at 35 °C for 24 h [6]. In the further experiments, Apb. kunkeei AG8 and AG9 strains (abbreviated according to recommendations from Todorov et al. [7]).
All experiments are performed on at least three independent occasions, and results are presented as average values.

2.2. Determination of D-Glucose, D-Fructose, D/L-Lactic Acid and Ethanol for D/L-Lactic Acid and Ethanol for Apb. kunkeei AG8 and AG9 Strains

Cell-free supernatant obtained after centrifugation (6000× g, 15 min, 4 °C) of the culture of Apb. kunkeei AG8 and AG9 strains grown in FYP 1.0%, FYP 10% and FYP 30%, at 35 °C for 24 h, were evaluated for the determination of D-glucose, D-fructose, D/L-lactic acid and ethanol for D/L-lactic acid and ethanol.
The content of D-glucose and D-fructose was determined by the enzymatic test K-FRUGL 11/05 (Megazyme™, Bray, Co. Wicklow, Ireland), according to the manufacturer’s instructions, and D-glucose and D-fructose concentrations were calculated accordingly. All D-glucose and D-fructose quantification experiments were performed with a minimum of three replicates.
The amount of D/L-lactic acid produced by the studied strains was evaluated through an enzymatic test, applying the specific kit for quantification of D-lactate and L-lactate (Megazyme™, Bray, Co. Wicklow, Ireland). This analysis was performed in triplicate with the entire cell-free supernatant content of each strain grown as described before.
Ethanol content was determined by the K-ETOH 03/06 enzyme assay (Megazyme™, Bray, Co. Wicklow, Ireland), according to the manufacturer’s instructions, and the ethanol concentration was calculated. All ethanol quantification experiments were performed with a minimum of three replicates.

2.3. Determination of Enzymatic Activities

The procedure was applied to the determination of intracellular enzymes: fructokinase, D/L-lactate dehydrogenase, acetate kinase, and alcohol dehydrogenase, according to described below.

2.4. Disintegration of Apb. kunkeei Cells

Reagents: 0.01 M K2HPO4 buffer, pH 6.8; 0.01 M K2HPO4 buffer, pH 7.6; 0.025 M K2HPO4 buffer, pH 7.0; 2 M Tris-HCl buffer, pH 7.6; 0.05 M Tris-HCl buffer, pH 7.6; 2 M Tris-HCL buffer, pH 7.0; 1 M MgCl2; 0.5 M ethylenediaminetetraacetate (EDTA), pH 8.0; 0.1 M dithiothreitol (DTT); 50% glycerol; protease inhibitor (Sigma, Burlington, MA, USA Cat. P8465).
Cell preparation and disintegration: Washing the cells. 2 mL of cell suspension were washed twice by centrifugation at 9000× g, 15 min, 4 °C with 0.01 M K2HPO4 buffer, pH 6.8 for determination of D/L-lactate dehydrogenase; with 0.01 M K2HPO4 buffer, pH 7.6 for alcohol dehydrogenase determination; with 0.05 M Tris-HCl buffer, pH 7.6 for the determination of acetate kinase and fructokinase with 0.025 M K2HPO4 buffer.
Disintegration of cells: Washed cell pellets were dissolved in a double volume of chilled disintegrating buffer with the following composition: 0.01 M K2HPO4 buffer, pH 6.8 for determination of D/L-lactate dehydrogenase; 0.05 M Tris-HCl, pH 7.6; 0.01 M MgCl2; 0.001 M EDTA, pH 8.0; 0.001 M DTT; 38.15% glycerol for the determination of alcohol dehydrogenase, acetate kinase, fructokinase and mannitol dehydrogenase. Disintegration was performed with ultrasound (Techpan Ultrasonic Disintegrator UD-20, Warsaw, Poland)-30 cycles/15 s impact/30 s breaks, in an ice bath. Cell debris was removed by centrifugation at 9000× g, 15 min, 4 °C, and the supernatant was used to determine fructokinase, mannitol dehydrogenase, L-lactate dehydrogenase, acetate kinase, and alcohol dehydrogenase enzyme activities.

2.5. Enzymatic Assay of Fructokinase (EC 2.7.1.4)

The quantification of fructokinase was determined according to the recommendations from Gunther et al. [8]. Reagents: 1 M Tris-HCl buffer, pH 7.8; 1 M fructose (Sigma, Burlington, MA, USA, purity 99%); 0.1 M ATP (Calbiochem, San Diego, CA, USA); 0.1 M MgCl2; 0.1 M NADP+ (Merck, Darmstadt, Germany); phosphoglucoisomerase (EC 5.3.1.9) from Saccharomyces cerevisiae (Sigma, Burlington, MA, USA, Cat. P5381); glucose-6-phosphate dehydrogenase (EC 1.1.1.49) from Leuconostoc mesenteroides (Calbiochem, San Diego, CA, USA, Cat. 346774). The fructokinase assay was performed by an indirect spectrophotometric method, counting the increase in NADPH absorbance at 340 nm. Reaction conditions for fructokinase determination were as follows: 0.1 M Tris-HCl, pH 7.8; 0.0125 M MgCl2; 0.0125 M ATP; 0.03 M NADP+; 0.1 M fructose; 1 U/mL phosphoglucoisomerase; 1 U/mL glucose-6-phosphate dehydrogenase; 0.1 mL cell lysate; temperature 35 °C. Measurements were performed with a Beckman Coulter DU 800 spectrophotometer (Brea, CA, USA). From the absorption values, for a selected interval of 1 min, the enzyme activity in U/mL and the specific activity in U/mg were calculated. In total, 1 unit of fructokinase activity is the amount of enzyme that catalyzes the formation of 1.0 μM of fructose-6-phosphate in 1 min, under the above conditions. For the determination of the specific enzyme activity, the protein concentration was assayed by the method of Bradford, using bovine serum albumin as a standard. All fructokinase assay experiments were performed in triplicate as a minimum according to recommendations.

2.6. Enzymatic Assay of D/L-Lactate Dehydrogenase (EC 1.1.1.28; 1.1.1.27)

The quantification of D/L-lactate dehydrogenase was determined according to the recommendations from Maekawa [9]. Reagents: 1 M Tris-HCl buffer, pH 9.0; 1 M HEPES buffer, pH 8.0; 0.1 M NAD+ (Merck, Darmstadt, Germany); 1 M D-lactic acid (Sigma, Burlington, MA, USA, purity 99%); 1 M L-lactic acid (Sigma, purity 98%). The D/L-LDH assay was performed by a direct spectrophotometric method, counting the formation of NADH at 340 nm. The reaction conditions for the determination of D-LDX were: 0.04 M Tris-HCl, pH 9.0; 0.01 M NADH+; 0.1 M D-lactic acid; 0.05 mL cell lysate; temperature 35 °C. The reaction conditions for L-LDX determination were: 0.04 M HEPES, pH 8.0; 0.01 NADH+; 0.15 M L-lactic acid; 0.05 mL cell lysate; temperature 35 °C. The measurements were carried out with a Beckman Coulter DU 800 spectrophotometer (Brea, CA, USA). Enzyme analysis of D/L-LDH (EC 1.1.1.28; EC 1.1.1.27). In total, 1 unit of L-lactate dehydrogenase activity is the amount of enzyme that dehydrogenates 1.0 μM of lactate to pyruvate in 1 min, under the above conditions. All experiments for the determination of D/L-lactate dehydrogenase were performed a minimum of three times following recommendations from Maekawa [9].

2.7. Enzymatic Assay of Alcohol Dehydrogenase

The quantification of alcohol dehydrogenase was determined according to the recommendations from Fibla and Gonzalez-Duarte [10]. The alcohol dehydrogenase assay was performed by a direct spectrophotometric method, counting the formation of NADH or NADPH at 340 nm. The reaction conditions for ADH determination were as follows: 0.02 M pyrophosphate buffer; pH 8.5; 0.0075 M NAD+ or NADH+; 3.1% ethanol; 0.05 mL cell lysate; temperature 35 °C. Measurements were performed with a Beckman Coulter DU 800 spectrophotometer (Brea, CA, USA). A total of 1 unit of alcohol dehydrogenase activity is the amount of enzyme that dehydrogenates 1.0 μM of ethanol to acetaldehyde in 1 min, under the above conditions. For the determination of the specific enzyme activity, the protein concentration was assayed by the method of Bradford, using bovine serum albumin as a standard. All experiments for the determination of ADH were performed with a minimum of triplicate following recommendations from Fibla and Gonzalez-Duarte [10].

2.8. Enzymatic Assay of Acetate Kinase (EC 2.7.2.1)

The quantification of acetate kinase was determined according to the recommendations from Ferry [11]. Reagents: 0.1 M triethanolamine buffer (TEA), pH 7.6; 1 M Na-acetate (Sigma, Burlington, MA, USA, purity 99%); 0.2 M MgCl2; 0.0064 M NADH+ (Calbiochem, San Diego, CA, USA); 0.091 ATP (Calbiochem, San Diego, CA, USA); 0.056 M phosphoenolpyruvate (Sigma); L-lactate dehydrogenase (EC 1.1.1.27) from rabbit muscle (Sigma, Burlington, MA, USA, Cat. 61309); pyruvate kinase (EC 2.7.1.40) from rabbit muscle (Calbiohem, San Diego, CA, USA, Cat. 5506); myokinase (EC 2.7.4.3) from rabbit muscle (Sigma, Burlington, MA, USA, Cat. M3003). The experimental procedure for the determination of acetate kinase (EC 2.7.2.1) was carried out by an indirect spectrophotometric method, taking into account the decrease in the absorbance of NADH at 340 nm. The reaction conditions for the determination of acetate kinase were as follows: 0.063 M TEA, pH 7.6; 0.2 M Na-acetate; 0.0061 M ATP; 0.0019 M phosphoenolpyruvate; 0.0067 M MgCl2; 0.0011 M NaOH; 10 U/mL pyruvate kinase; 10 U/mL L-lactate dehydrogenase; 10 U/mL; myokinase; 0.1 mL cell lysate; temperature 35 °C. Measurements were performed with a Beckman Coulter DU 800 spectrophotometer (Brea, CA, USA). A total of 1 unit of acetate kinase activity is the amount of enzyme that phosphorylates 1.0 μM of acetate to acetyl phosphate in 1 min, under the above conditions. For the determination of the specific enzyme activity, the protein concentration was assayed by the method of Bradford, using bovine serum albumin as a standard. All experiments for the determination of acetate kinase were performed with a minimum of triplicate following recommendations from Ferry [11].

2.9. Analysis of Gene Expression of Enzymes of ABC-Transporter-Related Genes

Based on a study focused on the expression of ABC-transporter-related genes by lactobacilli [12], the evaluated Apb. kunkeei AG8 and AG9 strains were subjected to a similar protocol in order to conduct a preliminary assay regarding the relevance of this system in the expression of its bacteriocin [13]. A culture of Apb. kunkeei AG8 and AG9 strains were grown in FYP medium with 1% fructose, 30% fructose (as experimental), and 1% glucose (as a control assay) at 35 °C for 24 h and subjected to RNA extraction using the GeneMATRIX Universal RNA Purification Kit (EURx Ltd., Gdansk, Poland), following instructions from the manufacturer. The obtained RNA was evaluated for purity and quantified on NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA) and used for measuring the expression of the genes associated with the ABC transporter system, using the GenomeLab™ GeXP Genetic Analysis System (Beckman Coulter, Brea, CA, USA), as previously described [12,13]. The housekeeping gene kanR was used as an external control. Primers were designed based on the complete genome of Lactiplantibacillus plantarum subsp. plantarum ST-III (CP002222.1), detailed previously described in Ananieva et al. [12] and Cavicchioli et al. [13]; primer sequences, gene functions, and length of products are presented in Table 1. Reverse transcriptase (RT) reactions were prepared with a final volume of 20 μL, containing 3 μL of DNase/RNase-free water, 4 μL of 5× RT buffer, 5 μL kanR RNA, 1 μL RT enzyme (GenomeLab™ GeXP Start Kit, Beckman Coulter, Brea, CA, USA), 2 μL of primers (10 pM), and 5 μL of RNA. Then, reactions were conducted based on the following protocols: 1 min at 48 °C, 60 min at 42 °C, 5 min at 95 °C, and held at 4 °C (Thermal Cycler, VWR, Radnor, PA, USA). Each experiment included an RT-negative and a no-template control (NTC). PCR samples were prepared to a final volume of 20 μL, containing 4 μL 5× PCR buffer, 4 μL 25 mM MgCl2, 0.7 μL Thermo-Start DNA polymerase (GenomeLab™ GeXP Start Kit, Beckman Coulter, Brea, CA, USA), 2 μL of primers plex (10 pM), and 9.3 μL of cDNA samples from the RT plate. PCRs were conducted in a thermal cycler (VWR) under the following conditions: 10 min at 95 °C, followed by 40 cycles of 30 s at 94 °C, 30 s at 55 °C, and 1 min at 68 °C, and then the reactions were held at 4 °C. Then, the GeXP fragment and data analyses followed the manufacturer’s instructions (Beckman Coulter, Brea, CA, USA). Aliquots of 1 μL from the PCR products were added to the appropriate wells of a 96-well microplate. DNA size standard 400 (0.5 mL, GenomeLab™ GeXP Start Kit, Beckman Coulter, Brea, CA, USA) was added to 38.5 μL of sample loading solution, thoroughly mixed, and added to the 96-well microplate. The PCR product was separated based on the fragment size by capillary gel electrophoresis (GenomeLab™ GeXP Genetic Analysis System, Beckman Coulter, Brea, CA, USA). The strength of the dye signal was measured after normalization to kanR RNA, using the GeXP express profiler software, 3.1.(Beckman Coulter, Brea, CA, USA). Results were expressed as either absence (−) or different degrees of gene expression (+ weak, <100 units; ++ medium, 100–300 units; +++ high, >300 units).
Each primer contained universal tags (according to Beckman Coulter protocol) reverse primer contained a 19-nucleotide universal priming sequence at the 5′ end, and the forward primer consisted of an 18-nucleotide universal priming sequence at the 5′ end. Inside the GeXP PCR buffer were two pairs of primers labeled with D4dye, which were complementary to the 5′ end of the designed primers. All the PCR products were designed >3 bp apart, ranging from 60 bp to 150 bp, so that they could be distinguished by capillary electrophoresis analyses. In addition to the 2 genes of interest, each panel contained 1 housekeeping gene and Kanamycin RNA (kan RNA) that served as an external control. kan RNA can produce a peak at 325 bp after capillary electrophoresis.

2.10. GeXP Fragment and Data Analyses

The procedure for GeXP fragment and data analysis followed the manufacturer’s instructions. To the PCR products from the multiplex reaction were added l μL to the appropriate wells of a new 96-well sample microplate. A total of 0.5 μL DNA size standard 400 (GenomeLab GeXPStart Kit; Beckman Coulter, Brea, CA, USA) was added to 38.5 μL of sample loading solution with thorough mixing. The mixed solution was assembled and added to the 96-well sample microplate. The PCR product was separated based on fragment size by capillary gel electrophoresis (GeXP Genetic analysis system, Beckman Coulter, Brea, CA, USA). The strength of the dye signal was measured after normalization to KanR RNA. Normalization of the signals was performed in the GeXP express profiler software (Beckman Coulter, Brea, CA, USA)

3. Results and Discussion

Isolation of fructophilic bacteria from the intestinal tract of bees [6] resulted in the selection of different LAB, including Lpb. plantrum, Lactiplantibacillus pentosus, Loigolactobacillus iwatensis, Apb. kunkeei, and Weissela confusa. Honey bees’ intestinal tract harbors different microorganisms, including a variety of LAB, as previously identified for the studied Bulgarian bees [6]. It was interesting to observe that not all of the previously mentioned bees associated with species were fructose metabolic predominant isolates [6]; however, as the focus of our research was fructose metabolism and metabolic pathways modifications in LAB, we have selected Apb. kunkeei as the principal objective for current research. Moreover, based on previous investigations, two strains, AG8 and AG9, both identified as Apb. kunkeei (based on performed physiological, biochemical, and biomolecular test) showed predominance between isolates from the mentioned species [6] and was selected for further experiments.
After culturing the studied strains for 24 h on FYP medium with 1% fructose, 10% fructose, and 30% fructose, the final metabolites lactate, acetate, and ethanol obtained show that with increasing fructose concentration, the acetate/lactate ratio changes in favor of the acetate. In the metabolism of these bacteria, the amount of fructose affects the number of metabolic products, which is particularly characteristic of Apb. kunkeei AG8 and AG9 strains. A negligible amount of ethanol was formed in these two strains. The modification of end products confirms that fructophilic lactic acid bacteria are heterofermentative (Table 2).
Data on the activity of key enzymes of carbohydrate metabolism showed that fructokinase was induced in the presence of a higher amount of fructose, its activity being twice as high at 30% fructose compared to 10% fructose.
Alcohol dehydrogenase was not active at any of the fructose concentrations used; therefore, it is a feature in the final stages of fructose metabolism in the fructophilic bacteria studied.
The activity of acetate kinase and L-lactate dehydrogenase was different at different percentages of fructose. A difference was also observed in the ratio between the two enzymes, being 1:1 at 1% fructose and sensitively shifting to 10:1 and even 15:1 in some strains in favor of acetate kinase. The data unequivocally indicate a permanent inhibition of L-lactate dehydrogenase occurring when cultured in medium with 30% fructose, which also explains the change in metabolic products at the end of fermentation. FLAB prefer fructose over glucose as a growth substrate, and their growth on glucose is limited or delayed compared to that on fructose. Glucose is usually the best substrate for other LAB, and these characteristics clearly distinguish FLAB from most LAB. Obligate FLAB grow well on fructose but poorly on glucose [6]. However, growth on glucose is stimulated when the medium is supplemented with pyruvate or fructose or when the incubation is under aerobic conditions. This is due to the requirement for an external electron acceptor when glucose is metabolized. Pyruvate, fructose, and oxygen serve as the electron acceptors. Facultative FLAB are able to grow on glucose but at a delayed rate compared to growth on fructose [14]. Because of the deletion, they lack alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) activities, while Apb. kunkeei possesses ALDH activity, but lacks ADH activity. This results in a failure to convert acetyl phosphate to ethanol via acetaldehyde. Acetyl phosphate is instead converted to acetate by acetate kinase. During the production process of acetate, heterofermentative LAB generate an additional ATP, which results in the production of more biomass in these LAB. On the other hand, the ethanol production system is essential to maintain the NAD/NADH balance in the hetero-lactic phosphoketolase pathway [14].
Phosphorylation of monosaccharides is extremely important for carbohydrate metabolism in the prokaryotic cell. The phosphotransferase system includes two classes of proteins, sugar-specific (EII) and general (EI and HPr) enzymes that supply the cell with fructose-1-phosphate [15]. Fructokinases (Frk or ScrK; ATP:β-D-fructose-6-phosphotransferase) catalyze the transfer of γ-phosphate from ATP to the intracellular fructose molecule, resulting in fructose-6-phosphate [16].
Most of the bacteria having genes encoding fructokinases are located on the (frk) chromosome [17] or are part of the sucrose gene cluster (scrK, sacK or cscK) [16,18]. Therefore, microorganisms that use fructose as a sole carbon source must incorporate it into a specific metabolic pathway, which is not yet well understood. It has been suggested that the fructose-6-phosphate phosphoketolase pathway may be used [19]. The substrate for this catabolite pathway, fructose-6-phosphate, links various metabolic pathways such as N-acetyl hexose fermentation, galactose catabolism (Leloir pathway), and peptidoglycan synthesis.
The enzymes alcohol dehydrogenase and acetaldehyde dehydrogenase have a key role in the regeneration of NAD+ in the metabolic pathways of heterofermentative lactic acid bacteria [20]. Insufficient regeneration of NAD+ has been suggested to be the key to the fructophilic characteristic of some lactic acid bacteria. Bioinformatic analyses of some bacteria show that neither fructose-specific phosphoenolpyruvate phosphotransferases nor the sucrose gene cluster can transport phosphorylated fructose into the cell.
The results obtained by us, showing an increase in the amount of acetate as a final metabolite, when cultivating the studied shams in a medium with 30% fructose on the one hand and the activity of the enzymes fructokinase and acetate kinase on the other, give us reason to assume that the metabolic reactions from the phosphoketose metabolic pathway is shifted in the direction of obtaining fructose-6-phosvate and its transformation into acetyl phosphate with subsequent reduction to acetate in the absence of the possibility of obtaining lactate.
Lactobacilli are extremely important members of the human and animal microbiota, as well as the plant phyllosphere. The evolution and ecology of lactobacilli are shaped by niche adaptation and genome size reduction. Many species, for example, the Lactiplantibacillus plantarum, have genetic diversity that has allowed them to occupy distant ecological niches [21]. Other species of lactic acid bacteria are highly specialized and extensively reduce their genome. Examples are the insect-associated Fructilactobacillus fructivorans (Former Lactobacillus fructivorans) [22], Lactobacillus iners, species specialized in the female urogenital tract [23]; Limosilactobacillus reuteri (former Lactobacillus reuteri) is an intestinal symbiont in vertebrates [24]. Lactobacillus delbrueckii underwent a very late reduction in its genome during its adaptation in lactic acid fermentations [25]. On the other hand, fructophilic bacteria, Fructobacillus spp., possess significantly fewer protein-coding sequences (CDSs) in their small genomes and lack several metabolic systems, including respiratory chains, phosphotransferase systems, and ABC transporters [26]. The absence of the bifunctional alcohol/acetaldehyde dehydrogenase (adhE) gene, which is essential for lactic acid fermentation, has been reported to be absent in Fructobacillus spp. Loss of the adhE gene results in the production of acetate instead of ethanol and results in an NAD+/NADH imbalance in the heteroenzymatic phosphoketolase pathway [27].
Similar genomic features, such as a low number of CDSs in a small genome, have recently been reported for Apb. kunkeei, which has a significantly smaller genome compared to other lactobacilli [28]. The genome sizes of the 16 Apb. kunkeei strains ranged from 1.41 to 1.58 Mbp (mean ± SD, 1.54 ± 0.05 Mbp) and were significantly smaller than those of other lactobacilli. The genome size and number of CDSs in Apb. kunkeei are like those of Fructobacillus spp. (mean ± SD, 1.49 ± 0.30 Mbp and 1387 ± 132) [26], which share similar biochemical characteristics and habitats with Apb. kunkeei [14].
Acetate kinase is used to make acetate from acetyl phosphate instead of ethanol and is not actively used in heteroenzymatic ICDs for glucose metabolism, but is used when an additional electron acceptor is present [29]. Enzyme activity assays showed that Apb. kunkeei possessed ALDH activity but not ADH activity. This is also consistent with the genetic characterization of the adhE gene and the biochemical characteristics in Apb. kunkeei [14,26].
Apb. kunkeei was originally isolated from wine [30], but later also from some fructose-rich sources, including flowers and fruits [14], and is considered one of the main species present in the gut of bees [31,32]. Biochemical characterization of Apb. kunkeei bacteria reveal that the species is well adapted to fructose-rich substrates, grows well on fructose and poorly on glucose, and is thus classified as the only obligate fructophilic lactic acid bacteria in the lactobacilli [26]. Apb. kunkeei lives in close association with bees [33] and some of the strains produce bacteriocin-like substances that are active against Melissococcus plutonius, which causes a fatal disease of bee larvae [31,34]. Therefore, based on the observations in previous studies, some strains of Apb. kunkeei are considered a promising probiotic for honey bees [31,34]. Thus, Apb. kunkeei AG8 and AG9 will be further evaluated for their potential probiotic properties, including whole-genome sequencing and appropriate bioinformatic, biochemical, and physiological investigations regarding their safety and potential beneficial attributes for the honey bees.
Two strains were selected, Apb. kunkeei AG8 and AG9 were cultivated on FYP medium with 1% and 30% fructose and on glucose yeast extract polypeptone (GYP) 1% glucose medium at a temperature of 35 °C for 12 h. In the two Apb. kunkeei AG8 and AG9 strains, the gene expression levels of the enzymes involved in the absorption and transport of fructose were examined (Table 3). For the analysis of the gene expression levels of the enzymes, total RNA was isolated from an overnight culture according to the manufacturer’s protocol (Beckman Coulter).
RNA was extracted with the GeneMATRIX universal RNA purification kit from overnight culture, according to the manufacturer’s instructions (EURx, Gdańsk, Poland). The multiplex primers used in this study were designed using GeXP express Profiler software (Beckman Counter, Brea, CA, USA). The target enzymes for which the primers were used are described in Table 1.
To normalize expression levels, glu6 and kanR genes, housekeeping genes–glu6–gene for glucose-6-phosphate dehydrogenase and internal control kanR encoding Kanamycin from GeXP starter kit were used. The RT-Minus control and the external control (NTC) showed no expression of the enzymes, which is evidence that each peak shows the exact expression of the enzymes targeted by the present work.
Our results are clearly pointing the essential role of the ATP-binding cassette (ABC) transporters in the utilization of carbohydrates, as indicated by the expression of the “sugar ABC transporter ATP-binding protein.” Moreover, ABC transporters also contribute to the regulation of alcohol dehydrogenase expression during cultivation on studied sugars in the current study, where relations between levels of applied carbohydrates and gene expressions were recorded (Table 3).
The analysis revealed increased expression of genes related to carbohydrate metabolism and the ABC transporter sugar system in response to glucose and fructose treatments. These findings enhance our understanding of glucose and fructose metabolic pathways in Apb. kunkeei may help optimize its fermentation, biological relevance, and even probiotic effects as a novel complex feed additive with prebiotic benefits.
ABC transporters are a large family of transmembrane proteins that use ATP hydrolysis to actively transport various substrates, including sugars, lipids, and drugs, across cellular membranes. In the context of fructose metabolism, ABC transporters are particularly important in the gut and liver, where they help regulate the uptake and distribution of fructose and its derivatives. Moreover, fructose is absorbed in the small intestine primarily via facilitated diffusion through GLUT5 transporters. However, ABC transporters contribute indirectly by maintaining the balance of intracellular and extracellular molecules that influence fructose uptake. Via ABC transporters, the cells may export metabolic byproducts or regulate bile acid transport, which affects nutrient absorption. In the liver, fructose is rapidly phosphorylated and metabolized, and ABC transporters help shuttle metabolites and cofactors necessary for these reactions. On the other hand, in microbial systems such as the gut microbiome, ABC transporters are directly involved in importing glycosides and other complex carbohydrates that include fructose moieties. This activity influences host metabolism and energy balance.
Fructose promotes the fermentation of Apb. kunkeei more effectively than glucose, as indicated by the expression of genes for transport and utilization enzymes, such as ABC transporters. Alcohol dehydrogenase was expressed at reasonably similar levels during growth on different concentrations of glucose or fructose.
From the obtained results, shown in Table 3, it can be seen that strain Apb. kunkeei AG9 shows a well-expressed expression of the gene for the enzyme fructokinase, while in Apb. kunkeei AG8, the expression of this gene is significantly weaker. Fructokinase activity was also observed when cultured on FYP medium with 1% glucose in both strains; therefore, we cannot say that the expression of enzymes involved in fructose utilization is induced upon growth on fructose.
Alcohol dehydrogenase in both strains is low, which is completely consistent with the literature as a characteristic of fructophilic lactic acid bacteria. In the present analysis, we used Gl6Ph dehydrogenase as a reference gene to compare the expression of the enzymes. There is high expression in both strains. L-Lactate dehydrogenase expression was high in both strains.
Analysis of the expression of the genes encoding the enzymes, part of the ABC transporters, showed different levels of expression or a lack thereof in the different strains. In Apb. kunkeei AG9 and AG8 strains cultured on GYP medium with 1% glucose, no expression of the ABC transporter ATP-binding protein gene was observed. Expression of the bacteriocin ABC transporter gene was absent in both strains. This confirms the results obtained in the analysis of the antibacterial activity of the strain against test cultures.
As a result of the analyses carried out, as well as from the literary sources, the results obtained are included in the research of recent years. For example, publications on Lacticaseibacillus paracasei point to the fact that an ABC transport system may be involved in the uptake of fructo-oligosaccharides [35], which supports the hypothesis that fructo-oligosaccharides are transported by ABC transporters in Lactobacillus acidophilus [36].
Specific ABC transporter subfamilies are responsible for the export of antimicrobial peptides (eg, lantibiotics, bacteriocin, and competence peptides) [37], and these transporters are also able to export protein substrates. For example, ABC exporters are responsible for bacteriocin secretion in Lab. acidophilus [38] and Lpb. plantarum [39]. Using the bacteriocin predictor BAGEL [40], 3–12 putative bacteriocins were identified in the lactobacilli genome. Most genes encoding putative bacteriocins are genetically linked to genes encoding ABC exporters, supporting the idea that peptide export via ABC exporters is common in LAB.
It is already a scientific fact that LAB are an essential part of microbiota for all animals, including honey bees [41]. The honeybee digestive system’s microaerophilic conditions, 35 °C temperature, and nectar sugars are factors that are in favor of LAB growth [42]. These Gram-positive, nonsporulating, catalase-negative bacteria are tolerant to low pH and appear as rods or cocci; they actively metabolize carbohydrates for energy, resulting in production of lactic acid; ca be homofermentative (producing mainly lactic acid) or heterofermentative (producing substances like acetic acid or ethanol) [43]. Taxonomically, LAB fall under phyla Firmicutes and belong to the order Lactobacillales and included in six families Aerococcaceae, Carnobacteriaceae, Enterococcaceae, Lactobacillaceae, Leuconostocaceae, and Streptococcaceae [44].
Research has extensively examined LAB presence in honey bees. Vasquez et al. [45] identified 13 bacterial species, including the dominant Apb. kunkeei, in the honeybee crop. Olofsson and Vasquez [46] reported on 10 LAB phylotypes in the stomach, five closely related to Apb. kunkeei, and some not LAB species, such as Bifidobacterium asteroides or Bifidobacterium coryneforme, and five more distantly related to Lactobacillus. Vasquez et al. [47] documented Lactobacillus helveticus in the stomach. Forsgren et al. [48] isolated Apb. kunkeei, B. asteroides, and B. coryneforme from the crop. Olofsson et al. [49] further isolated several LAB strains, including Lactobacillus helsingborgensis, Lactobacillus kimbladii, Bombilactobacillus mellis, Bombilactobacillus mellifer, Lactobacillus melliventris, Lactobacillus apis, Lactobacillus kullabergensis, Apilactobacillus apinorum and Apb. kunkeei.
Iorizzo et al. [42] reported on 24 strains obtained from the stomach and midgut of Apis mellifera ligustica, an endemic Italian honeybee subspecies. In the stomach, they found ten different strains of Lpb. plantarum, three strains of Apb. kunkeei, one strain of Lactococcus lactis, and one strain of Fructobacillus fructosus. Moreover, the midgut contained eight strains of Apb. kunkeei and one strain of Lpb. plantarum [42].
LAB play a crucial role in honeybee physiology and nutrition. Bacteria like bifidobacteria, simonsiella, and lactobacilli produce short-chain fatty acids (SCFAs) such as acetic acid, aiding bee nutrition by supplementing their diet [50]. SCFAs are absorbed in the insect rectal wall, where most pollen and bacterial biomass accumulate. Among bee gut microbiota, Lactobacillus Firm-5 is the main producer of succinate and pimelate, while B. asteroides primarily produces valerate [43]. These intestinal bacteria provide additional nutrition during overwintering when food storage occurs in the rectum for extended periods [50].
Other types of FMCB commonly found in the intestinal tract of bees are from the genus Fructobacillus, recently identified as a separate genus, phylogenetically close to the genus Leuconostoc spp. The study revealed that Fructobacillus spp. possess significantly fewer protein-coding sequences (CDSs) in their small genomes and lack several metabolic systems, including respiratory chains, phosphotransferase systems, and ABC transporters. Furthermore, the bifunctional alcohol/acetaldehyde dehydrogenase gene (adhE) has been reported to be absent from the genome of Fructobacillus spp., which is essential for hetero-lactic fermentation. Loss of the adhE gene results in the production of acetate instead of ethanol and this will most probably result in an NAD+/NADH imbalance in the hetero-lactic phosphoketolase pathway, a hypothesis that merit additional research and confirmation. However, recent research suggests that the loss of adhE, an important gene for phenotypic convergence to FLAB, occurs through a specific evolutionary process (even this can be considered as scientific speculation and suggesting that additional research needs to be conducted with objective to prove this hypothesis) involving domain architecture decay and amino acid substitutions in several LAB lineages found in fructose-rich habitats. These findings indicate restricted evolutionary routes leading to genomic and molecular convergence among free-living bacterial clades [51,52]. This is somewhat different from the situation in Fructobacillus spp., since adhE and ALDH gene activity was not detected in them.
Similar genomic features, such as a low number of CDS in a small genome, have been reported for Apb. kunkeei. On the other hand, the behavior of fructophilic Apb. kunkeei has not been investigated at the genomic level so far. Apb. kunkeei has a significantly smaller genome compared to other lactobacilli. Functional gene classification and enzyme activity assays confirmed the hypothesis of reductive evolution among FMKB, especially in genes encoding enzymes of metabolic pathways [51,52].
As a result of the research conducted, we proved, based on the genetic analysis of the strains studied by 16S RNA, the presence in the intestinal tract of bees of Apb. kunkeei, which represent about 20% of the isolated strains of fructophilic bacteria. API-ZYM analysis revealed that enzymes of carbohydrate metabolism were absent in all strains except AG8 and AG9. Only these strains showed the presence of β-galactosidase, α-galactosidase, α- and β-glucosidase, β-glucoronidase, N-acetyl-β- glucosaminidase [6]. It was confirmed that the activity of some nitrogen metabolism enzymes was detected in the Apb. kunkeei strains isolated by us.
Data on the activity of key enzymes of carbohydrate metabolism showed that fructokinase was induced in the presence of a higher amount of fructose, its activity being twice as high at 30% fructose compared to 10% fructose. Alcohol dehydrogenase was not active at any of the fructose concentrations used; therefore, there is a feature in the final stages of fructose metabolism in the studied fructophilic bacteria [51].
The activity of acetate kinase and L-lactate dehydrogenase was different at different percentages of fructose. The data unequivocally speak of a permanent inhibition of L-lactate dehydrogenase occurring when cultured in medium with 30% fructose, which also explains the change in metabolic products at the end of fermentation.
LAB have been successfully applied as probiotics that contribute to the health of humans and various domestic and farm animals. Since lactic acid bacteria are important components in the gastrointestinal tract with a reported impact on the intestinal barrier mechanism, it is not surprising that lactic acid bacteria, especially fructophilic lactic acid bacteria, may be responsible for bee health.

4. Conclusions

Based on the data obtained, we can suggest that the metabolism of fructose was modified in the evolutionary process and strongly influenced by the environmental conditions. Adaptation processes in honey bees’ gut environmental microecosystem served as a force in the modification of the size of the genome of Apb. kunkeei where evolution and adaption were working in parallel. Some specific alterations in the metabolic pathways of fructose are good examples of this. The observations in the gut microbiota of honey bees were serving as a platform for the expansion of our knowledge on the role of Apb. kunkeei and metabolism of fructose, and philosophically and practically, the idea of the importance of honey bees for the ecological balance and well-being of life on the earth. Albert Einstein was quoted that the day when honey bees are extended, life on the planet will be in peril.
Apb. kunkeei strains AG8 and AG9 cultivated on FYP medium with varying fructose concentrations (1%, 10%, and 30%) showed that higher fructose levels promoted acetate production over lactate. Ethanol production was negligible; however, this was expected as ADH activity was not recorded. In performed enzyme assays it was shown that fructokinase activity was stimulated at FYP supplemented with 30% fructose; however, L-lactate dehydrogenase activity decreased. It was observed to lack ADH but retain ALDH activity, enabling acetate production and additional ATP generation, enhancing biomass yield. It was suggested that the absence of the adhE gene contributes to NAD+/NADH imbalance and favors acetate production. ADH expression remained low across sugar concentrations on strain specific levels. These findings underscore the metabolic specialization of Apb. kunkeei, its reliance on fructose, and the role of ABC transporters in optimizing fermentation processes. The strain-specific gene expression and metabolic flexibility highlight its potential as a probiotic and feed additive in apiculture and biotechnology. Adaption processes in honey bees gut environmental microecosystem was served as a force in the modification of the size of the genome of Apb. kunkeei, where evolution and adaptation were working in parallel. Some specific alterations in the metabolic pathways of fructose are good examples of this. The observations in the gut microbiota of honey bees was serving as platform for the prefunding of our knowledge on the role of Apb. kunkeei and metabolism of fructose, and philosophically and practically the idea of importance of honey bees for the ecological balance and well-being of life on the earth. Albert Einstein was quoted that the day when honey bees will be extended, the life on the planet will be despaired.

Author Contributions

Concept: I.V.I., I.I. and S.D.T.; methodology: I.V.I., Y.R. and M.A.; Investigation: Y.R. and M.A.; Data curation: I.V.I., Y.R. and I.I.; Formal analysis: Y.R. and M.A.; Supervision: I.V.I., I.I. and S.D.T.; Funding Acquisition: I.V.I.; Writing—Original Draft Preparation: Y.R., S.D.T. and I.V.I.; Writing—Review and Editing: S.D.T. and I.V.I. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by European Union-Next Generation EU, through the National Recovery and Resilience Plan of the Republic of Bulgaria, project Nr BG-RRP-2.004-0001-C01, DUECOS and by the Sao Paulo Research Foundation (FAPESP) (grants 2023/05394-9; 2024/01721-8), Sao Paulo, SP, Brazil.

Institutional Review Board Statement

The reported study does not involve the results of any in vivo intervention experiments.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and comply with research standards.

Conflicts of Interest

The authors declare no competing interest.

References

  1. Dardir, H.A. In vitro evaluation of probiotic activities of lactic acid bacteria strains isolated from novel probiotic dairy products. Global Vet. 2012, 8, 190–196. [Google Scholar]
  2. Klaenhammer, T.R.; Barrangou, R.; Buck, B.L.; Azcarate-Peril, M.A.; Altermann, E. Genomic feature of lactic acid bacteria effecting bioprocessing and health. FEMS Microbiol. Rev. 2005, 29, 393–409. [Google Scholar] [CrossRef] [PubMed]
  3. Oprea, S.E.; Zervos, M.J. Enterococcus and Its Association with Foodborne Illness; Humana Press Inc.: Clifton, NJ, USA, 2007. [Google Scholar]
  4. König, H.; Unden, G.; Fröhlich, J. (Eds.) Biology of Microorganisms on Grapes, in Must and in Wine (Chapter 1); Springer: Berlin/Heidelberg, Germany, 2009; pp. 3–29. [Google Scholar]
  5. Silva, M.S.; Rabadzhiev, Y.; Eller, M.R.; Iliev, I.; Ivanova, I.; Santana, W.C. Microorganisms in Honey. Honey Anal. 2017, 500, 233–257. [Google Scholar] [CrossRef] [Scilit]
  6. Rabadjiev, Y.; Christova, P.; Iliev, I.; Ivanova, I. Identification of lactic acid bacteria flora within the honey intestinal tract of Apis millifera from different regions of Bulgaria. J. Biosci. Biotechnol. 2016, 215–224. [Google Scholar]
  7. Todorov, S.D.; Baretto Penna, A.L.; Venema, K.; Holzapfel, W.H.; Chikindas, M.L. Recommendations for the use of standardized abbreviations for the former Lactobacillus genera, reclassified in the year 2020. Benef. Microbes 2003, 15, 1–4. [Google Scholar] [CrossRef] [Scilit]
  8. Günther, M.A.; Sillero, A.; Sols, A. Fructokinase assay with a specific spectrophotometric method using 1-phosphofructokinase. Enzymol. Biol. Clin. 1967, 8, 341–352. [Google Scholar] [CrossRef] [Scilit]
  9. Maekawa, M. Lactate dehydrogenase isoenzymes. J. Chromatogr. 1988, 429, 373–398. [Google Scholar] [CrossRef] [Scilit]
  10. Fibla, J.; Gonzalez-Duarte, R. Colorimetric assay to determine alcohol dehydrogenase activity. J. Biochem. Biophys. Methods 1993, 26, 87–93. [Google Scholar] [CrossRef] [Scilit]
  11. Ferry, J.G. Acetate kinase and phosphotransacetylase. Meth. Enzymol. 2011, 494, 219–231. [Google Scholar] [CrossRef] [Scilit]
  12. Ananieva, M.; Tzenova, M.; Iliev, I.; Ivanova, I. Gene expression of enzymes involved in utilization of xylooligosaccharides by Lactobacillus strains. Biotechnol. Biotechnol. Equip. 2014, 28, 941–948. [Google Scholar] [CrossRef] [Scilit]
  13. Cavicchioli, V.Q.; Todorov, S.D.; Iliev, I.; Ivanova, I.; Drider, D.; Nero, L.A. Physiological and molecular insights of bacteriocin production by Enterococcus hirae ST57ACC from Brazilian artisanal cheese. Braz. J. Microbiol. 2019, 50, 369–377. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Endo, A.; Futagawa-Endo, Y.; Dicks, L.M.T. Isolation and characterization of fructophilic lactic acid bacteria from fructose-rich niches. Syst. Appl. Microbiol. 2009, 32, 593–600. [Google Scholar] [CrossRef] [Scilit]
  15. Nothaft, H.; Parche, S.; Kamionka, A.; Titgemeyer, F. In vivo analysis of HPr reveals a fructose-specific phosphotransferase system that confers high-affinity uptake in Streptomyces coelicolor. J. Bacteriol. 2003, 185, 929–937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Aulkemeyer, P.; Ebner, G.; Heilenmann, K.; Jahreis, K.; Schmid, K.; Wrieden, S.; Lengeler, J.W. Molecular analysis of two fructokinases involved in sucrose metabolisms of enteric bacteria. Mol. Microbiol. 1991, 5, 2913–2922. [Google Scholar] [CrossRef] [Scilit]
  17. Fennington, G.J.; Hughes, T.A. The fructokinase from Rhizobium leguminosarum biovar trifolii belongs to group I fructokinase enzymes and is encoded separately from other carbohydrate metabolism enzymes. Microbiology 1996, 142 Pt 2, 321–330. [Google Scholar] [CrossRef] [Scilit]
  18. Jiang, S.-Y.; Chi, Y.-H.; Wang, J.-Z.; Zhou, J.-X.; Cheng, Y.-S.; Zhang, B.-L.; Ma, A.; Vanitha, J.; Ramachandran, S. Sucrose metabolism gene families and their biological functions. Sci. Rep. 2015, 5, 17583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. de Vries, W.; Stouthamer, A.H. Pathway of glucose fermentation in relation to the taxonomy of bifidobacteria. J. Bacteriol. 1967, 93, 574–576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Edenberg, H.J.; McClintick, J.N. Alcohol dehydrogenases, aldehyde dehydrogenases, and alcohol use disorders: A Critical Review. Alcohol. Clin. Exp. Res. 2018, 42, 2281–2297. [Google Scholar] [CrossRef] [Scilit]
  21. Siezen, R.J.; van Hylckama Vlieg, J.E. Genomic diversity and versatility of Lactobacillus plantarum, a natural metabolic engineer. Microb. Cell Factories 2011, 10 (Suppl. S1), S3. [Google Scholar] [CrossRef] [Scilit]
  22. Wong, C.N.A.; Ng, P.; Douglas, A.E. Low-diversity bacterial community in the gut of the fruitfly Drosophila melanogaster. Environ. Microbiol. 2011, 13, 1889–1900. [Google Scholar] [CrossRef] [Scilit]
  23. Mendes-Soares, H.; Suzuki, H.; Hickey, R.J.; Forney, L.J. Comparative functional genomics of Lactobacillus spp. reveals possible mechanisms for specialization of vaginal lactobacilli to their environment. J. Bacteriol. 2014, 196, 1458–1470. [Google Scholar] [CrossRef] [Scilit]
  24. Oh, P.L.; Benson, A.K.; Peterson, D.A.; Patil, P.B.; Moriyama, E.N.; Roos, S.; Walter, J. Diversification of the gut symbiont Lactobacillus reuteri as a result of host-driven evolution. ISME J. 2010, 4, 377–387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. van de Guchte, M.; Penaud, S.; Grimaldi, C.; Barbe, V.; Bryson, K.; Nicolas, P.; Robert, C.; Oztas, S.; Mangenot, S.; Couloux, A.; et al. The complete genome sequence of Lactobacillus bulgaricus reveals extensive and ongoing reductive evolution. Proc. Natl. Acad. Sci. USA 2006, 103, 9274–9279. [Google Scholar] [CrossRef] [Scilit]
  26. Endo, A.; Irisawa, T.; Futagawa-Endo, Y.; Takano, K.; du Toit, M.; Okada, S.; Dicks, L.M.T. Characterization and emended description of Lactobacillus kunkeei as a fructophilic lactic acid bacterium. Int. J. Syst. Evol. Microbiol. 2012, 62, 500–504. [Google Scholar] [CrossRef] [Scilit]
  27. Endo, A.; Okada, S. Reclassification of the genus Leuconostoc and proposals of Fructobacillus fructosus gen. nov., comb. nov., Fructobacillus durionis comb. nov., Fructobacillus ficulneus comb. nov. and Fructobacillus pseudoficulneus comb. nov. Int. J. Syst. Evol. Microbiol. 2008, 58, 2195–2205. [Google Scholar] [CrossRef] [Scilit]
  28. Tamarit, D.; Ellegaard, K.M.; Wikander, J.; Olofsson, T.; Vásquez, A.; Andersson, S.G.E. Functionally structured genomes in Lactobacillus kunkeei colonizing the honey crop and food products of honeybees and stingless bees. Genome Biol. Evol. 2015, 7, 1455–1473. [Google Scholar] [CrossRef] [Scilit]
  29. Zaunmüller, T.; Eichert, M.; Richter, H.; Unden, G. Variations in the energy metabolism of biotechnologically relevant heterofermentative lactic acid bacteria during growth on sugars and organic acids. Appl. Microbiol. Biotechnol. 2006, 72, 421–429. [Google Scholar] [CrossRef] [Scilit]
  30. Edwards, C.G.; Haag, K.M.; Collins, M.D.; Hutson, R.A.; Huang, Y.C. Lactobacillus kunkeei sp. nov.: A spoilage organism associated with grape juice fermentations. J. Appl. Microbiol. 1998, 84, 698–702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Endo, A.; Salminen, S. Honeybees and beehives are rich sources for fructophilic lactic acid bacteria. Syst. Appl. Microbiol. 2013, 36, 444–448. [Google Scholar] [CrossRef] [Scilit]
  32. Vojvodic, S.; Rehan, S.M.; Anderson, K.E. Microbial gut diversity of Africanized and European honey bee larval instars. PLoS ONE 2013, 8, e72106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Rangberg, A.; Mathiesen, G.; Amdam, G.V.; Diep, D.B. The paratransgenic potential of Lactobacillus kunkeei in the honey bee Apis mellifera. Benef. Microbes 2015, 6, 513–524. [Google Scholar] [CrossRef] [Scilit]
  34. Todorov, S.D.; Alves, M.V.; Bueno, G.C.A.; Alves, V.F.; Ivanova, I.V. Bee-associated beneficial microbes—Importance for bees and for humans. Insects 2024, 15, 430. [Google Scholar] [CrossRef] [Scilit]
  35. Kaplan, H.; Hutkins, R.W. Metabolism of fructooligosaccharides by Lactobacillus paracasei 1195. Appl. Environ. Microbiol. 2003, 69, 2217–2222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Barrangou, R.; Azcarate-Perll, M.; Doung, T.; Conners, S.; Kelly, R.; Klaenhammer, T. Global analiysis of carbohydrate utilization by Lactobacillus acidophilus using cDNA microarrays. Proc. Natl. Acad. Sci. USA 2006, 103, 3816–3821. [Google Scholar] [CrossRef] [Scilit]
  37. Havarstein, L.S.; Diep, D.B.; Nes, I.F. A family of bacteriocin ABC transporters carry out proteolytic processing of their substrates concomitant with export. Mol. Microbiol. 1995, 16, 229–240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Dobson, A.E.; Sanozky-Dawes, R.B.; Klaenhammer, T.R. Identification of an operon and inducing peptide involved in the production of lactacin B by Lactobacillus acidophilus. J. Appl. Microbiol. 2007, 103, 1766–1778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Diep, D.B.; Håvarstein, L.S.; Nes, I.F. Characterization of the locus responsible for the bacteriocin production in Lactobacillus plantarum C11. J. Bacteriol. 1996, 178, 4472–4483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. de Jong, A.; van Hijum, S.A.; Bijlsma, J.J.; Kok, J.; Kuipers, O.P. BAGEL: A web-based bacteriocin genome mining tool. Nucleic Acids Res. 2006, 34, W273–W279. [Google Scholar] [CrossRef] [Scilit]
  41. Piccart, K.; Vásquez, A.; Piepers, S.; De Vliegher, S.; Olofsson, T.C. Short communication: Lactic acid bacteria from the honeybee inhibit the in vitro growth of mastitis pathogens. J. Dairy Sci. 2016, 99, 2940–2994. [Google Scholar] [CrossRef] [Scilit]
  42. Iorizzo, M.; Pannella, G.; Lombardi, S.J.; Ganassi, S.; Testa, B.; Succi, M.; Sorrentino, E.; Petrarca, S.; De Cristofaro, A.; Coppola, R.; et al. Inter- and intra-species diversity of lactic acid bacteria in Apis mellifera ligustica colonies. Microorganisms 2020, 8, 1578. [Google Scholar] [CrossRef] [Scilit]
  43. Zheng, H.; Steele, M.I.; Leonard, S.P.; Motta, E.V.S.; Moran, N.A. Honey bees as models for gut microbiota research. Lab. Animal. 2018, 47, 317–325. [Google Scholar] [CrossRef] [Scilit]
  44. Zheng, J.; Wittouck, S.; Salvetti, E.; Franz, C.M.A.P.; Harris, H.M.B.; Mattarelli, P.; O’Toole, P.W.; Pot, B.; Vandamme, P.; Walter, J.; et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 2782–2858. [Google Scholar] [CrossRef] [Scilit]
  45. Vásquez, A.; Forsgren, E.; Fries, I.; Paxton, R.J.; Flaberg, E.; Szekely, L.; Olofsson, T.C. Symbionts as major modulators of insect health: Lactic acid bacteria and honeybees. PLoS ONE 2012, 7, e33188. [Google Scholar] [CrossRef] [Scilit]
  46. Olofsson, T.C.; Vásquez, A. Detection and identification of a novel lactic acid bacterial flora within the honey stomach of the honeybee Apis mellifera. Curr. Microbiol. 2008, 57, 356–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Vásquez, A.; Olofsson, T.C.; Sammataro, D. A scientific note on the lactic acid bacterial flora in honeybees in the USA—A comparison with bees from Sweden. Apidologie 2008, 40, 26–28. [Google Scholar] [CrossRef] [Scilit]
  48. Forsgren, E.; Olofsson, T.C.; Vásquez, A.; Fries, I. Novel lactic acid bacteria inhibiting Paenibacillus larvaein honey bee larvae. Apidologie 2009, 41, 99–108. [Google Scholar] [CrossRef] [Scilit]
  49. Olofsson, T.C.; Butler, È.; Markowicz, P.; Lindholm, C.; Larsson, L.; Vásquez, A. Lactic acid bacterial symbionts in honeybees—An unknown key to honey’s antimicrobial and therapeutic activities. Int. Wound J. 2014, 13, 668–679. [Google Scholar] [CrossRef] [Scilit]
  50. Martinson, V.G.; Danforth, B.N.; Minckley, R.L.; Rueppell, O.; Tingek, S.; Moran, N.A. A simple and distinctive microbiota associated with honey bees and bumble bees. Mol. Ecol. 2010, 20, 619–628. [Google Scholar] [CrossRef] [Scilit]
  51. Kanno, N.; Maeno, S.; Tanizawa, Y.; Arita, M.; Endo, A.; Iwasaki, W. Evolutionary pathways toward multi-level convergence of lactic acid bacteria in fructose-rich environments. Commun. Biol. 2024, 7, 902. [Google Scholar] [CrossRef] [Scilit]
  52. Maeno, S.; Tanizawa, Y.; Kanasaki, Y.; Kubuta, E.; Kumar, H.; Dicks, L.; Salmnien, S.; Makagawa, J.; Arita, M.; Endo, A. Genomic characterization of a fructophilic bee symbiont Lactobacillus kunkeei reveals its niche-specific adaptation. Syst. Appl. Microbiol. 2016, 39, 516–526. [Google Scholar] [CrossRef] [Scilit]
Table 1. Primers used in the study expression of genes associated with fructose metabolism by Apilactobacillus kunkeei AG8 and AG9, referring to the name of the primers, their sequence, the biological function of targeted genes, and the expected length of the generated PCR products.
Table 1. Primers used in the study expression of genes associated with fructose metabolism by Apilactobacillus kunkeei AG8 and AG9, referring to the name of the primers, their sequence, the biological function of targeted genes, and the expected length of the generated PCR products.
PrimersSequence of the Applied PrimersBiological Function of Targeted GeneLength of the Generated PCR Product (bp)
gluc F
gluc R
AGGTGACACTATAGAATATCTTTGGCGGTACTGGTGAC
GTACGACTCACTATAGGGATGTTGGGCAATCGTACCGAA
Glucose-6-phosphate 1-dehydrogenase120 bp
dhL1 F
dhL1 R
AGGTGACACTATAGAATATCTGCGGCAAAGTACCCAAT
GCCGGATTATTCGCAAGCAGGTACGACTCACTATAGGGA
Malat/L-lactate-dehydrogenase151 bp
fruc F
fruc R
AGGTGACACTATAGAATACCAGCTGCTACCCCTTCAAA
GTACGACTCACTATAGGGAGAAGCGGGCGGTACTAAGTT
Fructokinase460 bp
aldeh F
aldeh R
AGGTGACACTATAGAATACAATTGGCTCGGCCATTACG
GTACGACTCACTATAGGGACCATTTGCTGCCGATCTTCG
Alcohol dehydrogenase430 bp
zj316_2428 F
zj316_2428 R
AGGTGACACTATAGAATACGGTTCCGTCGAACCTAACA
ATAAGCGGTTGTCAGGCGAAGTACGACTCACTATAGGGA
Efflux ABC transporter, ATP-binding and permease protein347 bp
lbp_cg0987 F
lbp_cg0987 R
AGGTGACACTATAGAATATCAACGGCAACGAGTAGCTT
TGGACCTGACCAGATTGTGCGTACGACTCACTATAGGGA
Sugar ABC transporter, ATP-binding protein280 bp
jdm1_2227 F
jdm1_2227 R
AGGTGACACTATAGAATACGGTCCAAATTTGTTGCCGT
TTAGGGATGGAGGCTGTGGAGTACGACTCACTATAGGGA
ABC transporter ATP-binding protein200 bp
gluc F
gluc R
AGGTGACACTATAGAATATCTTTGGCGGTACTGGTGAC
GTACGACTCACTATAGGGATGTTGGGCAATCGTACCGAA
Glucose-6-phosphate 1-dehydrogenase
Primers designed on full genome of Lactiplantibacillus plantarum subsp. plantarum ST-III (CP0022221).
Table 2. Values of evaluated metabolites and activity of key enzymes of carbohydrate metabolism after 24 h of culturing the isolates on FYP. Both strains (Apb. kunkeei AG8 and Apb. kunkeei AG9) were cultured in FYP media supplemented with 1%, 10% and 30% fructose, respectively.
Table 2. Values of evaluated metabolites and activity of key enzymes of carbohydrate metabolism after 24 h of culturing the isolates on FYP. Both strains (Apb. kunkeei AG8 and Apb. kunkeei AG9) were cultured in FYP media supplemented with 1%, 10% and 30% fructose, respectively.
Apb. kunkeei AG8Apb. kunkeei AG9
FYP supplemented with 1% fructoseAcetate (g/L)1.62 ± 0.222.5 ± 0.24
Lactate (g/L)0.54 ± 0.080.37 ± 0.06
Ratio acetate/lactate75%:25%87%:13%
Ethanol (g/L)00
Acetatekinase
(U/mg protein)
0.78 ± 0.071.01 ± 0.08
L-lactate dehydrogenase (U/mg protein)0.24 ± 0.060.17 ± 0.04
Fructokinase (U/mg protein)0.64 ± 0.060.69 ± 0.06
Acoholdehydrogenase (U/mg protein)00
FYP supplemented with 10% fructoseAcetate (g/L)2.1 ± 0.213.2 ± 0.24
Lactate (g/L)0.09 ± 0.010.12 ± 0.01
Ratio acetate/lactate96%:4%96%:4%
Ethanol (g/L)00
Acetatekinase
(U/mg protein)
0.53 ± 0.051.61 ± 0.09
L-lactate dehydrogenase (U/mg protein)0.11 ± 0.020.13 ± 0.02
Fructokinase (U/mg protein)1.06 ± 0.121.09 ± 0.12
Acoholdehydrogenase (U/mg protein)00
FYP supplemented with 30% fructose Acetate (g/L)3.22 ± 0.213.35 ± 0.23
Lactate (g/L)0.023 ± 0.0020.048 ± 0.002
Ratio acetate/lactate99%:1%99%:1%
Ethanol (g/L)0.011 ± 0.0020.049 ± 0.004
Acetatekinase
(U/mg protein)
1.81 ± 0.181.95 ± 0.16
L-lactate dehydrogenase (U/mg protein)0.06 ± 0.0020.05 ± 0.002
Fructokinase (U/mg protein)1.96 ± 0.231.98 ± 0.20
Acoholdehydrogenase (U/mg protein)0.11 ± 0.020.25 ± 0.02
Table 3. Expression levels of the genes responsible for the following: Gl6Ph dehydrogenase, L-lactate dehydrogenase, Fructokinase, Alcohol dehydrogenase, Efflux ABC transporter, Sugar ABC permease, and ABC transporter ATP-binding protein of two of the studied AG8 strains on media–FYP 30%, FYP 1%, GYP 1%. Genes are shown “+”–weak expression (less than 100 units); “++”–average expression (between 100 and 300 units); “+++”–high expression (more than 300 units).
Table 3. Expression levels of the genes responsible for the following: Gl6Ph dehydrogenase, L-lactate dehydrogenase, Fructokinase, Alcohol dehydrogenase, Efflux ABC transporter, Sugar ABC permease, and ABC transporter ATP-binding protein of two of the studied AG8 strains on media–FYP 30%, FYP 1%, GYP 1%. Genes are shown “+”–weak expression (less than 100 units); “++”–average expression (between 100 and 300 units); “+++”–high expression (more than 300 units).
The Biological Importance of the Enzyme Apb. kunkeei AG8Apb. kunkeei AG9
GYP 1% GlucoseFYP 1% FructoseFYP 30% FructoseGYP 1% GlucoseFYP 1% FructoseFYP 30% Fructose
Glucose-6-phosphate 1-dehydrogenaseAn enzyme of the pentose phosphate pathway ++++++++++++++++++
L-lactate-dehydrogenaseConverts pyruvate into L-lactate+++++++++++++++
FructokinasePhosphorylation of fructose++-+++++
Alcohol dehydrogenaseOxidoreductase for transformation of alcohols to aldehyde and ketone++++++
Efflux ABC transporter, ATP-binding and permease proteinParticipates in the transport of sugars across the cell membrane++--+++++++
Sugar ABC transporter, ATP-binding proteinPromotes the entry of sugars into the cell, associated with ATP hydrolysis++++++++++++-
ABC transporter ATP-binding proteinProvides the energy for the passage of substrates through the cell wall-++--++++
Levels of expression of enzyme genes shown as “+”—weak expression (lower that 100 units); “++”—medium expression (between 100 and 300 units); “+++”—higher expression (more than 300 units)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ivanova, I.V.; Rabadjiev, Y.; Ananieva, M.; Iliev, I.; Todorov, S.D. Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees. Appl. Microbiol. 2025, 5, 130. https://doi.org/10.3390/applmicrobiol5040130

AMA Style

Ivanova IV, Rabadjiev Y, Ananieva M, Iliev I, Todorov SD. Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees. Applied Microbiology. 2025; 5(4):130. https://doi.org/10.3390/applmicrobiol5040130

Chicago/Turabian Style

Ivanova, Iskra Vitanova, Yavor Rabadjiev, Maria Ananieva, Ilia Iliev, and Svetoslav Dimitrov Todorov. 2025. "Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees" Applied Microbiology 5, no. 4: 130. https://doi.org/10.3390/applmicrobiol5040130

APA Style

Ivanova, I. V., Rabadjiev, Y., Ananieva, M., Iliev, I., & Todorov, S. D. (2025). Specificity of Gene Expression in Fructose Metabolism in Apilactobacillus kunkeei Isolated from Honey Bees. Applied Microbiology, 5(4), 130. https://doi.org/10.3390/applmicrobiol5040130

Article Metrics

Back to TopTop